Department of Higher Education - Madhya Pradesh

34965557 bids are invited for sl. no. item title item description 1 1 containers 2 2 sauce pan with lid 3 3 fry pan 4 4 tava roti/ tava dosa 5 5 parrat 6 6 grater(multipurpose) 7 7 patila with lid 8 8 kadchhi 9 9 knife all types 10 10 peeler/ chamcha/ chimta/jhara/ masala dabba 11 11 cutlery set 12 12 chakla belan 13 13 kadahi with lid 14 14 dinner set (steel) 15 15 bucket/ dustbin/ tub 16 16 pressure cooker 17 17 lighter 18 18 tray 19 19 crockeries (tea set borosil glasses) 20 20 namak daniset 21 21 stiching material—needle box 22 22 gas chula with cylinder/ chimini 23 23 indection 24 24 paper napkins/ cloth napkin/ table mat 25 25 model parts of flower/ kidney/brain/heart/human eye& ear 26 26 weighting machine digital 27 27 sonometer sccale 28 28 scale electronice 29 29 weight sclae 6kg 30 30 calcium oxide 31 31 clycerol 32 32 iodine solution 33 33 phenol 34 34 glacial acetic acid 35 35 safferemine 36 36 potassium mydroxide 37 37 canada balson 38 38 fehling solution 39 39 calcium chloride 40 40 acid accumulator 41 41 cylender noggel/ regulator/rubber set 42 42 bottele opener 43 43 sweing machine 44 44 washing machine 45 45 fabric colour set 46 46 bad sheet 47 47 soffa set cover 48 48 dinning table cover 49 49 vacume cleaner 50 50 hair cap/ aprin 51 51 microwave 52 52 phillips otg 53 53 toster 54 54 grill sandwich maker 55 55 hand grinder 56 56 steel bartan set 57 57 coffe maker 58 58 mixer /grider/ juicer 59 59 all types seaser 60 60 water coler 20 l 61 61 aquagurd 62 62 modular kitchen 63 63 autoclave portable 21l 64 64 autoclave portable50l 65 65 dissecting microscope 66 66 binocular microscope 67 67 deep freezer 68 68 compoundmicroscope 69 69 high defination microscope 70 70 microscopic eye pic 71 71 triangular microscope 72 72 ganong respirometer 73 73 hot air oven 14x14x14 74 74 magnetic stirrer with hot plate 75 75 maximum minimum thermometer 76 76 micro pipette variable 1 5ml 77 77 uv chromatographic chamber 78 78 ph meter ( digital ) with elctrodes 79 79 thin layer chromatography apparatus 80 80 water bath double wall ( 12 holes) ss 81 81 bod incubator 82 82 digital colony counter 83 83 digital tds meter 84 84 flame photometer 85 85 interactive led panel 86 86 digital thermometer 87 87 projection microscope 88 88 betological incubator stainless steel 89 89 laminar air flow horizontal 90 90 hair dryer 91 91 homogenizer 92 92 distillation apparatus doubledistillation 93 93 micro kjeldahl & distillation apparatus 94 94 soxhlet extraction unit 95 95 vortex shaker 96 96 auxanometer 97 97 computer system with licenced operating system internet facility 98 98 farmer potometer / ganog potometer 99 99 water and soil analysis testing kit (digital ) 100 100 tissue culture rack ( caster rack ) 101 101 blackman apparatus 102 102 gel electrophoresis unit with power supply 103 103 heating mantle with regulator cap 1 litre 104 104 occular micrometer/ stage micrometer 105 105 stem borer 106 106 cod analyzer multi parameter beanch 107 107 oxygen electrode 108 108 rotatory microtome 109 109 specimen 20pices 110 110 botany/zoology/physics/chemistry/home science map 111 111 digital spectrophotometer 112 112 blood pressure machine 113 113 plant collection net 114 114 centrifuge machine 115 115 glucometer 116 116 inverter 117 117 laboratory stirrer 118 118 insect collection net 119 119 chemical blance digital 0.01 to 600gm 120 120 chemical cabinet storage 121 121 rotary vane vaccume pump 122 122 oil free vacuum pump 123 123 muffle furnace 124 124 refrigerator 125 125 digital melting pint apparatus 126 126 karl fisher titrator 127 127 student polarimeter 128 128 digital conductivity meter 129 129 digital photo colorimeter 130 130 dissolved oxygen meter 131 131 flask shaker ( wrist action type ) 132 132 screw guage/ vernier calipers 133 133 ammeter dc/ac 134 134 stop watch digital / stop clock 135 135 analog multimeter /digital multi meter 136 136 voltmeter dc/ac / galvanometer 137 137 spectrometer prism ( crown/ flint glass) 138 138 thermometer different range 139 139 analog to digital converter power supply 140 140 rheostat ( various length ) 141 141 battery eliminator 142 142 apparatus to study specific resistance energy gap 143 143 apparatus to study characteristics tunnel 144 144 apparatus to study characteristics of zener diode 145 145 anderson/schering/hay/kelvin/maxwell 146 146 apparatus to study rc coupled amplifier power supply 147 147 audio frequency generator 148 148 laclanche cell 149 149 function generator 1 hz to 10 mhz 150 150 battery charger 2 to 12 volt 151 151 apparatus to study response curve for lcr 152 152 apparatus to draw b h curve of ferromagnetic 153 153 complete apparatus to determine the heating 154 154 potentiometer 155 155 mos fet/ fet characteristics apparatus 156 156 half adder /full adder/half subtractor 157 157 half wave and full wave rectifier apparatus 158 158 zener regulated power supply 159 159 8085/8086 microprocessor kit 160 160 photo diode characteristics apparatus 161 161 digital to analog converter with built in power 162 162 travelling microscope 163 163 series and parallel resonance circuit 164 164 solar cell characteristics apparatus 165 165 encoder and decoder circuit with built in power 166 166 cro dual trace 30/40 mhz 167 167 plancks constant using solar cell apparatus 168 168 function generator 0 3 to 30 mhz 169 169 vibration magnetometer 170 170 single stage and double stage r c couple 171 171 power amplifier ( trainer board) 172 172 variable regulated dc power supply 0 30v range 173 173 scr / ujt characteristics apparatus 174 174 horizontal torsion apparatus 175 175 multiplexers and demultiplexers with built in 176 176 stefan constant apparatus 177 177 regulated power supply trainer board 178 178 dielectric constant apparatus 179 179 thermistor characteristic apparatus 180 180 drill machine with all size bits (hammer) 181 181 bread board (trainer kit) 182 182 study of amplitude modulation and demodulation 183 183 digital ic trainer kit 184 184 study of crystal oscillator 185 185 four probe method 186 186 induction hot plate with induction ports 187 187 op amp as voltage follower trainer board 188 188 youngs modulus apparatus 189 189 frank hartz experiment setup using argon gas 190 190 thyratron characteristics apparatus 191 191 transistorized push pull amplifier 192 192 michelson interferometer apparatus 193 193 study of frequency modulation and demodulation 194 194 op amp as voltage to frequency/frequency to 195 195 study of active and passive filters 196 196 zeeman effect experiment 197 197 fresnel biprism diffraction apparatus 198 198 study of tdm pcm reciever/ transmitter 199 199 study of smps ...

Directorate Of Health Services - Madhya Pradesh

34817214 supply of surgical materials , alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable , anti abd grouping serum 3x10ml consumable , anti a sera igm ( 10 vial ) , consumable , anti b sera igm ( 10 vial ) , consumable , anti d sera igg+igm 10ml vial ( each ) , consumable , anti d ( polyvalent ) ( 1x10 ml ) , consumable , anti h sera , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent ( 1x5 lit ) , consumable , bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable , bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , blood agar powder ( 500 grm ) , consumable , blood bag 100ml , blood bag 350ml , blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) , blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood urea ( bun ) uv ( 1000 ml ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea ( arba ) , consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , cholesterol kit end point enzymatic kit 50 test / kit , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit , conc hcl ( 1x500 ml = 500 ml ) , consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative ) , crp test kit ( latex / card ) ( 25 test / kit ) , crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable , dengu card antigen ( 25 card / pkt ) , consumable , dengue card test 100 test kit , developer powder ( 22.5 ltr ) , diagnostic strips for urine sugar / albmin packing: 100 strip / pkt , dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 , digital x ray film 10x12 ( 150 films / pkt ) , digital x ray film 11x14 ( 150 films / pkt ) , digital x ray film 8x10 ( 150 films / pkt ) , echo jelly 20ml bottle , echo jelly 250 ml ( mfg by precious life care ) , bottle , edta k3 vial each , edta solutions k3 ( 500 ml ) , edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable , field stain a 500ml , field stain b 500ml , filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable , crp latex slide per test , gel matrix group card , gel matrix cross match card , g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable , glacial acetic acid ( 2.5 liter ) , consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable , glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt , glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt , glass test tube 5 without edge , glucometer strip ( 1x100 ) , glucose kit ( god / pod ) ( 350ml ) , digonstic , h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable , hba ag elisa 96 kit 1x96 ( each ) , consumable , hba ag rapid card test ( each ) , consumable , hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic , hcl n / 10 ( 500 ml bottle ) , hcv elisa ( 96 test kit ) , consumable , hcv kit card test ( 25 test / kit ) , digonstic , heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit , hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable , hiv kit card ( 25 test / kit ) , hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable , k3 blood vaccutainer edta 100 tubes / pkt , leishman stain 500 ml , malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species , malaria pf / pv antigen card , malaria pf / pv rapid test , methyline blue ( 100 ml ) , solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips ( 2 200 ul ) 1x1000 ( each ) , consumable , n / 10 hcl 500ml , nebulization mask kit ( pediatrics ) , nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable , nebulization mask kit ( adult ) , new born baby kit [ 4 piece set ] , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable , ra factor 50 test kit qualicative , ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes , test tube 12 x 100 ( medicm size ) 100 / pkt , test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each , tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll ( each ) , consumable , tourniquet with belt ( good quality pairs ) , pairs , tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable , typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) , typhoid test card. , umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable , umbical cord clamps plastic material ( box of 100 clamps ) , consumable , urine albumin & suger , usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable , usg thermal paper , vdrl ( rpr ) 1x100 sd strip , vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable , vdrl kit ( strip ) ( 50 test / kit ) , consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , adhesive plasters usp 7.5 cm x 10 mts / roll , adhesive plasters usp 7.5 cm x 5 mts / roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , disposable appron , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g ( ) , needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7, 1 / 2 inches consumable , disposable plastic appron ( full size ) , disposable pricking lancet ( pkt of 200 units ) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife ( num ) , consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 6, 1 / 2 inches consumable , disposable sterile gloves size 7 inches consumable , disposable sterile gloves size 7, 1 / 2 inches consumable , disposable sterile hypodermic syringe 10ml ( each ) , consumable , disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , disposable surgeon cap ( box of 100 caps ) , disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable , disposable syringe with needle ( 2ml each ) , syrings , disposable syringe with needle ( 3ml each ) , syrings , disposable syringe with needle ( 5ml each ) , needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask ( as per attached specification ) , consumable , oxygen mask adult ( standard size ) , oxygen mask paediatric ( standard size ) , plain disposable vial 3ml ( each ) , consumable , scalp vein set ( size 24g, disposable ) , consumable , three layer surgical mask , urine container 5ml disposable ( 50 per pkt ) , urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable , x ray film 10 x 12 50 sheets / pack , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack , b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable , b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle , b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material , black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt , black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt , catgut chromic size:2 / 0 length 150 cm , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable , chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt , chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable , non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable , silk no 1 cutting needle 1x12 ( 1x12 ) , consumable , suture mersilk 8 0 ( 12 foil ) , silver nitrate solution 1 ltr. , urine bag 2 ltr. , plaster of paris 410x5mtr , plaster of paris 6 15x 5mtr , cumb sera , albumin , laryngo scope bulb , auto clave quil , idetification tag , peadiatric drip set , dresing pad , endotracheal tube no. 6 , endotracheal tube no. 2.5 to 5 ml. , dynaplast 10 cm. , sicklewive test kit , autoclave indicator , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms ( each ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) , cotton crape bandage 15cm x 4m ( box of 10 bandages ) , cotton delivery belt , adhesive tape 7.5cm x10 ( mtr / roll ) , consumable , cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m / roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m / roll , umblical cotton tape length 75cm. , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , feeding tube ( catheter ) 10g , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys catheter size 22 2 way ( 13 each ) , consumable , foleys catheter size 24 2 way ( 14 each ) , consumable , foleys urinary catheter 2 way size 8 , infant feeding tube ( catheter ) size: 3g , infant feeding tube ( catheter ) size: 4g , infant feeding tube ( catheter ) size: 5g , infant feeding tube ( catheter ) size: 6g , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 25 ( 100 / pkt ) , surgical material , surgical blade, size 11 , ecg jelly 250 gms , ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable , ecg paper computerizesd triple channel 20m , ecg paper ( chemical coated ) 50mm x 20mm roll , ecg paper ( chemical coated ) 50mm x 30 mtr. roll , ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll , ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable , absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorable surgical suture rb needle size no 1 , 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable , blood vessel introducers needles 16g, sterilized, set , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle , insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( children ) , surgical material , spinal needle no. 23 , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle ( 5 ml ) , syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable , vicryl no. 1 rb , vicryl no. 2.0 rb , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula size 26g ( ) , consumable , biomedical waste collection plastic bag small ( all colours ) , biomedical waste collection plastic bag medium ( all colours ) , biomedical waste collection plastic bag large ( all colours ) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress ( male ) , bed sheet single bed ( white ) , bedsheet double bed ( white ) , bed sheet single bed ( coloured ) , bedsheet double bed ( coloured ) , baby diapers small ( 10 diaper per pkt ) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat / lab tec / xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane ( each ) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size ( white ) , napkin sup. quality std size ( coloured ) , peticote blauge cloth shuti rangeen , peticote / blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen ( small ) , table cloth rangeen ( large ) , biomedical waste collection plastic dustbin small ( all colours ) , biomedical waste collection plastic dustbin medium ( all colours ) , biomedical waste collection plastic dustbin large ( all colours ) ...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Directorate Of Medical Education - Madhya Pradesh

34145016 supply of medicine / surgical / iv fluid / surgical suture / surgical stapler / chemical kits aceborophylline 100 mg amantadine 100mg capsule apripitant capsule 125mg & 80mg calcitrol 0.25 mg cap calcitrol 0.5mg capsule calcitrol calcium carbonate and zinc capsule chloramphenicol 250mg capsule chloramphenicol 500mg capsule crizotinib 250mg capsule cyclosporine 100 mg cyclosporine 50 mg deferiprone 500 mg cap. imatinib mesylate 100 mg oseltamivir ( 45mg ) , capsule palbociclib 100 mg cap palbociclib 75 mg cap sildenafil 20mg tetracycline capsules 250 mg tetracycline capsules 500 mg ulipristal acetate capsules 5mg acyclovir 3% ear drop beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5% 5 ml ear drop fluromethanol eye drop gentamycin eye drop homatropine hydrobromide eye drop ip 5ml sterile lignocaine hcl 4% eye drop natamycin eye drop polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml polyvinyl alcohol 1.4% 5 ml prednisolone eye / drop. proparacaine hydrochloride 0.5% eye drops 5ml sodium chloride opthalmic solution 5% eye drop acyclovir 3% eye oint.5 gm tube atropine eye oint. 3gm tube chloramphenicol eye ointment 5 gm tube ciprofloxacin eye ointment 5 gm tube hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment tobramycin eye oint.3gm tube benzocain gel chlorhexadine gel choline salicyclic gel triamadone accetate gel sterile collogen granules nephro steril ( alanine 6.3 gm+l arginine 4.9 gm+l histidine 4.3 gm+l isoleucine 5.1 mg+l leucine 10.3 mg+l lysine 10.01 gm+l phenylalanine 3.8 gm+l threonine 4.8 gm+l valine 6.2 gm+methionine 2.8 gm+n acetylcarnosine 0.5 gm+proline 4.3 gm+serine 4.5 gm+tryptophan 1.9 gm ) 250ml infusion normal saline 1.6% 500 ml bottle parenteral nutrition two chamber bags without lipid ornidazole iv infusion 100ml bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle desflurane 240ml bottle solution usp inhalation anaesthetic adalimumab 20mg / 0.4ml inj adalimumab 40mg / 0.8ml inj adenosine 3 mg / ml 2 ml amp ado trastuzumab emtansine 100 mg inj alteplase 50mg inj amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle aminophylline 25 mg / ml 10 ml vial ampicillin+sulbactum 1.5 mg inj anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d anti human thymocyte immunoglobulin 25 mg anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj benzathine penicilline 12 lac iu / vial betamethasone sodium phosphate 4 mg / ml 1 ml amp biphasic insulin aspart ip penfill 100 iu inj 3 ml cartridge bortezomib 3 .5 mg / vial botalinin 100iu inj botalinin 200iu inj botulinum toxin type a injection buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj butorphanol 1mg / ml 1ml amp carboprost tromethamin 250 mcg / ml 1ml amp cefuroxime 1.5gm inj cefuroxime 500mg inj cetuximab 100mg 2mg / ml vial cetuximab 200mg 2mg / ml vial cetuximab 50mg 2mg / ml vial chloramphenicol 500mg inj chlorpromazine ip 25mg vial cholecalciferol 600000 iu / ml injection cis atracurium 2mg / ml vail cladribine 10 mg / 10ml inj clonidine hydrochloride 100 mcg / ml 10 ml vial contrast urograffin inj cytarabine 1000 mg iv cytarabine 100mg injection cytarabine 1gm inj daunorubicin 50 mg / vial dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) dextron 40 inj diatrizoate meglumine & diatrizoate sodium ( 37% ) vial diatrizoic acid 60% amp diatrizoic acid 65% amp diatrizoic acid 76% ( urographin dye ) injection diazepam 5 mg / ml 2 ml amp dicyclomine 10mg / ml 2 ml vial digoxin i.p. 0.5mg / 2 ml amp diltiazem 25mg / 5ml vial diphtheria antitoxin 1000 iu vial doxorubicin 500mg injection doxycyclin 100 mg injection edaravone 60 mg inj enalapril maleate inj 1.25 mg per ml 2ml vial ephedrine 30mg / ml 1ml inj esmolol / 40mg / ml 5 ml vial etanercept 25mg inj etanercept 50mg inj etomidate 2 mg / ml emulsion with mct 10ml vial fentanyl 100 microgran 2 ml amp fentanyl 50 microgran 2 ml amp fluorescein 20% 5 ml amp flupentixol 20 mg inj flupentixol 25 mg inj fluphenazine 25 mg / ml 1 ml amp ganciclovir 500 mg vial gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp gatifloxacin vial gentamycin 80mg / 2ml amp glutathion 600mg inj granulocyte colony stimulating factor ( gcsf ) inj haemocoagulase 1 iu inj haemophilus influenzae type b vaccine hepatitis b vaccine / 1ml hyaluronidase 1500 iu / 2ml amp ifosfamide + mesna 1gm inj infliximab 100mg inj insulin glargine injection iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle isobaric levobupivacaine 0.5% inj isoprenalin inj 1ml amp isoxsuprine hcl 5mg / ml 2ml amp ketamine hydrochloride 50 mg / ml 10 ml ketoprolac tromethamine 30 mg inj l aspiraginase 10000iu inj leuprolide 6.25mg inj levobupivacaine hyperbaric 0.5% lidocaine 4%, 5 ml vial lignocaine ( preservative free ) 2% 50 ml vial lignocaine 10% injection lignocaine 4% 30 ml vial lignocaine for spinal anaesthesia lignocaine 5% + destrose 7.5% 2 ml amp heavy lorazepam 2 mg / ml, 1 ml vial low molecular weight dextran 40000 vial mannicoccal acwy 0.5 ml inj meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial mephentermine 30 mg / ml 10 ml mesna 200mg injection methacarbamol 100 mg. / 10ml vial methotrexate 500mg injection metoprolol 5mg / ml 5ml vial micafungin 100 mg micronised progesterone 50mg / ml 2ml amp micronized progesterone 100mg / ml 2ml amp milrinone 1mg / ml solution for injection / infusion mitomycin c 40mg inj mitoxantrone 15 mg inj morphine sulphate 10mg / ml 1ml amp naloxone 0.4 mg / ml, 1 ml nikethamide amp nimodipine 10mg / 50ml injection nitrofurantoin injection olanzapine 10 mg inj olanzapine depot inj panitumumab 100mg / 5ml inj pembrolizumab 100mg / 4ml ( 25mg / ml ) penicillin v 125 mg inj pentoxiphylline 20 mg / ml pertuzumab 30mg / ml ( 420mg / 14ml ) phenobarbitone 100mg / ml 1ml amp. phenobarbitone 200mg / ml 1ml amp. pilocarpine 0.5 % / 1ml amp piperacillin 2 gm+tazobactam 250 mg placenta extract 2 ml injection pneumococcal vaccine 10 ml vial pregabalin inj progesterone b.p.100mg vial promethazine 2 ml / 2.5% vial protamine sulphate 1%, 10mg / 5ml amp quinine sulphate 300 mg / ml, 2 ml amp romiplostim 250 mg injection romiplostim 500 mg injection ropivacaine 0.5% 20 ml vial ropivacaine 0.75% 4ml amp ropivacaine 10mg / ml 2.5ml vial ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) sargramostim 500 mg inj soluble insulin penfill 3 ml injection surfactant ( porcine lung surfectant extract 80mg / ml ) terbutaline 0.5mg / ml aml amp teriparatide 600mcg 3 ml amp tetanus immunoglobulin usp 500 iu / vial thiamine 400mg inj thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) thiopentone sodium 0.5gm powder / vial, 20 ml vial tobramycine 80 mg vial tocilizumab 400 mg inj torsemide inj 2ml amp trypan blue opthalmic solution 0.06% pre filled syringe ulinastatin 100000iu injection urokinase 500000 iu vial vasopressine 40 iu / ml amp verapamil hydrochloride 2.5 mg / ml 2ml amp vinblastine 10 mg / 10 ml amp vinorolbine 50mg inj vit d3 injection vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj water for injection 10 ml amp zuclopenthixol acuphase 50 mg inj zuclopenthixol decanoate 200 mg inj acetic acid solution 3% 100ml acetone detection kit ada kit ae 1 / ae 3 aluminium ammonium sulphate powder 500gm amacr ana test kit anti a lactin 05ml anti ab sera 10ml anti d igg+ igm 10ml anti d igm 10ml anti h lactin 05ml anti her / erbb2 monoclonal anti human globulin ( ahg ) 05ml anti a sera 10 ml anti b sera 10 ml banded use in blood bank barium chloride 10 % 500 ml bcl 2 benedict reagent 5 lit cane bismark brown stain 100 gm blood culture media aerobic for adult ( bac t / alert pf plus blood culture media anaerobic for pediatric ( bac t / alert pf plus ) blotting paper 50 / pkt bovine albumin 22% 05ml buffer solution for hiv 50ml ca 125 calcium chloride 05ml / vail capillary tube cd34 combined spinal epidural ( cse ) kit couplin jar cover slips size 18x18mm cover slips size 22x22mm cox 2 csf protein kit cyclin d 1 cyto fix spray desmin disposable microtome blade ( 50 blades in one ) dpx mount 250ml ehlrich aldehyde reagent 125 ema estrogen receptor epi monoclonal filter paper 12.5 cm 0.1 micron ( 50 per pkt ) fouchet reagent 250ml glacial acetic acid 100 ml glial fibrillary acidic protein ( gfap ) h2so4 25 % 500 ml bottle haematoxylene 5gm haemoglobin strip hbv elisa test kit 4th generation 96 test hbv rapid test kit hpr polymerr kit with dab chromogen hydro chloride acid about 36.46% i.d. microtyping abd card i.d. microtyping gel card ahg immersion oil iso propyl alcohol ki67 / mib 1 06 ml antibody kit leishman stain 500 ml leucoreductionfilter ( bed side ) light green stain 100 gm liquid ammonia 500 ml liss diluent for gel card malaria parasite elisa test kit massons trichrome stain mercuri oxide 25gm methanol 2.5lit mgg 480ml multi parameter urine strips ( 100 in 1 box ) myogenin n / 10 hcl 500ml nfp nitric acid 500 ml nkx 3 1 p 53 pandys reagent 125ml pap pen papanicalou ea 125ml pea 030 papanicalou og 6 125ml pea 010 paraffin wax 58 60c pas stain pasture pipette poly l ltsin solution p8920 polythene gloves pricking lancet progestron receptor monoclonal retic stain 125ml s 100 sharp collection containers disposable 5 ltrs sharp collection containers disposable 1.5 ltrs single donor platelet kit make haemonotics / terumo penpol ( close system ) slide tray sma sodium chloride for analysis steel cassets for tissue processing sulpgar powder 500 gm sulpho salicylic acid 500ml synaptophysin tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) tissue paper roll titriplexiii pure ( edta ) tris buffer gr tween 20 for synthesis vdrl elisa test kit vimentin wafers cutting blade for tube welders xylene chlorhexidine mouthwash 0.2% 50 ml sterile haemocoagulase solution topical solution 0.2 cu nasal drop saline nasal gel 15 gm tube budesonide nasal spray 32mcg / spray methylcobalamin nasal spray 250 mcg saline nasal wash 3gm kit sodium chloride nasal wash betamethasone 0.5mg, gentamicin 1mg betamethasone valerate cream 0.05% 15gm betamethasone valerate ointment 0.1%, 15 gm tube centella asiatica extract based skin moisturization and antiscar gel 30gm clindamycin ointment 10gm fluconazole ointment 20 gm tube fusidic acid 2%, 15 gm heparin 20gm oint human placental extract ointment ketoconazole cream lidocaine zinc oxide ointment luliconazole cream la magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm papain urea and silk protein based debriding ointment and cream 100 gm papain urea and silk protein based debriding ointment and cream 25 gm papain urea and silk protein based debriding ointment and cream 50 gm papain urea 15 gm tube povidone iodine ointment 7.5%, 500 gm salicylic acid 2%, 30 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm silver sulphadiazine cream usp 1% w / w 250gm clotrimazole+beclomethasone oral paint triamcinolone oromucosal paste bp 0.1% ketocanazole oral paste triamcinolone acetonide dental paste usp 0.1% barium sulphate powder 250 gm clotrimazole powder neomycin sulphate+polymycin b powder polyethylene glycol + electrolyte powder protein powder silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial n acetylcysteine solution for inhalation respules tiotropium ( 18 mcg ) + formoterol ( 12 mcg ) fostomycin sachet 3gm orodispersible probiotic sachet acyclovir lotion beclomethasone lotion citric acid 500 ml bottle compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml feracrylum solution 1% 100 ml gention violet l / a glycerine 15% and sodium chloride 15% enema 20ml sodium hypochloride solution 5% 5 ltr topical heparin solution 5ml vial benzocaine +cetramide spray lignocaine spray 10% absorbable 2 0 endo suture cartridge 48 length advance rf energy hand instrument of 5 mm shaft diameter for laproscopic procedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm disposable circular stapler 31mm diameter disposable circular stapler – 32mm diameter disposable circular stapler 33mm diameter disposable circular stapler iii rows disposable circular stapler 25 / 26mm diameter disposable circular stapler 28 / 29mm diameter disposable clip applier medium 10mm with 20 clips disposable clip applier medium 5mm with 16 clips disposable curved cutter stapler disposable hemorrhoidal stapler iiirows disposable hemorrhoidal stapler with detachable anvil. disposable linear stapler with fixed staple height 75mm 90mm size disposable linear stapler with fixed staple height 55mm 60mm size disposable trocar 05mm disposable trocar 10mm disposable trocar 12mm disposable trocar 15mm distal tip closure titanium ligation clip large size distal tip closure titanium ligation clip medium size distal tip closure titanium ligation clip small size endoscopic cutter & stapler 60mm long length endoscopic cutter & stapler 60mm regular length endosuturing device 10mm with toggle lever handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh handpiece ( transducer ) compatible with ultrasonic vessel sealing dissector installed in myh hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc locking clip cartridge medium / large mesh fixation device with non absorbable titatinum tacks 20 multifire clip applier long size 15 clip multifire clip applier small size 20 clip non absorbable 2 0 endo suture cartridge 48 length open clip applicator 100 20cm length open clip applicator 200 20cm length open clip applicator 300 open clip applicator 400 open disposable clip applier for medium clip size 9.75 having 20 clips open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length plastic locking clip applicator medium / large polycearbonte bladeless trocar with reducer seal 10mm polycearbonte bladeless trocar with reducer seal 12mm polycearbonte bladeless trocar with reducer seal 5mm polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm reload 55 60mm for medium thick tissue blue compatible with linear cutter. reload 55 60mm for thin / vascular tissue white compatible with linear cutter. reload 75 80mm for medium thick tissue blue compatible with linear cutter. reload 75 80mm for thick tissue green compatible with linear cutter. reload compatible with curved cutter reload endoscopic cutter & stapler 45mm purple reload endoscopic cutter & stapler 60mm purple reload endoscopic cutter & staplter 45mm blue reload endoscopic cutter & staplter 45mm green reload endoscopic cutter & staplter 60mm / black reload endoscopic cutter & staplter 60mm blue reload endoscopic cutter & staplter 60mm gold reload endoscopic cutter & staplter 60mm green reload endoscopic cutter & staplter 60mm white reload for linear stapler with fixed staple height 35mm 45mm size blue reload for linear stapler with fixed staple height 35mm 45mm size green reload for linear stapler with fixed staple height 55mm 60mm size blue reload for linear stapler with fixed staple height 55mm 60mm size green reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly reusable laparoscopic clip applicator for large titanium clips. reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly reusable linear cutter 55 60mm with 200 firing reusable linear cutter 75 80mm with 200 firing single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip suture locking autolock titanium clip 100 titanium clip 400 universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. paracetamol suppository abdominal drain no 8 abdominal drain bag accessory spikes amorphous hydrogel with colloidal silver antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm antimicrobial incise drape 3 meter antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm arterial pressure bag 1000ml arterial pressure bag 500ml ash brace m size barium sulphate liquid 1 liter bionet connector biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered bipolar forceps cable bis monitor electrode black monofilament 2 / 0 rc loop black thread ( stitching ) big bleaching powder gr ii 25 kg bag blood bag double 350 ml cpd solu blood bag double 350 ml with sagam blood bag quadruple 350 ml top bottom with cpd sagam solu blood bag quadruple 450 ml top bottom with cpd sagam solu blood bag single 350 ml blood bag transfer 350 ml blood bag triple 350 ml blood bag triple 350 ml sagam blood culture bottles bone marrow aspiration needles ( 14 ) bone marrow aspiration needles ( 15 ) bone marrow aspiration needles ( 16 ) bone marrow aspiration needles 13 g bone marrow biopsy needle bp cuff adult & pediatric carbolic acid 500 ml cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) catheter single lumen 6.6 no catheter single lumen 7.7 no cautery patient plate disposable central venous line 4f cerebral catheter reservoir 12mm dia chamber cerebral catheter reservoir 18mm dia chamber cervical soft collar chlorhexidine gluconate dressing material chlorinated lime with boric acid solution 400ml cling drape 15x500cm closed suction trachostomy suction tube with pro s collegen patch collogen sheet 10x10 collogen sheet 15x15 colostomy kit condom catheter small, meadium, large conjugated drain craniotomy cutter blade cresol with soap solution 5ltr jar cvp manometer cylinder connection nut dermatome blade disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 dj stent 6 / 26 double monitoring pressure transducer dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. dura guide for neuro surgery ecg paper 80mmx20 mtr roll ecg paper computerized triple channel 20m elastomeric pump for post operative analgesia endo stich lap suturing device 10 mm endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm extra ventricular drain ( evd ) fibrin & tissue glue fluorescein strips pkt foam sclerotherapy fibre fogartis catheter 4 fr gasket for vaccume jar 1000 ml gasket for vaccume jar 600 ml gasket for humidifier bottel guide wire m 0.89mm, 150cm halogen bulb holder ( heavy duty ) hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) hip u drape humbys knife disposable blade hydrocephalus shunt medium pressur ( vp shunt ) hydrogen peroxide 21% w / w, paracetic acid 4% w / w, acetic acid 10% w / w ( cold st disinfectant for dialysis ) icd bag implantable pain port with epidural catheter for long term pain management impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml intraocular lens 14 30d dioptre intravenous drip set pediatric size introducer sheath 0.97mm 6fr, ( 2.0mm ) , 11 cm introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm j r c bag 1 ltr j r c bag 1.5 ltr j r c bag 1 / 2 ltr 500ml kehr t tube laser radial fibre 600 micron and 400 micron liga clip 200mm, 300mm, 400mm liver biopsy gun long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm mackintosh double colour water proof roll ( 20 meter per roll ) malecot rubber catheter no 12 malecot rubber catheter no 16 malecot rubber catheter no 20 malecot rubber catheter no 22 malecot rubber catheter no 24 medical dry imaging film 10x12 medical dry imaging film 14x17 medical dry imaging film 8x10 methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 microlaryngeal surgery tube no 5 monopolar cautry wire disposable neonatal urine collection and measurement bag 100 ml omaya reservoir large size oxygen adaptor 5 type oxygen catheter oxygen connection with flow meter for central line oxygen connection with flow meter for cylinder oxygen high pressure hose pipe oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) oxygen regulator for control penal board ( oxygen pipe line ) oxygen tailpipe ( flexible metalic ) pacing leads 6 fr paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, paraffin gauze dressing material 10x10cm pediatric diapers peritonial dialysis catheter 200mm pediatric peritonial dialysis catheter 280mm adult peritonial dialysis fluid 1ltr. pigtail catheter 6 fr ( 150 cm ) pigtail catheter with needle 6 fr ( 30 cm ) plaster of paris powder ip 1 kg pkt plastic nozel cap post exposure prophylaxis kits ( pep kits ) pressure regulated v p shunt for peadtric probe for oxygen radiopaque polyurethane catheter with fixation wings and integral extension tube 2f, 5f ( leader flex ) rectified sprit 4.5 ltr. scrotals support short pencil point spinal needle g 25 / 22, l 38mm. sics kit ( small incision cataract surgery ) silicon / double nasal prong with universal connector. all sizes silicon cautery plate silicon folyes catheter 14 fr silicon folyes catheter no 12 silicon tubing set for endoflaton silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm silk protein based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein based sterile surgical pu foam dressing 20cmx20cm silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilized sizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr soda lime for anesthesia workstation 5kg spatula for papsmear sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. sterile post‐operative surgical dressing surgical kit drape gown t.piece circuit with oxygen tubing set ( complete set ) tear test strip ( 100 strips in box ) terrimo guide wire thomas splint tmt graph paper tommy syringe tounge depresser wooden tracheostomy filter transducer set for invasive b.p. triway folyes catheter no 22 turp set ureteric catheter urine collecting bag with urometer 1 ltr. vaccum adaptor 5 type vaccum pump belt vaccum pump oil vaccum regulator ventilator circuit ( heated wire ) ventilator mask water bed wipes wound protector extra small incision size 2 4 cm wound protector large incision size 9 14 cm wound protector large incision size 9 14 cm with retraction ring wound protector medium incision size 5 9 cm wound protector small incision size 2.5 6 cm x ray casset 12x15 x ray casset 10x12 x ray casset 8x10 x ray developer 22.5 lit. x ray films size 10x12 50film per pkt blue sensitive x ray films size 12x15 50film per pkt blue sensitive x ray films size 8x10 50film per pkt blue sensitive x ray fixer 22.5 lit x ray hangers ( clip type ) 10x12 x ray hangers ( clip type ) 12x15 x ray hangers ( clip type ) 8x10 x ray screen high speed 12x15 x ray screen high speed 8x10 x rayscreen high speed 10x12 180 absorbable polyglyconate knotless wound closure device with unidirectional 0 30cm , green 37mm 1 / 2 circle taper point 180 absorbable polyglyconate knotless wound closure device with unidirectional 2 0 30cm , green 37mm 1 / 2 circle taper point 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved absorbable unidirectional barbed device polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm black braided silk 2 0 rb 5333 suture 17mm 1 / 2c taper black braided silk 3 0 rb suture 17mm 1 / 2c taper black braided silk 5 0 rb suture 17mm 1 / 2c taper black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. knotless wound closure device with unidirectional 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting knotless wound closure device with unidirectional 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm monofilament glycomer 0, 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 1 , 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 2 0 , 75cm , violet 27mm 1 / 2 circle taper point monofilament glycomer 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting monofilament glycomer 3 0 75cm , violet 22mm 1 / 2 circle taper point patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or and us fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. perforator 14mm pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system polydioxanone 122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. polydioxanone barbed suture 1 0 polydioxanone suture voilet monofilament 17mm 1 / 2c taper no 4 0 90cm polydioxanone suture voilet monofilament 40mm 1 / 2c blunt point 1 240cm polydioxanone suture voilet monofilament double armed trocar point 2 0 70cm polydioxanone suture clear monofilament 36mm 1 / 2c taper 3 0 70cm polydioxanone suture voilet monofilament 17mm 1 / 2c 5 0 70cm polyglactin 4 0suture undyed braided 1 / 2c reverse cutting polyglactin 910 with triclosan no. 0 x 90 36mm hc rb polyglactin 910 with triclosan no. 1 x 100 55mm hc rb polyglactin 910 with triclosan no. 1 x 90 36mm hc tc progrip self fixating mesh 12*08cm progrip self fixating mesh 14*9cm progrip self fixating mesh 15*15cm progrip self fixating mesh 20*15cm progrip self fixating mesh 30*15cm protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved sterilised surgical needled suture 8mm 1 / 4 spatulated micropoint double 5 0 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system v shape clip applicators large v shape clip applicators medium v shape clip applicators small v shape ligation clip large v shape ligation clip medium v shape ligation clip small aciclovir 200mg / 5ml oral suspension 100ml bottle albendazole suspension 200 mg / 5ml bottle baclofen oral solution ip 1mg / ml syp calcium phosphate, 2:1 ratio, 100 ml bottle carbamazepine oral suspension usp 100ml syp chloramphenicol palmitate oral suspension ip 125mg / ml 100ml syp chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle ciprofloxacin 125mg / 5ml syp 60 ml bottle co trimoxazole 30 ml cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml cyclosporine oral solution usp 100mg / ml 50ml syrup cyproheptadine + lycine and vitamins 200ml syp cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle domperidon suspension 1mg / ml 30 ml bottle etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle ibuprofen oral suspension bp 100mg / 5ml 100ml syp iron+zinc syp metronidazole 200mg / 5ml suspension 60ml bottle nitazoxanide 100mg / 5ml 30 ml bottle norfloxacine suspension ( 30 ml bottle ) oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle paracetamol oral solution 150mg / ml 15 ml bottle with dropper paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) phenobarbitone syp 30ml. 20mg / 5ml. phenytoin sodium suspension 30mg / 5ml 100 ml bottle prednisolone sodium phosphate solution 5mg / 5ml 60ml syp salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle sodium valporate oral solution 100ml syp sorbitol 7.15 gm+tricholine citrate 0.55 gm sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle trypsin bromelain & rutoside trihydrate tablets 6 mercaptopurine , 50mg acarbose 25 mg aceclofenac 100mg+paracetamol 500mg , tablet aceclofenac+thiocolchicoside 100mg+4mg tablet aceclofenace 100mg+serratiopeptidase 15mg tab acenocoumarol 2 mg tab acenocoumarol 1mg acyclovir 200mg tab ademetionine 100mg tab afatinib 40 mg agomelantine 025 mg tab alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg ambroxol hydrochloride 30mg tab amitriptyline 10 mg amlodipine ( 5 mg ) + metoprolol ( 50 mg ) artemether 80mg tab artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab aspirin 75 mg aspirin 150 mg aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg aspirin 75 mg+prasugrel 10 mg atorvastatin 10 mg+aspirin 75 mg. baclofen 5mg tab benfothiamin 150mg betahistine 4mg tab betamethasone 0.5 mg bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg bisoprolol 5 mg+amlodipine 5 mg bosentan 62.5 mg tab brivaracetam 50mg tab bromocriptine 2.5mg tab buprinorphine 4mg buprinorphine 8 mg bupropion 300 cabargolin 0.25 mg cefadroxil 500 mg chlorthalidon 50 mg tab cilostazole 50mg tab cilostazole100mg tab cinnarizine 20 mg and dimenhydrinate 40 mg citicoline 500mg tab clopidogrel 75 mg+aspirin 75 mg clopidogrel 75 mg+atorvastatin 20 mg clotrimazole 400mg tab co trimoxazole tab cyclophosphamide 50 mg tab cyclosporine 300mg tab cynocobalmin + folic acid tab dapagliflozin 5mg tab dapsone 100 mg tab deferasirox dispersible 500mg tab deflazacort 6mg tab desmopressin 0.5mg tab dexamethasone 4 mg tab diphenylhydramine 50 mg domperidone+ranitidine 150mg tab drotaverine 40 mg tab drotaverine 80mg duloxetine 40mg dydrogesterone 10mg eltrombopag olamine 150mg tab empagliflozin 25mg tablet entecavir 0.5mg tab entecavir 1mg tab eplerenone 25mg erlotinib tablets ip 100mg escitalopram 10 mg tab esomeprazole 40mg ethambutol hydrochloride 400mg tab ethambutol hydrochloride 800mg tab etizolam+propranolol 20mg tab etophylline 77 mg+ theophyllin 23 mg etoposide 50 mg etoricoxib 90mg farmalin 1gm tab ( 100 tab per box ) fenofibrate 160mg tab ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) fludrocortisone 0.1mg tab folic acid 800 mcg fungal diastase 100 mg+papain 60 mg gabapentin 400 mg+nortriptyline 10 mg ganciclovir 1000mg tab glibenclamide 2.5mg tab gliclazide 60mg glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg glimepiride 2 mg+metformin 500 glipizide 5 mg+metformin 500 mg glucagon 0.1mg tablet glyceryl trinitrate 0.5 mg sublingual tab hydrocortisone 10 mg hydrocortisone 20mg tab hydroxyzine 10 mg tab hyoscine butylbromide tab 10mg ibuprofen 400 mg indapamide hemihydrate 1.5mg isoniazid 200 mg tab isosorbide 5 mononitrate 20 mg isosorbide mononitrate 30 mg itopride 150mg itopride hydrochloride 25 mg tab itopride hydrochloride 50 mg tab l carnosine 200mg tablet lactobacillus 120 lamotrigine 25mg tab lansoprazole 15mg tab lapatinib 250 mg levetiracetam 750mg tab levodopa + carbidopa 100+25mg levofloxacin 750mg tab loperamide 8 mg tab lorcaserine 10 mg tab losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) lurasidone 20 magnesium oxide 200 mg magnesium valproate 400 mg mebendazole 100 mg tab meclizine hydrochloride 25 mg mefenamic acid 250mg+dicyclomine 10mg tab megestrol acetate 40mg melatonin 3mg melatonin 6mg mercaptopurine 50mg tab mesalamine ( 5 aminosalicylic acid ) 400 mg tab metaclopramide 10 mg tab metformin ( 1000 mg ) + vildagliptin ( 50 mg ) metformin 500 mg+voglibose 0.3 mg methimazole 10 mg tab methocarbamol 500 mg. methotrexate 10 mg methotrexate 5 mg tab methylcobalamin +folic acid tab methylcobalamin 1500mg tab methyldopa 250 mg tab methylphenidate 10 mg methylphenidate 20 mg methylphenidate 5 mg metoclopramide 05 mg metoprolol 12.5 mg metoprolol 50 mg+ramipril 5 mg misoprostol 200 mg modafinil 200mg tab morphine sulphate 10mg tablet moxonidine 0.3 mg multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) mycophenolate mofetil, 500 mg n acetylcysteine 300mg tab naproxen 250 mg tab naproxen 500mg + domperidone 10mg tab naproxen 500mg tab nebivolol 5mg nicorandil 5 mg tab nicotinamide 250mg tab nicoumalone 1 mg nimesulide 100 mg nimodipine 30mg tablet nitazoxanide 200 mg nitazoxanide 500mg tab nitrocontin 2.6 nitroglycerin 2.5 mg ofloxacin 200mg +tinidazole 600mg tab ofloxacin 400mg tab olmesartan 10 mg olmesartan 20mg olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg olmesartan medoxomil 40 mg+amlodipine 5 mg oxcarbazepine 150 mg tab oxcarbazepine 300 mg tab oxybutynin 2.5mg tab pancreatic enzyme 1000mg tab pancreatic enzyme 2000mg tab pancreatic enzyme 500mg tab pantoprazole 40 mg+domperidone 30 mg paracetamol, chlorpheniramine maleate, phenylephrine hydrochloride & caffeine tablets pazopanib 200mg / 400mg penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) pentoxifylline 400mg perampanel 4mg phenobarbitone 30 mg. pramipexol 0.26 sr pramipexol 0.50mg prazosin 10mg tab propranolol hydrochloride 40mg+flunarizine 10mg tab propylthiouracil 50mg prucalopride 2mg tab quetiapine 50mg tab racecadotril 100mg ranolazine sustained release 500mg tab rifaximin 550 mg tablet rivaroxaban 10mg tab rivaroxaban 15mg tab rivaroxaban 5mg tab rosuvastatin 20 mg sacubitril 24 mg+valsartan 26 mg secnidazole 500 mg tab sevelamer carbonate 400mg tab sevelamer carbonate 800mg tab sildenafil 25 mg silodosin 8mg tab sitagliptin 50 mg+metformin 500 mg sodamint tab solifenacin 5mg tab sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab sulfasalazine 500mg tab sunitinib 50 mg tapentadol 50mg tab telmisartan 40 mg+amlodipine 5 mg telmisartan 80 mg+amlodipine 5 mg telmisartan 80 mg+hydrochlorothiazide 12.5 mg teneligliptin 20 mg tenofovir disoproxil 300mg tab terbutaline sulphate 2.5mg tab tetrabenazine 12.5mg tab tetrabenazine 20 mg tab tetrabenazine 25mg tab thiamine 200mg tab thiamine 75mg thyroxine sodium 137 mcg thyroxine sodium 62.5 mcg thyroxine sodium 12.5 mcg thyroxine sodium 150 mcg thyroxine sodium 125 mcg thyroxine sodium 88mcg tablet tianeptine 12.5 mg tolperisone hydrochloride 150 mg tab tolvaptan 15 mg topotecan 1 mg torsemide 10 mg+spironolactone 50 mg tramadol 37.5mg and acetaminophen 325mg tablet valganciclovir 450mg tab valganciclovir 500mg tab valganciclovir 900mg tab valsartan 40 mg venlafaxine 75 verapamil 120mg tab vidagliptin 100mg tab vidagliptin 80mg vilazodon 20mg vilazodon 40mg voriconazole 100mg tab voriconazole 150mg tab voriconazole 200 mg voriconazole 50mg tab vortioxetine 20mg vortioxetine 10mg vortioxetine 5 mg warfarin sodium 5 mg tab zonisamide 100 mg tab zonisamide 50 mg tab...

Directorate Of Health Services - Madhya Pradesh

33747699 supply of medicine and material medicine and material , medicine name , atropine inj 0.6 mg / ml 2 ml amp , bupivacaine hcl inj 0.5% 20 ml vial , glycopyrolate inj 0.2 mg / ml 1 ml amp , halothane inhalation 250 ml bottle , isoflurane inhalation 250 ml bottle , ketamine inj 10 mg / ml 10 ml vial , lignocaine inj 2% 30 ml vial , lignocaine gel 2% 30 gram tube , lignocaine +adrenaline inj 2% + 0.005 mg / ml30 ml vial , midazolam inj 1 mg / ml 5 ml amp / 10 ml vial , pentazocine injection 30mg / ml 1 ml ampule , thiopentone inj 0.5gm powder / vial 20 ml vial , nitrous ( store under pressure in metal cylinders of the type conforming to the appropriate safety regulations and at temperature not exceeding 37°c ) , oxygeninhalation , promethazine injection 10 mg / mlone injection 1 vial , propofal injection 10 mg / ml 1 ml / vial , aceclofenec tab 100mg 10 x10 , acetylsalicylic acidtablet 150 mg 10 x 10 , acetylsalicylic acid ( aspirin ) *tablet 25 mg 10 x 10 , allopurinol tablet300 mg 10 x 10 , allopurinol tablet 100 mg 10 x 10 , aspirin tab 75 mg 10 x 10 , atracurium inj 10 mg / ml 2.5 ml amp , diclofenac tab 50 mg 10 x 10 , diclofenac inj 25 mg / ml 3 ml amp , diclofenac 1% gel , fentanyl 50 microgram / ml 2 ml amp , hydroxychloroquine tablet 200 mg 10 x 10 , ibuprofen tab 400mg 10 x 10 , ibuprofen oral suspension 100mg / 5ml 60 ml bottle , morphine inj 10 mg / ml1 ml amp , paracetamol tab 500mg 10 x 10 , paracetamol drops 125mg / ml drops 125mg / ml , paracetamol inj150 mg / ml 2 ml amp , paracetamol syp 125mg / 5 ml 60 ml bottle , paracetamol tab 650mg 10 x 10 , pregabalin tablet 150 mg 10 x 10 , succinyl choline inj 50 mg / ml10 ml vial , sulfasalazine tablet 500 mg 10 x 10 , tapentadol tablet 100 mg 10 x 10 , tramadol inj 50 mg / ml 2 ml amp , tramadol tab 50mg 10 x 10 , betahistine tab 8 mg 10 x 10 , cinnarizine tab 25 mg 10 x 10 , adrenaline inj 1 mg / ml 1 ml amp , betamethasone tab 0.5 mg 10 x 10 , betamethasone sodium phosphate inj 4 mg / ml 1 ml amp , cetirizine tab 10 mg 10 x 10 , cetirizine syp 5mg / 5ml 30 ml bottle , chlorpheniramine inj 10 mg / ml10 ml vial , chlorpheniramine oral liquid 2 mg / 5 ml , dexamethasone inj 8 mg / 2 ml 2 ml vial , dexamethasone tab 0.5 mg 10 x 10 , hydrocortisone inj 100 mg / vial dry powder 100mg / vial , hydrocortisone ointment 0.5% , hydrocortisone ointment1% , hydroxyzine syrup 10 mg / 5 ml , hydroxyzinetablet25 mg 10 x 10 , pheniramine injection 22.75 mg / ml 2 ml vial , prednisolone tab 20 mg 10 x 10 , promethazine syp 5mg / 5ml 60 ml bottle , ferrous ascorbate ( 100mg. elemental iron+ folic acid 1.5 mg ) 10 x 10 , phytomenadione injection 10 mg / ml 10 mg ampule , carbamazepine tab 200 mg 10 x 10 , carbamazepine tablet 200 mg 10 x 10 , carbamazepineoral liquid 100 mg / 5 ml , diphenylhydantoin tab 30 mg 10x10 , levetiracetam tablet 250 mg 10 x 10 , magnesium sulphateinjection 500 mg / ml , phenobarbitone inj 200 mg 1 ml amp , phenobarbitone tab 30 mg 10 x 10 , phenytoin inj 50 mg / ml 2 ml amp , phenytoin / diphenylhydantoin tab 100mg 10 x 10 , sodium valproate tab 500 mg 10 x 10 , sodium valproate syrup each 5ml contains 200mg 200 ml bottle , valproate oral solution 200mg / 5ml 100 ml bottle , desferrioxamine injection 500 mg vial , naloxone inj 0.4 mg / ml 1 ml amp , pralidoxime ( pam ) inj 25 mg / ml 20 ml amp , abacavir tablet 300 mg 10 x 10 , acyclovir inj 250 mg / vial vial , acyclovir tab 200 mg 10 x 10 , acyclovir tab 800 mg 10 x 10 , albendazole 200mg / 5 ml 10 ml bottle , albendazole tab 400 mg 10 x 10 , amikacin inj 100 mg / 2 ml 2 ml vial , amikacin inj 500 mg / 2 ml vial2 ml vial , amoxycillin cap 250 mg 10 x 10 , amoxycillin cap 500 mg 10 x 10 , amoxycillin oral suspension 125 mg / 5 ml30 ml bottle , amoxycillin +clavulanic acid inj ( amoxycillin 500 + clavulanic acid 100 mg ) / vial , amoxycillin +clavulanic acid syp ( amoxicillin 200mg + clavulanic acid 28.5mg ) / 5ml 30 ml bottle , amoxycillin +clavulanic acid tab ( amoxycillin 500 + clavulanic acid 125mg ) 10 x 10 , amphotericin b injection 50 mg vial / ampoules , ampicillin cap 500 mg 10 x 10 , ampicillin inj 500 mg / vial , artesunate inj 60 mg / vial , artesunate powder for injection 120 mg , artesunate + sulphadoxine + pyrimethamine ( age group 15 or above ) ab artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg ( 2tablets ) + pyrimethamine 37.5 mg ( 2 tab ) tablets ip1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ab artesunate 150mg ( 3tab ) + sulphadoxine 500mg ( 2 tab ) +pyrimethamine 25mg tab ip ( 2tab ) 1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 years ) tab artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg ( 1 tab ) + pyrimethamine 25 mg ( 1 tab ) tablets ip 1 combi pack , azithromycin tab 250 mg 10 x 10 , azithromycin tab 500 mg 10 x 10 , azithromycin syp 200mg / 5ml 15 ml bottle , benzathine penicilline 6 lakh iu / vial , benzathine penicilline 12 lakh iu / vial , cefixime tab 50 mg 10 x 10 , cefixime tab 200 mg 10 x 10 , cefixime oral suspension 100mg / 5ml 10 ml bottle , cefotaxime inj 250 mg / vial , cefotaxime inj 500 mg / vial , cefotaxime inj 1gm / vial , cefpodoxime tab 200 mg 10 x 10 , ceftazidime powder for injection 250 mg , ceftazidime powder for injection 1gm , ceftriaxone inj 250 mg / vial , ceftriaxone inj 500 mg / vial , ceftriaxone inj 1 gm / vial , cephalexin cap 250 mg 10 x 10 , cephalexin syp 125mg / 5ml 30 ml bottle , chloroquine inj 40 mg / ml 5 ml amp , chloroquine syp 160mg / 10ml ( 50mg / 5ml base ) 60 ml bottle , chloroquine tab 250 mg 10 x 10 , ciprofloxacin tab 250 mg 10 x 10 , ciprofloxacintab 500 mg 10 x 10 , ciprofloxacin inj 200 mg / 100 ml 100 ml ffs bottle , clarithromycintablet 250 mg 10 x 10 , clindamycin capsule 150 mg 10 x 10 , clofazimine tablet 50 mg 4 10 x 10 , clofazimine capsule 100 mg 10 x 10 , clotrimazole ( vaginal tab ) pessary 500 mg ( with applicator ) single tab , clotrimazole cream 2%w / w 15 gram tube , cloxacillin capsule 125 mg 10 x 10 , cloxacillin capsule 500 mg 10 x 10 , cycloserine capsule 125 mg 10 x 10 , dapsone tablet 100 mg 10 x 10 , diethylcarbamazine tab 100 mg 10 x 10 , diethylcarbamazineoral liquid 120 mg / 5 ml , diloxanide furoate tablet 500 mg 10 x 10 , doxycycline cap 100mg 10 x 10 , doxycycline dry syrup 50 mg / 5 ml , fluconazole tab 150 mg 10 x 10 , furazolidone tab 100 mg 10 x 10 , gentamicin inj 40 mg / ml 2 ml amp , itraconazole tablet / capsule 100 mg 10 x 10 , ivermectin tab 12 mg 10 x 10 , levofloxacin tab 250 mg 10 x 10 , levofloxacin tab 500 mg 10 x 10 , linezolid tablet 600 mg 10 x 10 , meropenem 500 mg vial , metronidazole inj 500 mg / 100 ml100 ml ffs bottle , metronidazole tab 400 mg 10 x 10 , metronidazole oral suspension 200 mg / 5ml 60 ml bottle , norfloxacin tab 400 mg 10 x 10 , norfloxacin dispersible tablet 100 mg 10 x 10 , ofloxacin 200 mg 10 x 10 , ofloxacin 400mg 10 x 10 , piperacillin +tazobactam inj 4.5 gm / vial vial , primaquine tab 2.5 mg 10 x 10 , primaquine tab 15 mg 10 x 10 , primaquine tab 7.5 mg 10 x 10 , quinine inj 300 mg / ml 2 ml amp , quinine tab 300 mg 10 x 10 , sodium aminosalicylate granules 10 gm , sulfamethoxazole and trimethoprim tab800mg + 160mg 10 x 10 , sulfamethoxazole +trimethoprim tab200mg +40 mg 10 x 10 , sulfamethoxazole +trimethoprim oral liquid ( 200mg +40 mg ) / 5 ml 50 ml bottle , sulfamethoxazole+trimethoprim ( pediatric tablets ) tab 400 mg+80 mg 10 x 10 , tablet artemether ( a ) + lumefantrine ( b ) tablet 20 mg ( a ) + 120 mg ( b ) 1x6 tab , tablet artemether ( a ) + lumefantrine ( b ) oral liquid 80 mg ( a ) + 480 mg ( b ) / 5 ml , tablet artemether ( a ) + lumefantrine ( b ) tablet 80 mg ( a ) + 480 mg ( b ) , tablet penicillin v ( phenoxymethyl penicillin ) 250 mg , tinidazole tab 300 mg 10 x 10 , vancomycin powder for injection 1 g , vancomycin powder for injection 250 mg , vancomycin powder for injection 500 mg , flunarizine tablet 5 mg 10 x 10 , sumatriptan tablet 25 mg 10 x 10 , 5 fluro uracil 500 mg , bendamustine inj 100 mg , calcium leucovorin 50mg , capecitabine 500 mg , carboplatin 450 mg , cisplatin 50 mg , cyclophosphamide 500 mg , bleomycin inj 15 mg , docetaxel 120 mg , doxorubicin 50 mg , epirubicin 100 mg , bortezomib inj 2 mg , etoposide 100 mg , decarbazine inj 200 mg 10 mg / ml , erlotinib tab 150 mg , exemestine tab 25 mg , gemcitabine1.4 mg , fulvestrant inj 500 mg , imatinib mesylate 400 mg , gefitnib tab 250 mg , methotraxate 50 mg , oxaliplatin 100 mg , paclitaxel 260 mg , hydroxyurea cap 500 mg , ifosfamide inj 1 gm , tamoxifen 20 mg , irinotecan inj 100 mg , vincristin 1 mg , lenalidomide tab 25 mg , zoledronic acid 4 mg , letrozole tab 2.5mg , doxorubicin , pemetrexed inj 50 mg , pomalidomide cap 2 mg , rituximab inj 500 mg , sorafenib tab 200mg , sunitinib tab / capsule50 mg , temozolamide tab 250 mg , topotecan inj 4 mg , trastuzumab inj 440 mg , vinblastin inj 10 mg , vinorelbine inj 10 mg , trihexyphenidyl tab 2 mg 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 10 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 25 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 250 mg ( a ) + 25 mg ( b ) 10 x 10 , diltiazem injection 5 mg / ml , adenosine inj 3 mg / ml 2 ml amp , amiodarone inj 50 mg / ml 3 ml amp , amiodarone tab 100 mg 10 x 10 , amlodipine tab 5 mg 10 x 10 , amlodipine tab 10 mg 10 x 10 , atenolol 100 mg 10 x 10 , atenolol tab 50 mg 10 x 10 , atorvastatin tab 10 mg 10 x 10 , atorvastatin tablet 40 mg 10 x 10 , chlorthalidone 12.5mg , chlorthalidone 25mg , clopidogrel tab 75 mg 10 x 10 , digoxin tab 0.25 mg 10 x 10 , digoxintab 250 mg 10 x 10 , diltiazem sr tablet 90 mg 10 x 10 , diltiazem tablet 60 mgl tablet 60 mgl 10 x 10 , diltizem tab 30 mg 10 x 10 , dobutamine inj 50 mg / ml 5 ml amp , dopamine inj 40 mg / ml5 ml amp , enalapril maleate tab 10 mg 10 x 10 , esmololinjection 10 mg / ml , finofibratetablet160 mg 10 x 10 , finofibrate tablet 40 mg 10 x 10 , hydrochlorothiazid tablet 12.5 mg 10 x 10 , hydrochlorothiazid tablet 50 mg 10 x 10 , isosorbide 5 mononitrate tab 20 mg 10 x 10 , isosorbide dinitrate tab 5 mg 10 x 10 , labetalol tab 100 mg 10 x 10 , labetalol inj 20 mg / 4 ml 4 ml amp , labetalol injection 5 mg / ml , methyldopa tab 250 mg 10 x 10 , metoprolol sr tab 25 mg 10 x 10 , metoprolol sr / plain tab 50 mg 10 x 10 , nifedipine cap 5 mg 10 x 10 , nifedipine tab 10 mg 10 x 10 , nitroglycerine ( glyceryl tri nitrate ) sub lingual tab 0.5 mg 10 tab , nitroglycerine ( glyceryl tri nitrate ) inj 25 mg / 5 ml 5 ml amp , noradrenaline inj 2 mg base / 2 ml amp. 2 ml amp , propranololtab 10 mg 10 x 10 , protamineinjection 50 mg / 5 ml , ramipril tab 2.5 mg 10 x 10 , streptokinaseinjection 15 lac / vialvial , telmisartan tab 40 mg 10 x 10 , verapamil tab 40 mg 10 x 10 , verapamilinjection 5 mg / 2 ml , urokinase ( 5 laciu ) vial , gum paint ( tannic acid ) 2% w / v 15 ml bottle , gutta percha ( gp ) 30tab / bottel , light cure composite , ketorolac10 mg tablet 10 x 10 , povidine iodine germicide gargle 20% w / v , gamma benzene hexachloride , benzoyl peroxide gel 5% , betamethasoneinjection 4 mg / ml 1 ml amp , betamethasone dipropionate ointment 0.05% 15 gram tube , calamine lotion 50 ml bottle , framycetin sulphate 1% cream 30 gram tube , fusidic acid cream / ointment 2% 5 gram tube , glycerin oral liquid , miconazole cream 2% w / w 15 gram tube , mupirocin cream / ointment 2% 5 gram tube , permethrin permethrin lotion 5% w / v ( 60 gm bottle , salicylic acid , silver sulphadiazine cream usp 1% 25 gram tube , haemodialysis fluid , intraperitoneal dialysis solution , bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) containing not less than 30% w / w of available chlorine ( as per i.p ) 25 kg bag , cetrimide solution 20% ( concentrate for dilution ) , hydrogen peroxidesolution 6% , povidone iodine solution 5%, 100 ml bottle , povidone iodinevaginal pessary 200mg 10 x 10 , povidone iodine 5% ointment 15 gram tube , acetazolamide tab 250 mg 10 x 10 , furusemide tab 40 mg 10 x 10 , furusemide inj 10 mg / ml2 ml amp , hydrochlorothiazide tab 25 mg 10 x 10 , mannitol inj 20% 100 ml ffs bottle / 350 ml ffs bottle , mephentermine injection 30 ml vial mg / ml 10 ml vial , spironolactone tablet 25 mg 10 x 10 , xylometazoline nasal drops: adult ( 0.1% ) , boro spirit ear drops 0.183 gm boric acid in 2.08 ml of alcohol , normal saline nasal drops: sodium chloride drops 0.05% w / v , xylometazoline nasal drops 0.05 %, , turpentine oil 15% w / v 50ml bottel , wax solvent ear drops: benzocaine 2.7% w / v 10 ml bottel drop , wax solvent ear drops:paradichlorobenzene 2 % w / v 10 ml bottel , activated charcoal , hyoscine butylbromide 20mg / ml 1 ml vial / amp , tab mebeverine tab 200 mg 10 x 15 , bisacodyl tab 5mg10 x 10 , bisacodyl suppositories 5 mg 10 x 10 , dicyclomine hydrochloride inj 10 mg / ml 2 ml amp , dicyclomine hydrochloride tab 20 mg 10 x 10 , domperidone tab 10 mg 10 x 10 , domperidone 1mg per 1ml suspension , lactulose solution 10 gm / 15 ml , metoclopramide inj 5 mg / ml , metoclopramide tab 10 mg 10 x 10 , ondansetron tab 4 mg 10 x 10 , ondansetron inj 2 mg / ml 2 ml am , ondansetron syp 2mg / 5 ml 30 ml bottle , pantoprazole inj 40 mg / vial vial , rabeprazole tab 20 mg 10 x 10 , ranitidine tab 150 mg 10 x 10 , ranitidine inj 50 mg / 2 ml 2 ml amp , dicyclomine tablet 500 mg 10 x 10 , loperamide tablet 2 mg 10 x 10 , losartan 10 mg 10 x 10 , drotaverine inj 40 mg / 2 ml 2 ml amp , drotaverine tab 40 mg 10 x 10 , sucralfate syrup 1gm / 5ml 100ml bottle , sucralfatetablet 20 mg 10 x 10 , bicalutamidetablet 50 mg 10 x 10 , tamoxifen tablet 10 mg3 10 x 10 , ethinylestradioltablet 0.05 mg 10 x 10 , ethinylestradioltablet 0.01 mg 10 x 10 , empagliflozin 25 mg 10 x 10 , ethinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10 x 10 , glibenclamidetablet 5 mg 10 x 10 , human chorionic gonadotropininjection 10000 iu vial of 1 ml injection , human chorionic gonadotropin injection 5000 iu vial of 2 ml injection , levonorgestreltablet 0.75 mg 10 x 10 , medroxyprogesteronetablet 10 mg 10 x 10 , medroxyprogesterone acetate injection 150 mg 1 ml / vial , methylprednisoloneinjection 1000 mg / ml vial , methylprednisolone tablet 16 mg 10 x 10 , methylprednisolonetablet 16 mg 10 x 10 , methylprednisolonetablet 4 mg 10 x 10 , ormeloxifenetablet 30 mg 10 x 10 , premix insulin 30:70 injection ( regular: nph ) 2 , premix insulin30:70 injection 40 iu / ml , sitagliptin tab 50 mg 10 x 10 , thinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) with ferrous fumarate10 x 10 , metformin sr 1000mg 10x15 , pioglitazone 15mg , biphasic isophane insulin insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges , carbimazole , carboprost ( 15 methyl pgf2a ) inj 250mcg 1 ml amp , clomiphene citrate 50 mg tab 10 x 10 , gliclazide tab 80 mg 10 x 10 , glimeperide tab 1 mg 10 x 10 , glimeperide tab 2 mg 10 x 10 , glucose packet 75 mg for ogtt test glucose packet 75 mg for ogtt test packet , insulin soluble inj 40 iu / ml 10 ml vial , levothyroxine tab 50 mcg 100 tab per bottle , levothyroxine tab 100 mcg 100 tab per bottle , metformin tab 500 mg 10 x 10 , iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection , anti d immunoglobulin for iv / im use ( monoclonal ) inj 150mcg 1 ml vial , anti d immunoglobulin for iv / im use ( monoclonal ) inj polyvalent 10 ml ( lyophilized ) inj 300mcg pfs / vial , anti snake venom , antitetanus immunoglobulins inj 250 iu / vial vial , hepatitis b immunoglobulin 100 iu / vial vial , rabies immunoglobulin 300 iu / 2 ml2 ml vial , rabies vaccine ( cell culture ) id / im inj 2.5 iu / ml 1 ml vial , formoterol inhaled bronchodilator , levosulbutamol 100 mcg , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 15mg+1.25mg+50mg / 5m 100ml bottle , aminophylline inj 25 mg / ml 10 ml vial , bromhexine syp 4mg / 5ml 50 ml bottle , budesonide nebulising suspension containing budesonide 0.5 mg / 2 ml 2 ml amp , caffeine citrate inj 20 mg / ml 3 ml vial , deriphylline tablet sr 300 mg 10 x 10 , etophylline +theophylline tab 100 mg ( etophylline 77 + theophylline 23 ) mg 10 x 10 , etophylline +theophylline inj 220 mg / 2 ml ( 169.4+50.6 mg ) 2 ml amp , ipratropium inhalation ( mdi / dpi ) 20 mcg / dose ipratropium respirator solution for use in nebuliszer 250 mcg / ml , levosalbutamol 50mcg / dose , montelukastsyrup 60 ml bottle , montelukasttablet 5 mg 10 x 10 , salbutamol tab 4 mg 10 x 10 , salbutamol inhaler 100mcg / dose metered dose container , salbutamol syp 2mg / 5ml 60 ml bottle , syrup dextromethorphan syrup 10 mg / 5 ml 100 ml pack bottle , tiotropium inhalation ( dpi ) 18 mcg / dose , tiotropium inhalation ( dpi ) 9 mcg / dose , human albumin solution 5% bottel 250 ml , deferasirox tab 250mg 10 x 10 , dispersable tablet hydroxyurea 100 mg 10 x 10 , enoxaparin inj 40 mg equivalent to 4000 iu vial / pfs , erythropoietin injection 2000 iu / ml , erythropoietin injection 10000 iu / ml , ethamsylate tablet tab 250 mg 10 x 10 , heparin inj 1000 iu 5 ml vial , hydroxyureacapsule 500 mg 10 x 10 , inj. deferoxamine 500mg / vial vial , recombinant factor eight inhibitor bypassing activility ( feiba ) 500 units , recombinant factor ix 500iu , recombinant factor vii a 1 mg , recombinant factor viii 250iu , 500iu , tab. deferasirox tab 500 mg 30 tab , tab. deferiprone 500mg 10x10 , tranexamic acid inj 500 mg / 5 ml. , tranexamic acid tab 500mg 10x10 , warfarin tab 5 mg 10x10 , warfarin tablet 1 mg 10x10 , warfarin tablet 2 mg 10x10 , caffeine oral liquid 20 mg / ml , surfactant suspension inj 25 mg / ml 100 ml vial , donepezil tablet 5 mg 10 x 10 , water for injection , water for injection 5 ml amp 2 ml amp , disulfiram tablet 250 mg 10 x 10 , baclofen baclofen 40 mg tablet10 x 10 , duvadilan 10 mg10x50 , duvadilan inj 5mgvial , neostigmine inj 0.5 mg / ml 1 ml amp , vecuronium inj 2 mg / ml 2 ml amp , pilocarpine drops 4% 5 ml bottel , acyclovir ointment3% 5gm tube , atropine sulphate 1%, tube , 3 gm , carboxymethylcellulosedrops 0.5% 10 ml / vial , dexamethasone drop ( 0.1%, 5ml ) , eye drop 5ml eye drop , fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye drop10 ml eye drop , homatropinedrops 2% , lantanoprost 0.005% ( 5ml ) , eye drop 5ml eye drop , moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 5ml eye drop , pilocarpinedrops 2% 5 ml bottel , pilocarpine drops 1% 5 ml bottel , prednisolone drops 1% 10 ml bottel , tropicamide drops 1% 5 ml drop , atropine 1% eye ointment 3 gram tube , atropine 1% eye drops 5 ml vial , chloramphenicol eye ointment 0.5% 4g / 5g tube , ciprofloxacin eye / ear drop 0.3% 5 ml vial , ciprofloxacin eye ointment 0.3% 3 / 3.5 gram tube , combo ear drop chloramphenicol 5% w / v +clotrimazole 1% +lignocaine hydrochloride 2% 5 ml drop , gentamicin ear / ear drop ( 0.3% ) 5 ml vial , timolol 0.5% eye drops 5 ml vial , codeine oral solution 15 mg / 5 ml 60 ml bottle , morphineinjection 15 mg / ml vial , morphine tablet 10 mg 10 x 10 , morphine tablet sr / 30 mg 10 x 10 , oxytocin injection 5 iu / ml injection 5 iu / ml1 ml ampule , drotaverine inj 40 mg / 2 ml 2 ml amp , methyl ergometrine maleate inj 0.2 mg / ml 1 ml amp , misoprostal tab 200 mcg 4 tab in 1 pack , combi pack with mifepristone + misoprostol ( 1 tablet of mifepristone 200 mg and 4 tablets of misoprostol 200mcg ) combi pack , methyl ergometrine maleate tab 0.125 mg 10 x 10 , mifepristone tab 200 mg 1 tab per pack , misoprostal tablet 100mcg 4 tab pack , misoprostoltablet 200mcg ( oral / vaginal ) 4 tab pack , risperidone 50 mg , alprazolam tab 0.25 mg 10 x 10 , chlorpromazine tab 100 mg 10 x 10 , clonazepam tablet 0.5 mg 10 x 10 , clozapine tablet 50 mg 10 x 10 , clozapine tablet 25 mg 10 x 10 , diazepam inj 5 mg / ml 2 ml amp , diazepam tab 5 mg 10 x 10 , escitalopram tablet 10 mg 10 x 10 , fluoxetine capsule 20mg 10 x 10 , fluphenazineinjection 25mg 1ml vial / ampoules , haloperidol inj 5 mg / ml 1 ml amp , haloperidol tab 5 mg 10 x 10 , imipramine tablet 25 mg 10 x 10 , lithium carbonatetablet 300 mg 10 x 10 , lorazepam tab 1 mg 10 x 10 , lorazepam inj 2 mg / ml , olanzapinetablet 5 mg 10 x 10 , olanzapine 10 mg 10 x 10 , phenobarbitonetablet 60mg 10 x 10 , promethazine injection 50 mg ( 25mg / ml ) 2ml vial / ampoules , risperidone tab 2 mg 10 x 10 , zolpidem 10 mg 10 x 10 , calcium gluconate inj 10% 10 ml vial , d 10 ( dextrose 10% ) iv fluid ( dextrose 10% ) 500 ml ffs bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 100 ml bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 500 ml bottle , dextrose 5% iv fluid ( dextrose 5% ) 500 ml ffs bottle , dextrose with saline i / v fluid ( dextrose 5% + saline 0.9% ) 500 ml ffs bottle , glucose ( a ) + sodium chloride ( b ) injection 5% ( a ) + 0.9% ( b ) 500ml ffs bottle , hydroxyethyl ( 6% saline solution for infusion ) starch 6%ip , pediatric solution like isolyte p, n / 2 & n / 5 pediatric solution like isolyte p, n / 2 & n / 5 100 ml bottle , potassium chloride oral solution 100mg / ml 200 ml bottle , reduced osmolarity ors pkt. who formula o.r.s. glucose 75meq, sodium 75m eq or m mol / l, chloride 65meq or m mol / l, potassium 20meq or m mol / l , citrate 10m mol / l osmolarity 245m osm / l, dextrose 13.5g / l sodium chloride 2.6g / l potassium chloride 1.5g / l, trisodium citrate dihydrate 2.9g / l+trisodium citrate dihydrate may be replaced by sodium hydrogen carbonate ( sodium bi carbonate ) 2.5g / l. sachet of 21.8gm , ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , sodium bicarbonate inj 7.5% w / v 10 ml amp , sodium chloride hypotonic inj n / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 100 ml ffs bottle , nicotinamide tablet 50 mg7 10 x 10 , ascorbic acid ( vitamin c ) tablet 100 mg tablet 100 mg 10 x 10 , calcium carbonate .tab 500 mg 10 x 10 , calcium with vitamin d3 calcium equivalent to 500 mg & vit. d3 250 iu 10 x 10 , ferric carboxymaltose 250mg 10 x 10 , ferric carboxymaltose 50mg / ml 20 ml vial , folic acid tab 5mg 10 x 10 , iron & folic acid syp iron each 1 ml contains 20mg elemental iron+folic acid 100 ?g 50 ml bottle with dropper , iron & folic acid sugar coated iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets 10 x 10 , iron sucrose inj 100 mg / 5 ml 5 ml amp , multivitamin sugar coated tab nfi formula sugar coated vit a 2500 iu , vit c 50mg, calcium pantothenate 1mg, vit b1 2 mg vit b6 0.5 mg vit d3 200 iu vit b2 2mg niacinamide 25mg folic acid 0.2mg. 10 x 10 , pyridoxine tab 10 mg 10 x 10 , pyridoxine tablet 40 mg 10 x 10 , pyridoxine tablet 100 mg 10 x 10 , riboflavin tablet 5 mg7 10 x 10 , thiamine injection 100 mg / ml , thiamine tablet 100 mg7 10 x 10 , vitamin a syp 100000 iu / ml with marked spoon for 1ml &2ml 100 ml bottle , vitamin k1 inj 1 mg / 0.5 ml 0.5 ml amp , vitamin. b complex tab nfi ( prophylactic ) b1 2 mg, b2 2mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg 10 x 10 , zinc sulphate tab dispersible 10mg 10 x 10 , zinc sulphate tab dispersible 20mg 10 x 10 , vitamin b12 inj, injection 500 mcg / ml ( 30 ml amp / vial ) , glacial acetic acid 99.99% 500 ml , visco pfs 3 ml prefilled syringe opthalmic , disposable gown , diclofenac+menthol 30 gm tube , cap antioxident 10x10 , tab. paracetamole 325 mg+ chlorpheniramine 4 mg + phenylepherine 10 mg 10x10 , syp diphynhydramine 100 ml , multivitamin drops 22 drops approx , material name , alkaline phosphatase 10x 22ml erba comfitable make , anti h span / tulip comfitable make , anti a1 lactin , anti d ( 1gg+2gm ) tulip / span / j.mitra comfitable make , anti ab anti sera span / tulip 10 ml comfitable make , ahg span / tulip vial comfitable make , abg cartiadge , albumine kit erba comfitable make , acitic acid 5% , acetone kit , bloting paper , bacilol , baby msks size 0, 1 , blood administration set , barium sulphate powder, susp. 95%w / v, powder ( hd ) 95% w / v 400 gram. , benedicts soluton ( qualitative ) 500 ml bottle , blood groupingseara antia, b&d ( 10 ml ) j.mitra / span / tulip comfitable make , blood lancet , blood bag 100 ml j.mitra / haemopack, hll life care comfitable make , blood bag 350 ml j.mitra / haemopack, hll life care comfitable make , blood bag 150ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood bag 200ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood cell counter key based gem , barium chloriad powder , barium chloriad ( 500 ml ) , brain tromoblastin for , b.t.c & c.t tube , basik fucksion powder , bruck sitrick , cidex , csf protien kit , csf suger kit , calcim reagent , crp kit ( agapee ) j.mitra / span qualicative 50 test kit comfitable make , crp kit 50 test kit erba comfitable make , cpk mb kit erba comfitable make rapid kit , capillaries ( serumbilirubinometer ) , capillaries ( wax ) , capillary tube for bt&ct , cover shlip ( 40gm ) , calorie meter , cyanemeth solution for hb ( drabkins solution , carbol fuchsin , culture media with nutrient agar high media company comfitable make , culture media with maconkey agar high media company comfitable make , culture media with blood agar high media company comfitable make , culture media with peptone water high media copany comfitable make , culture media with nutrient broth high media company comfitable make , culture plate , chikunguniya , counting numbers ( chekers ) , detaction for protien in urine ( uristixs ) 100strip , disposable cups for urine collection with screw cap , distilled water 5 letter , digital anyalytical balane 0.1gm to 160 gm , dengue card test span / j.mitra comfitable make , dropper rubber , drop mct oil , d.p.x. wax qualigence , esr tube , elisa plate reader with washer and printer , edta250 gm powder , e.d.t.a powder 500 gm , edta vial with screw cap , edta solution , electrolyte analyser reagents pack na+, k+ accurex enlite 2 para , electrolyte analyser reagents deproteinize , electrolyte analyser reagents riffil solution forna+, k+ and reffrence electrode , thermal paper roll for cell counter machine , electronic chemical weings scale , emmersion oil30ml , formaldehyde ( formalin ) 37% acq. 450 ml bottle , fliltter paper , field stain a qualigens , field stain b qualigens , forchest reagents 125 ml bottel , flask , flask , falckon tubecultre sterlized , glucose kit ( godpod ) , glutaraldehyde lotion 2% w / v stabilized 5 ltr. cans , glass droper , glass test tubes borosil glass 18 x 150 mm , glass piaptte , glass beaker 100 ml , glass beaker 200 ml , glass marking pencil ( white ) , glucometer sd company comfitable make , haemoglobin colour scale , heamocyto meter , glucometer stripsmorphan` comfitable make , glucometer strips acuchaklcomfitable make , glucometer stripssd company code free ivd , hydrogen peroxide sol. 20% w / v 1 ltr. bottle , h2so4 acid 20% , hb pipate , hb tube , hbsag card test rapiedj.mitra / span comfitable make , hdl chloleslestrol kit , h.c.v card rapid span / ing comfitable make , hdl kit erba comfitable make , hiv kit , hiv test card tridot flow through paste 3 dot span / j.mitra comfitable make , hematolgy cell counter reagents erma company pce 210 autodil er comfitable make , hematolgy cell counter reagents erma company pce 210 autolyse er comfitable make , hematolgy cell counter reagents erma company pce 210 autoclean er comfitable make , haemoglobin meter isi marked superior quality , hand sanitizer sterilium , incubator superior quality isi marked microbiology , listaman stain ( 500ml ) qualicative , laugles ioden , led bulb , lance paper , liquid hand wash , micropore , micro glass slide packet 50 slide packet , mp antigen test card for view for falciferum ozon / span / j.mitra comfitable make , malaria card test antibody j.mitra / span comfitable make , methylene blue , mithylated sprit100% , micropippate tips large , micropippate tips small , micropippate for analyzer erba company variable 5 50 comfitable make , micropippate for analyzer erba company variable 10 100 comfitable make , micropippate for analyzer erba company varialbe100 1000 comfitable make , micropippate for analyzer erba company varialbe 2micrlit. 1000 microlit comfitable make , multichanel pippate , n / 10 hcl , nitric acid 500 ml , new warce chamber , platilate diluting fluid , pt reagents span comfitable make , aptt reagents spancomfitable make , pandys reagent for csf , preganacy test strip 100strip , pasture piaptte ( borosil ) comfitable make , piaptte glass , phenol crystol , peatidisc large disposable , peatidisc small disposable , plain vial 12 x 75 with screw cap , permanentmarkers , pollythin 30 lit capacity , rapid pap kit span , rapid test kit for torch tes ( 1gm+1gg ) , r.b.c dilluting fluid ( 500 ml ) , r.a.factor 50 test kit qualicative j.mitra / span comfitable make , serum bluribine 4 x60 ml erbacomfitable make , serum bovine albumine 22% bsb span / tulip comfitable make , sodium citrate 3.8 % , sodium hypochlorid 5 lit jar , sulphuric acid ( 450 ml ) , serum tringlyieride ( 5x20ml ) , serum creatinine kit erba company 4 x60 ml comfitable make , serum protien kit erba comfitable make , staning rack , slide markers , slide stand , slide box 50 soidde , spirit lamp , sulpher powder , sulfuric acid 100% , semun diluting fluid , stop watch digtal , sypllis test card jaimitra / spam / biolab comfitable make , sputam cuntnar disposable , stickers ( blank ) 2x1 cm , twinket balt , taste tubeglass ( borosil ) 7.5x 12mm15 ml comfitable make , taste tubeglass ( borosil ) 7.5x 12mm5 ml comfitable make , tissue puper , teat rubber 1 ml , teat rubber 2 ml , teat rubber 5 ml , typhoid card test kitj.mitra / span comfitable make , torch test kit j.mitra / span comfitable make , t3, t4 tsh kit , test tube stand 10 holl , test tube stand 20 holl , thermocol box with packd , thermometer for water wath , triglyceride kit erba comfitable make , vdrl kit for sypllis comfitable make , vdrl kit j / mitra / span 50 test kit qualicative comfitable make , water wath , w.b.c dilluting fluid ( 500 ml ) , wbc diluting fluid 100ml , wintrob tube stand , xylene qualigens , zentition viloet 0.25% , zentition viloet 0.5% , zn stain , feeding tube for infant no. 6 , oxygen mask child , oxygen mask adult , cord clamp dispossable , plastic tubs , reagents for semi auto anyalyzer erba company , blood glucose kit erba company 50 test kit comfitable make , blood urea kit erba company 50 test kit comfitable make , sgpt test kit erba company 50 test kit comfitable make , sgot test kit erba company 50 test kit comfitable make , g6pd test kit erba company 50 test kit comfitable make , blood grouping sera 5 ml anti ab&d set j.mitra / span / tulip comfitable make , widal test kit erba company 50 test kit comfitable make , vdrl test kit erba company 50 test kit comfitable make , cholestrol kit erba company 50 test kit comfitable make , austrailia antigen card test , rpr kit for syplis 50 kit , lead protection partion , lead letters , lead protective barrir , lead goggle , lead protectvie apprean , lead rubber glove , lead gonad shield , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , xray castetes kiran, kr8 , xray castetes , xray castetes , xray castetes , xray hangers , xray hangers , xray hangers , xray hangers , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray dental film 50 sheet packet , x ray developerpowder , x ray developerpowder , x ray fixerpowder , x ray fixerpowder , x ray view box , xray safe light , absorbent cotton wool ip 500 gm paket , absorbable gelatine sponge ip 66 80mm x 50mm x 10 mm , adhesive plaster usp 7.5 cm x10mts / roll , adhesive plaster usp 7.5 cm x5 mts roll , bismith lodoform paraffin paste , boric acid with sprit drop , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 / 0 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 2 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no1 / 0 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 2 , b.b silk with 3 / 8 cir rb reverse 2 / 0 cutting needle 45 mm length 76cm , b.b silk6 reels x 25 mts length 25 mts , cotton roll100 gm , cresol with soap sol. 5 ltr. cans , chromie with cd. rb needle 40 mm length 75cm , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 0 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 0 , crap bandageall sizes , poly propylene with 1 / 2 cir rb needle 30 mm length 70 cm , poly propylene with 1 / 2 cir rb needle 40 mm length 70 cm , poly propylene with 1 / 2 cir rb heavy needle 30 mm length 70 cm , poly propylene with cutting needle 45 mm lengyh 100 cm , poly propylene with curved 8 / 0 rb bv double needle 7.6 mm length 60 cm , disposable syringe with needle cgs 1cc with mark 0 1ml , disposable syringe with needle cgs 2cc , disposable syringe with needle cgs 5cc , disposable syringe with needle cgs 10cc , disposable syringe with needle cgs 20cc , disposable syringe with needle cgs 50cc , disposable suction cather size: 12, 14 , disposable scale vein set size 20g , disposable scale vein set size 22g , disposable needle 18 g ( single use ) , disposable needle 20 g ( single use ) , disposable needle 22 g ( single use ) , disposable needle 23g ( single use ) , ecg gel 250 ml bottle , ecg paper80mm x 20mts for manual ecg machine bpl company 6208 view / view plus chemical red comfitable make , ecg paper 50mm x 20 mts computerzed for computer bpl company 6108tchemical blue comfitable make , endotracheal tube no 2.5 , endotracheal tube no 3 , endotracheal tube no 3.5 , endotracheal tube no 5 , endotracheal tube no 7 , endotracheal tube no 8 , foleys urinaty catheter size 8 ( 2way ) , foleys urinaty catheter size 10 ( 2way ) , foleys urinaty catheter size 14 ( 2way ) , foleys urinaty catheter size 16 ( 2way ) , foleys urinaty catheter size 18 ( 2way ) , foley balloon cather three way ( a ) fg 24 , glycerinc ip 30 ml plasric bottle , gention violet paint 0.5% 100ml bottle , hmf sachet , iv cannula ( two way ) size 18 , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula ( two way ) size 26 , i.v. cannula sizes 23 two way , intravenous set ( adult ) with airway and needle , intravenous set ( children ) with airway and needle , infant mucus extractor , infant feeding tube ( catheter ) 8 g , infant feeding tube ( catheter ) 10 g , infant feeding tube no. 3.5 , infant feeding tube no. 7 , liquid paraffin ip 500 ml bottle , liqued stesimox , lysol , mackintosh double colour water proof , micro drip set , metrasses 3×6 with raxine cover 4 density , metrasses 2 5×4 with raxine cover 4 density for child bed , needle hypodermic insulin needle ( metallic non sterile ) size 26 gx1 / 2 , nasal prom for neonatiol , n 95 mask for swine flue , disposable mask , l.p. needle no. 22 , l.p. needle no. 23 , oxygen catheter , oxyzen flowmeter regulator , oxygen tube , plaster of paries 1kg pkt.isi qulity , paper adhesive plaster 1x9.0 mts , p.o.p. bandag 6 inch , p.o.p. bandag 4 inch , peadiartic chamber set 110 ml , pressure monitoring line , pvc apron , ryles tube ( p.v.s ) childrn size 10, 12 , ryles tube ( p.v.s ) adult size 16, 18, 14 , sanitary pads , slippers all sizes , sterile gloves size 6 isi marked , sterile gloves size 6 1 / 2 isi marked , sterile gloves size 7 isi marked , sterile gloves size 7 1 / 2 isi marked , surgical blade size 11, 100 blade per packet , surgical blade size 15, 100 blade per packet , surgical blade size 21, 100 blade per packet , surgical blade size 22, 100 blade per packet , surgical blade size 23, 100 blade per packet , suture needles curved &1 / 2 circle cutting assorted sizes 1 5 , suture needles curved &1 / 2 circle cutting assorted sizes 6 10 , suture needles curved &1 / 2 circle cutting assorted sizes 11 15 , suture 10 0 nylone , suture 8 0 silk , suture 5 0 mono phalment , suction catheter no.7 green , suction catheter no.8 green , suction catheter no.16 green , suction catheter no.14 green , scalp vein set ( single use diposable ) size 23 gauge , scalp vein set ( single use diposable ) size 24 gauge , spoon marked 1 ml / 2 ml plastic , surgical spirit 100 ml bottle , sterlium hand wash , three way connector , tincture benzoin co. 500 ml bottle , ultra sonogram gel 250 ml bottle , urinary drainage bag , volium drip set , vicryl no.1 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.1 0 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.2 polyglyoviont 1 / 2 cir needle 95 cm , wax dissoluent , pamper for children , oxygen key , tab. chlorine 500 mg isi marked , tab. water purifying 4 gm , montex test 2 tu , montex test 5 tu , 1 twv csx ¼ftlessa vanj dh vksj ls , e vks , p , qq mcy;w@, q ih ds yksxks yxk, tk, xsaa½ 2 iseiysv nis gq, ¼lwpuk i= uofookfgr naifr ds fy, tkudkjh ½ 3 lksan;z lkexzh@ lopnrk csx ¼ deiyhv csx fueu lkexzh dk uke& rksfy;k lsv nksvk ] da?khfcanhirrk ] usy dvj ] nks lsv :eky ] lsusvjh usifdu isdsv vksj khkk nksvk ½ lfgr 4 tkudkjh dkmz nik gqvk ftlesa { ks=h; vkkk rfkk , , u , e dh laidz dh tkudkjh 5 lwpuk i= ¼xhkz izjh { k.k fdv ds mi;ksx laca / kh funszk ij lwpuk i=½ , d.mkse ckwdl ¼fvu½ , d.mkse ckwdl ¼qkbzcj½ , d.mkse ckwdl ¼ydm+h½ , osusvh ckwdl ¼fvu ½ , lsusvªjh usifdu isdsv 10 ihl , lsusvªjh usifdu isdsv 12 ihl , vkbzmsauvh fqdsku vsx qkwj u;w cksuz , vkbzmsauvh fqdsku vsx qkwj enj , digital wrist watch , digital thermometer , neonatal / infant weighing scale with sling , warm sleepig bag for neonates , blankets for neonates , mucus extractr , baby feeding spoon , torch with cells , bag for carrying kit / material during home visit , heamocheck book with strip complete , hemax cell cleaner 1 litre , hemax diluent 20 litre , hemax lyse 500ml , amber colored bottle 2 lit. , amber colored bottle 3 li. , ethanol absolute alcohol 500 ml , hcl 500 ml , diamond marker , tissue paper , auramine powder 25 gm , lense paper , thermacol box , sputum container , micro glass slide , forcep steel , weighing machine digital , water bath , paraffin role , spirit rectified 1 lit. , slide box 100 slide per box , glass beaker 200 ml , glass beaker 100 ml , permanent marker , slide rack , n / 95 mask , long stool lab , vinelands social maturity scale ( indian adaptalaion ) with manual , 16 pf questionnaire of age 16 and older with sheets with manual , binef kamath test of intelligence with manual , thematic apperception test ( indian adaption ) with manual , rorhchacs ink blot test cauds with location charts , nimhans neuro psychological battery for adult with manuals , nimhans index of sld with manuals , crescent blade , keraton ( 3.2 ) , disposable gown , vergin silk 8.0 black ( 1x12 ) , vergin silk 10.0 black ( 1x12 ) , vicryl 8.0 ( 1x12 ) , dark glass , cornear scissor , capsulereris forceps , scissor plain 4 inch , surgical blade 11 no. , side port , air cannula 27 g , fine port irrigaling vetis wire , banass scissor , trypan blue solution , propaciane hcl opthalmic solution , tropicaciyl plus eye drop , inj hyaluronidase ip 1500 iv , inj senscerocaine 0.5 1% , weight machine adult , scissor plain , artery forcep , tooth forcep , needle holder , oxygen flowmeter , cheatle forcep , sponge holdig forcep , bleaching powder 1 kg , stethoscope , labour ot fogging machine , ambu bag , cervical collar high neck , head mobilizer , fire extinguisherco2 2 kg , yoga mate , airotor hand piece , ultrasonic scaler , forcep ( set of 10 pieces ) , periosteal elevator , mouth mirror , sickle porpe , alginate , k file no. 10, 20 , 15, 25 , h file no. 15, 20, 25, 10 , formalin chamber , uv chamber , compressor , fracture plate , putty impression , zoe impression paste , upper & lower impression paste , abx diluent 20 lit can { horiba } , abx diluent 1 lit can { horiba } , white diff 1 lit { horiba } , abx minocleaner 100 ml { horiba } , printer ink modal h.p. tank4 bottel 3019 , t3 icromax , t4 icromax , tsh iromax , blood sugar erba , serum billirbin erba , blood uria erba , sgpt erba , sgot erba , uric acid erba , alkaline phosphate erba , total protin erba , hdl erba , total cholestrol erba , albumin erba , triglistride erba , diluent 20 lit hemax , :yse 500 ml hemax , cell cleaner e.z. 1 lit hemax , cleaner 100 ml hemax , printer |roll size 55 mm , printer roll size 50 mm , vtm kit 50 test / kit , standard q covid test card 25 test card / kit , face shield , ice gel pack 8x10 cm , brown tape 6 inch , zipper polythene 8x10 cm , polythene 1 kg red / black , sanitizer 100 ml , sanitizer 500 ml , shoe cover , disposable bed sheet , dead body suit , thermal scanner , pulse oxymeter , ppe kit , surgeon cap , disposable kelleys pad , latex examination gloves large 100 gloves / pkt , goggles , microglass slide blue star 50 slide / pkt , sanitiry napkin 8 pad / pkt , cough syrup sugar free 100 ml , tab vitamin c 500 mg sugar free , ct scan film 8x10 konica minolita , ct scan film 14x17 konica minolita , ct scan film 11x14konica minolita , shaving blade , ct scan film 10x12konica minolita...

Department of Higher Education - Madhya Pradesh

33579124 bids are invited for boq1 containers , boq2 sauce pan with lid , boq3 fry pan , boq4 tava roti / tava dosa , boq5 parrat , boq6 grater ( multipurpose ) , boq7 patila with lid , boq8 masala dabba , boq9 chimta , boq10 jhara , boq11 kadchhi , boq12 knife all types , boq13 peeler , boq14 chamcha , boq15 cutlery set , boq16 chakla belan , boq17 kadahi with lid , boq18 dinner set ( steel ) , boq19 bucket , boq20 dustbin , boq21 tub , boq22 pressure cooker , boq23 lighter , boq24 tray , boq25 crockeries ( tea set borosil glasses ) , boq26 namak daniset , boq27 stiching material—needle box. , boq28 chimni , boq29 gas chula with cylinder. , boq30 indection , boq31 paper napkins , boq32 cloth napkin , boq33 table mat , boq34 model parts of flower , boq35 model kidney , boq36 model human eye & ear , boq37 model brain , boq38 model heart , boq39 model of electric bell , boq40 weighting machine digital , boq41 microscope , boq42 stop clock , boq43 home science charts set , boq44 centrifue machine , boq45 sonometer sccale , boq46 scale electronice , boq47 weight sclae , boq48 calcium oxide , boq49 clycerol , boq50 iodine solution , boq51 phenol , boq52 glacial acetic acid , boq53 safferemine , boq54 potassium mydroxide , boq55 canada balson , boq56 fehling solution , boq57 calcium chloride , boq58 acid accumulator , boq59 cylender noggel / regulator / rubber set , boq60 bottele opener , boq61 sweing machine , boq62 washing machine , boq63 fabric colour set , boq64 bad sheet , boq65 soffa set cover , boq66 dinning table cover , boq67 vacume cleaner , boq68 aprin , boq69 tds meter , boq70 hair cap , boq71 microwave , boq72 phillips otg , boq73 toster , boq74 grill sandwich maker , boq75 hand grinder , boq76 steel bartan set , boq77 coffe maker , boq78 mixer and grider , boq79 juicer , boq80 all types seaser , boq81 water coler 20lit , boq82 aquagurd , boq83 computer for home sciencelab , boq84 modular kitchen total quantity : 118...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Directorate Of Health Services - Madhya Pradesh

33142079 supply of surgical material as per tender documents , alkaline phosphatase (alp) dea 300 ml(model ba 400 system (mfg bybio system)),consumable , alkaline phosphatase kit (kinetic) 10x2.2ml 44 test/kit consumable , anti abd grouping serum 3x10ml consumable , anti a sera igm(10 vial),consumable , anti b sera igm(10 vial),consumable , anti d sera igg+igm 10ml vial(each),consumable , anti d (polyvalent)(1x10 ml),consumable , anti h sera , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent(1x5 lit),consumable , bilirubin (direct) as 300 ml(model ba 400 system (mfg bybio system)),consumable , bilirubin (total) 600 ml(model ba 400 system (mfg bybio system)),consumable , bilirubin caoillary heparinised vitrex(one packet contain 100 capillary),consumable , bilirubin kit (colorimeter semi auto) 4x60 ml 480 test/kit consumable , bilirubin standard 1x5 ml(model ba 400 system (mfg bybio system)),consumable , blood agar powder(500 grm),consumable , blood bag 100ml , blood bag 350ml , blood gluose (god/pod) semi auto end point(1000 ml),consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal(10 ml vial (mfg tulip diagnostics)),consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal(10 ml vial (mfg tulip diagnostics)),consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail (eryclone anti d igm) , blood grouping anti sera d monoclonal(10 ml vial (mfg tulip diagnostics)),consumable , blood urea (bun) uv(1000 ml),consumable , blood urea reagent kit(200ml (2x100ml)),consumable , blood urea(arba),consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml(model ba 400 system (mfg bybio system)),consumable , cholesterol kit end point enzymatic kit 50 test/kit , cholesterol kit end point enzymatic kit 5x20ml 200 test/kit , conc hcl (1x500 ml = 500 ml),consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm(+/ 1.00mm),thikness 0.13.. to 0.17mm(pkt of 50 pieces),consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative) , crp test kit (latex/card) (25 test/kit) , crp test kit(latex/card),kit of 25 tests(mfg pathogyme diagnostics)(25 test / kit),consumable , dengu card antigen(25 card/pkt),consumable , dengue card test 100 test kit , developer powder (22.5 ltr) , diagnostic strips for urine sugar/albmin packing: 100 strip/pkt , dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)cotton gauze pieces 1 , digital x ray film 10x12 (150 films/pkt) , digital x ray film 11x14 (150 films/pkt) , digital x ray film 8x10 (150 films/pkt) , echo jelly 20ml bottle , echo jelly 250 ml(mfg by precious life care),bottle , edta k3 vial each , edta solutions k3 (500 ml) , edta solutions k3(mfg by himedia)(500 ml bottle),consumable , field stain a 500ml , field stain b 500ml , filter paper sheet((whatmann no 01) sheets),consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% (conc. formaline)(1 x 30 lit),consumable , crp latex slide per test , gel matrix group card , gel matrix cross match card , g6pd deficiency test kit (mfg pathogyme diagnostics)(10 test / kit),consumable , glacial acetic acid (2.5 liter),consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm,detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions(50 slides/packet),consumable , glass test tube 12 x 100 (medium size) heavy quality 100/pkt , glass test tube 12 x 75(small size) heavy quality 100/pkt , glass test tube 5 without edge , glucometer strip (1x100) , glucose kit (god/pod)(350ml),digonstic , h2so4 (sulphuric acid)(25% 500 ml bottle),consumable , hba ag elisa 96 kit 1x96(each),consumable , hba ag rapid card test(each),consumable , hbs antigeng kit card(pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab),digonstic , hcl n/10 (500 ml bottle) , hcv elisa(96 test kit),consumable , hcv kit card test(25 test / kit),digonstic , heamoglobin colour scale book with special strip complete(1 x 200),consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale (starter kit) components (1) color scale 01/kit (2) test strip 1000/kit (3) printed literature for method of use/kit (4)lancet 1000/kit , hiv elisa kit (hiv micro elisa ag+ab 4th generation )(96 test kit),consumable , hiv kit card (25 test / kit) , hydrogen peroxide (conc.) h2o2 (500 ml),consumable , k3 blood vaccutainer edta 100 tubes/pkt , leishman stain 500 ml , malaria antigen card pf/pv card (as per nvbdcp guidelines)( 10 card, 10 dropper, 1 buffer solution) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card (as per gio nvbdcp specification) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card (antigen) atleast 100 microbes/desi ltr. for both species , malaria pf/pv antigen card , malaria pf/pv rapid test , methyline blue(100 ml),solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips (2 200 ul) 1x1000(each),consumable , n/10 hcl 500ml , nebulization mask kit (pediatrics) , nebulization mask kit, mfg by life o line technologist(pediatrics),consumable , nebulization mask kit (adult) , new born baby kit [4 piece set] , pregnancy test card(10 card pack(mfg oscar medicare pvt ltd)),consumable , ra factor 50 test kit qualicative , ra factor rapid kit (25 test/kit) 1:) should be based on latex agglutination slide test. 2:) qualitative and semiquantitative testing facility possible. 3:) test speed must be less than 2 minutes , test tube 12 x 100 (medicm size) 100/pkt , test tube 12 x 75 (small size) 100/pkt(12 x 75 (small size) 100/pkt),tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000/pkt(2 to 100 micro litres 1000/pkt),each , tips for auto pipettes 200 to 1000 micro litres 500/pkt(200 to 1000 micro litres 500/pkt),each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll(each),consumable , tourniquet with belt (good quality pairs), pairs , tourniquet with belt (mfg by precious life care pvt ltd)(good quality pairs),consumable , typhoid card test kit (for igg and igm antibody detection) (25 test kit) , typhoid test card. , umbical cord clamps plastic material (box of 100 clamps)(mfg by precious life care),consumable , umbical cord clamps plastic material(box of 100 clamps),consumable , urine albumin & suger , usg gel(mfg precious life care pvt ltd)(250 ml bottle),consumable , usg thermal paper , vdrl (rpr) 1x100 sd strip , vdrl kit (strip) (mfg by alere)(50 test/kit),consumable , vdrl kit (strip)(50 test/kit),consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , adhesive plasters usp 7.5 cm x 10 mts/roll , adhesive plasters usp 7.5 cm x 5 mts/roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd/cpd solution (disposable sterilised) with needle(100 ml),bag , blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag , disposable appron , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g( ),needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7,1/2 inches consumable , disposable plastic appron (full size) , disposable pricking lancet (pkt of 200 units) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife(num),consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 6,1/2 inches consumable , disposable sterile gloves size 7 inches consumable , disposable sterile gloves size 7,1/2 inches consumable , disposable sterile hypodermic syringe 10ml(each),consumable , disposable suction catheter assorted covering all sizes 10,12,14,16,18 consumable , disposable suction catheter(size 12),consumable , disposable suction catheter(size 14),consumable , disposable surgeon cap(box of 100 caps) , disposable syringe (for vitamin k inj)(1ml with needle 26g),consumable , disposable syringe with needle(2ml each),syrings , disposable syringe with needle(3ml each),syrings , disposable syringe with needle(5ml each),needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask(as per attached specification),consumable , oxygen mask adult (standard size) , oxygen mask paediatric (standard size) , plain disposable vial 3ml(each),consumable , scalp vein set(size 24g, disposable),consumable , three layer surgical mask , urine container 5ml disposable (50 per pkt) , urine container size of the container shall be 30ml disposable (50 per pkt),consumable , x ray film 10 x 12 50 sheets/pack , x ray film 12 x 12 50 sheets/pack , x ray film 12 x 15 50 sheets/pack , b.b silk (12 foils/pkt)(3/8 rcut needle 45 mm length 76 cm, size 2/0)),consumable , b.b silk size 3/0 (12 foils/pkt)(3/8cir rcut needle 26mm length 76 cm),needle , b.b silk with 1/2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0,(12foils/pkt),needle , b.b silk with 1/2 cir rb needle size:1/0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1/0(6 reels is per box rate should be quoted for 6 reels),surgical material , black braided silk with 1/2 cir cd cutting needle 16 mm length 75 cm 3/0 (14 foils/pkt) , black braided silk with 1/2 cir cutting needle 30mm length 75 cm(1/0 12 foils/pkt),consumable , black braided silk with 1/2 cir rb needle 20 mm length 75 cm 1/0 13 foils/pkt , black braided silk with 1/2 cir rb needle 30 mm length 75 cm 2/0 12 foils/pkt , catgut chromic size:2/0 length 150 cm , catgut chromic with 1/2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 2 consumable(each),consumable , chromic catgut (12 foils/pkt)(size:1/0 length 150 cm),consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1/4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils/pkt , chromic catgut suture (12 foils/pkt)(3/8 cir r cutting needle 19 mm needle, suture length 76 cm size 4/0),needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3/8 circle reverse cutting micro point(38 cm),consumable , non absorbable braided silk black(12 mm 3/8 circle reverse cutting micropoint 38 cm ),consumable , silk no 1 cutting needle 1x12(1x12),consumable , suture mersilk 8 0 (12 foil) , silver nitrate solution 1 ltr. , urine bag 2 ltr. , plaster of paris 410x5mtr , plaster of paris 6 15x 5mtr , cumb sera , albumin , laryngo scope bulb , auto clave quil , idetification tag , peadiatric drip set , dresing pad , endotracheal tube no. 6 , endotracheal tube no. 2.5 to 5 ml. , dynaplast 10 cm. , sicklewive test kit , autoclave indicator , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms(each),consumable , cotton crape bandage 10cm x 4m (box of 10 bandages) , cotton crape bandage 15cm x 4m (box of 10 bandages) , cotton delivery belt , adhesive tape 7.5cm x10(mtr/roll),consumable , cloth based surgical adhesive tape roll(1 inch x 5 mtr / roll),consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll (10 roll/pkt)(3 inch x 5 m / roll (10 roll/pkt)),consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m /roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m /roll , umblical cotton tape length 75cm. , disposable suction catheter(size 12),consumable , disposable suction catheter(size 14),consumable , feeding tube (catheter) 10g , foleys catheter size 12 2 way(10 each),consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way(11 each),consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way(12 each),consumable , foleys catheter size 22 2 way(13 each),consumable , foleys catheter size 24 2 way(14 each),consumable , foleys urinary catheter 2 way size 8 , infant feeding tube (catheter) size: 3g , infant feeding tube (catheter) size: 4g , infant feeding tube (catheter) size: 5g , infant feeding tube (catheter) size: 6g , surgical blade isi marked, size 15(100 per packet),surgical material , surgical blade isi marked, size 22(100/pkt),surgical material , surgical blade isi marked, size 23(100/pkt),surgical material , surgical blade isi marked, size 24(100/pkt),surgical material , surgical blade isi marked, size 25(100/pkt),surgical material , surgical blade, size 11 , ecg jelly 250 gms , ecg paper (chemical coated)(80mmx 20 mtr each),consumable , ecg paper computerizesd triple channel 20m , ecg paper(chemical coated) 50mm x 20mm roll , ecg paper(chemical coated) 50mm x 30 mtr. roll , ecg paper(wax coated) heavy quality 50mm x 30 mtr/ roll , ecg paper(wax coated) mfg by life o line technologist(50mm x 30 mtr, roll),consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist(50 mm x 20 mtr),consumable , absorable surgical suture rb needle size no 1 0,30 mm length 70 cm , 12 foils per packet , polyglycolic acid (pga) , absorable surgical suture rb needle size no 1 ,30 mm length 70 cm , 12 foils per packet , polyglycolic acid (pga) , absorbable surgical suture braided polyglycolic acid 3/8 circle reverse cuttingg(12mm 45 cm spatulated needle),consumable , blood vessel introducers needles 16g, sterilized, set , chromic (12 foils/pkt)(3/8 rb needle 30 mm, length 76 cm, size 2/0),needle , chromic size 1, (12 foils/pkt)(1/2 cir rb needle 40 mm, length 76 cm),needle , chromic size 1, 12 foils/pkt(1/2 cir rb needle 45 mm, length 100 cm),needle , insulin syringe/ each (graduation upto 100 units) 30 g needle, 40 units/ml(30 g needle, 40 units/ml),syrings , intravenous set with airway and needle((adult)),surgical material , intravenous set with airway and needle(children),surgical material , spinal needle no. 23 , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle(5 ml),syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd(20 ml),consumable , vicryl no. 1 rb , vicryl no. 2.0 rb , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula (two way) size 20 , iv cannula (two way) size 22 , iv cannula (two way) size 24 , iv cannula size 26g( ),consumable , biomedical waste collection plastic bag small(all colours) , biomedical waste collection plastic bag medium(all colours) , biomedical waste collection plastic bag large(all colours) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress (male) , bed sheet single bed(white) , bedsheet double bed(white) , bed sheet single bed(coloured) , bedsheet double bed(coloured) , baby diapers small (10 diaper per pkt) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat/lab tec /xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane(each) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size(white) , napkin sup. quality std size(coloured) , peticote blauge cloth shuti rangeen , peticote/blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen (small) , table cloth rangeen (large) , biomedical waste collection plastic dustbin small(all colours) , biomedical waste collection plastic dustbin medium(all colours) , biomedical waste collection plastic dustbin large(all colours)...

Madhya Pradesh Public Health Services Corporation Limited - Madhya Pradesh

33111294 t 338/ mpphscl/ general surgical consumables and kits /rc/2022 online rate contract tender for supply of general surgical consumables and kits to various hospitals of government of madhya pradesh for a period of 18 months , general surgical consumables and kits , cold sterilant solution (5 ltr can) , synthetic, monofilament, nonabsorbable polyprolene mesh (7.5 x 15 cm) , barium sulphate,hd 300 grm, , basic fuchsin chemical name:pararosaniline hydrochloride,chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green(25 gms glass bottle),consumable , bone cement, 40 g pack , capillary tube, 100 pieces , cassette 10 x 12 , cassette 12 x 15 , cassette,6.5 x 8.5 , cassette,8 x 10 , coated polyster with 1/2 cirgreen needle 17 mm (curved reverse cutting or curved round body or taper cut) size:2/0 length 90cm , collagen sheets 10 x 10 cm sheet , corrugated drainage sheet, sterile, multichannel, single use(2 inch x 6 inch (pvc) piece),consumable , cryo pen permanent marker, fine tip, alcohol resistant and water resistant, for labelling cryovials. , cvp line complete set , dead body bag (*as per attached specification) , dental x ray film size 31 x 41 mm (150 films / pkt) rate should be quoted for packet of 150 , disposable hypodermic, needle for opthalmic use no 2, 1 , disposable needles is 10654:2002 26 g (1 1/2 inch) , disposable needles is 10654:2002 26 g (1 inch) , disposable syringe with needle 10ml , disposable syringe with needle 20ml syringes , disposable syringe with needle(1ml each),syrings , disposable syringe with needle(2ml each),syrings , disposable syringe with needle(3ml each),syrings , dj stent for ureter,8 fr , epidural set 18 n0. , epidural set 20 n0. , fixer powder ( fixer with hardner),( 22.5 ltr/pkt) , fogger solution 5 lit cane containing of hydrogen peroxide i.p 11.0% w/v and silver nitrate dilute 0.01% w/v , formaldehyde 40% (conc. formalin) (1 x 30 lit), consumable , glacial acetic acid (liquid) 100 ml bottles , glutaraldehyde solution 2% in 5liter can (2 strips/vials per each can) (5 liter can), consumable , guide wire 3mm , hepatitis b core (hbc) igm antibody (elisa) (*as per attached specification) , hi speed cassette screen,10 x 12/each , hi speed cassette screen,12 x 15/each , hi speed cassette screen,6.5 x 8.5/each , hi speed cassette screen,8 x 10/each , icd bag 1000 ml , infant feeding tube (catheter) size: 3g , infant feeding tube size: 5g , insulin syringe {auto disabled (ad)/reuse prevantion (rup) syringe} with 31g needle (single unit pack) is marked, 40 iu(each),consumable , insulin syringe {auto disabled (ad)/reuse prevantion (rup) syringe}/ each (graduation upto 100 units) 30g needle, 40 units/ml (30 g needle, 40units/ml) syringe(each),consumable , insulin syringe with 31g needle (single unit pack) is marked, 100iu, {auto disabled (ad)/re use prevantion (rup) syringe(each),consumable , intra oral dental x ray film, size 0,1,2,3, 4 150 films in one packet each size , iohexol injection 350 mg iodine/ml(20 ml vail) , latex based baloon capacity (3 ml) foleys catheter(3 way, size 12),consumable , latex based baloon capacity (30 50ml) foleys catheter(size 14 3 way),consumable , lead letter 0 9 sets, (100 clips/pkt) , lead letter a to z set , lugol iodine 100 ml bottles , lugols iodine (5% solution) (potassium iodine 10% w/v and iodine 5% w/v , mantoux reagent (purified protein derivative), 10 tu vial , mantoux reagent (purified protein derivative), 5 tu vial , mentoux reagent 2 tuberculin unit (tu) strength(5ml vial)1 vial of tuberculin ppd contains 5ml reagent , n/10 hcl 100 ml , nasal prong(each),consumable (neonatal size 00) , paediatric epidural set(19g needle, metal stylet,22g catheter,0.22micron epidural catheter lor syringe) , pd catheter swan neck double cuff with catheter kit size 41cm to 47c.m. , pd catheter swan neck with curl with double cuff size 62.5 cm , polyamide mono filament (nylon) with 1/2 cir cut needle 20/16 mm length 70 cm size 2/0(12 foils/pkt),consumable , polypropylene size 2/0 (12 foils/pkt)(1/2 cir rb needle 25mm, length 45 cm),needle , quincke pediatric spinal needles, g 25, length 2.0 inch , reuse prevention syringe sterile single use reuse prevention syringe with fixed needle scompliance to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized.(10 ml) , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles compliance to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(2ml),syrings , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles compliance to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(3ml),syrings , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles complianceto iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(5ml),syrings , rnase/ dnase away solution, for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature) , silk suture for eye spatulated micropoint reverse cutting needle, double armed suture 12 foils/pkt 9 0 , silk suture spatulated micropoint reverse cutting needle, double armed suture 12 foils/pkt 10 0 , spinal (l.p.) needle disposable 24 g with syringe , spinal needle 26 g(each) needle with syringe , spinal needle with metal stylet,(g 23),needle , spinal needle(g 22 l 120 mm),consumable , sterile disposable urine container 20ml , suction tube, silicone, int. diam. 8 mm, length minimum 2 m , sulphuric acid(500ml glass bottle),consumable , suture needles curved 1/2 circle round body assorted size 11 15 6 nos. /pkt. , suture needles curved 1/2 circle round body assorted size 16 20 6 nos. /pkt. , suture needles curved 1/2 circle round body assorted size 6 10 6 nos. /pkt. , suture needles curved 1/2 circle round body assorted,size 1 5 6 nos. /pkt. , suture needles curved and cutting 1/2 circle cutting,size 6 10 6 nos. /pkt. , suture needles curved and cutting 1/2 circle,size 11 15 6 nos. /pkt. , suture needles curved and cutting 1/2 circle,size 16 20 6 nos. /pkt. , suture needles curved and cutting,size 1 5 6 nos. /pkt. , sutures 10 0 silk,12 foils/pkt , troponin 1 kit(10 test per pack),consumable...

Ministry Of Defence - Madhya Pradesh

32705555 bids are invited for glacial acetic acid (q3) , formaldehyde solution as per is: 3321 (q3) , methanol lr grade (q3) , perchloric acid (q3) total quantity : 7...

Directorate Of Health Services - Madhya Pradesh

32422152 surgical materials suplly of surgical materials , alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable , anti abd grouping serum 3x10ml consumable , anti a sera igm ( 10 vial ) , consumable , anti b sera igm ( 10 vial ) , consumable , anti d sera igg+igm 10ml vial ( each ) , consumable , anti d ( polyvalent ) ( 1x10 ml ) , consumable , anti h sera , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent ( 1x5 lit ) , consumable , bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable , bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , blood agar powder ( 500 grm ) , consumable , blood bag 100ml , blood bag 350ml , blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) , blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood urea ( bun ) uv ( 1000 ml ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea ( arba ) , consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , cholesterol kit end point enzymatic kit 50 test / kit , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit , conc hcl ( 1x500 ml = 500 ml ) , consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative ) , crp test kit ( latex / card ) ( 25 test / kit ) , crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable , dengu card antigen ( 25 card / pkt ) , consumable , dengue card test 100 test kit , developer powder ( 22.5 ltr ) , diagnostic strips for urine sugar / albmin packing: 100 strip / pkt , dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 , digital x ray film 10x12 ( 150 films / pkt ) , digital x ray film 11x14 ( 150 films / pkt ) , digital x ray film 8x10 ( 150 films / pkt ) , echo jelly 20ml bottle , echo jelly 250 ml ( mfg by precious life care ) , bottle , edta k3 vial each , edta solutions k3 ( 500 ml ) , edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable , field stain a 500ml , field stain b 500ml , filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable , crp latex slide per test , gel matrix group card , gel matrix cross match card , g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable , glacial acetic acid ( 2.5 liter ) , consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable , glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt , glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt , glass test tube 5 without edge , glucometer strip ( 1x100 ) , glucose kit ( god / pod ) ( 350ml ) , digonstic , h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable , hba ag elisa 96 kit 1x96 ( each ) , consumable , hba ag rapid card test ( each ) , consumable , hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic , hcl n / 10 ( 500 ml bottle ) , hcv elisa ( 96 test kit ) , consumable , hcv kit card test ( 25 test / kit ) , digonstic , heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit , hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable , hiv kit card ( 25 test / kit ) , hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable , k3 blood vaccutainer edta 100 tubes / pkt , leishman stain 500 ml , malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species , malaria pf / pv antigen card , malaria pf / pv rapid test , methyline blue ( 100 ml ) , solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips ( 2 200 ul ) 1x1000 ( each ) , consumable , n / 10 hcl 500ml , nebulization mask kit ( pediatrics ) , nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable , nebulization mask kit ( adult ) , new born baby kit [ 4 piece set ] , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable , ra factor 50 test kit qualicative , ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes , test tube 12 x 100 ( medicm size ) 100 / pkt , test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each , tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll ( each ) , consumable , tourniquet with belt ( good quality pairs ) , pairs , tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable , typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) , typhoid test card. , umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable , umbical cord clamps plastic material ( box of 100 clamps ) , consumable , urine albumin & suger , usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable , usg thermal paper , vdrl ( rpr ) 1x100 sd strip , vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable , vdrl kit ( strip ) ( 50 test / kit ) , consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , adhesive plasters usp 7.5 cm x 10 mts / roll , adhesive plasters usp 7.5 cm x 5 mts / roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , disposable appron , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g ( ) , needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7, 1 / 2 inches consumable , disposable plastic appron ( full size ) , disposable pricking lancet ( pkt of 200 units ) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife ( num ) , consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 6, 1 / 2 inches consumable , disposable sterile gloves size 7 inches consumable , disposable sterile gloves size 7, 1 / 2 inches consumable , disposable sterile hypodermic syringe 10ml ( each ) , consumable , disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , disposable surgeon cap ( box of 100 caps ) , disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable , disposable syringe with needle ( 2ml each ) , syrings , disposable syringe with needle ( 3ml each ) , syrings , disposable syringe with needle ( 5ml each ) , needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask ( as per attached specification ) , consumable , oxygen mask adult ( standard size ) , oxygen mask paediatric ( standard size ) , plain disposable vial 3ml ( each ) , consumable , scalp vein set ( size 24g, disposable ) , consumable , three layer surgical mask , urine container 5ml disposable ( 50 per pkt ) , urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable , x ray film 10 x 12 50 sheets / pack , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack , b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable , b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle , b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material , black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt , black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt , catgut chromic size:2 / 0 length 150 cm , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable , chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt , chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable , non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable , silk no 1 cutting needle 1x12 ( 1x12 ) , consumable , suture mersilk 8 0 ( 12 foil ) , silver nitrate solution 1 ltr. , urine bag 2 ltr. , plaster of paris 410x5mtr , plaster of paris 6 15x 5mtr , cumb sera , albumin , laryngo scope bulb , auto clave quil , idetification tag , peadiatric drip set , dresing pad , endotracheal tube no. 6 , endotracheal tube no. 2.5 to 5 ml. , dynaplast 10 cm. , sicklewive test kit , autoclave indicator , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms ( each ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) , cotton crape bandage 15cm x 4m ( box of 10 bandages ) , cotton delivery belt , adhesive tape 7.5cm x10 ( mtr / roll ) , consumable , cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m / roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m / roll , umblical cotton tape length 75cm. , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , feeding tube ( catheter ) 10g , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys catheter size 22 2 way ( 13 each ) , consumable , foleys catheter size 24 2 way ( 14 each ) , consumable , foleys urinary catheter 2 way size 8 , infant feeding tube ( catheter ) size: 3g , infant feeding tube ( catheter ) size: 4g , infant feeding tube ( catheter ) size: 5g , infant feeding tube ( catheter ) size: 6g , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 25 ( 100 / pkt ) , surgical material , surgical blade, size 11 , ecg jelly 250 gms , ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable , ecg paper computerizesd triple channel 20m , ecg paper ( chemical coated ) 50mm x 20mm roll , ecg paper ( chemical coated ) 50mm x 30 mtr. roll , ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll , ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable , absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorable surgical suture rb needle size no 1 , 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable , blood vessel introducers needles 16g, sterilized, set , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle , insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( children ) , surgical material , spinal needle no. 23 , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle ( 5 ml ) , syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable , vicryl no. 1 rb , vicryl no. 2.0 rb , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula size 26g ( ) , consumable , biomedical waste collection plastic bag small ( all colours ) , biomedical waste collection plastic bag medium ( all colours ) , biomedical waste collection plastic bag large ( all colours ) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress ( male ) , bed sheet single bed ( white ) , bedsheet double bed ( white ) , bed sheet single bed ( coloured ) , bedsheet double bed ( coloured ) , baby diapers small ( 10 diaper per pkt ) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat / lab tec / xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane ( each ) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size ( white ) , napkin sup. quality std size ( coloured ) , peticote blauge cloth shuti rangeen , peticote / blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen ( small ) , table cloth rangeen ( large ) , biomedical waste collection plastic dustbin small ( all colours ) , biomedical waste collection plastic dustbin medium ( all colours ) , biomedical waste collection plastic dustbin large ( all colours ) ...

Directorate Of Health Services - Madhya Pradesh

32077142 supply of material suture surgical and other consumables in district hospital datia 1 material suture surgical and other consumables 2 absorbant cotton woll 500gm. 3 absorbant cotton woll 100gm. 4 adhesive paper tape 4x 9 mtr. 5 adhesive plaster 7.5 x 5 mtr 6 adhesive plaster 10 x 5 mtr 7 adhesive plaster 1 roll 8 adhesive plaster 1 / 2 roll 9 blood administration set 10 b.b. silk 6 reels x 25 mts length 25 mts. size 1 / 0 11 catgut chromic legth 150 cm size 1 / 0 12 catgut chromic legth 150 cm size 1 13 catgut chromic legth 150 cm size 2 / 0 14 catgut plan legth 150 cm size 1 / 0 15 catgut plan legth 150 cm size 2 / 0 16 catgut plan legth 150 cm size 3 / 0 17 catgut plan legth 150 cm size 4 / 0 18 cup goggle ( kala chasma ) 19 disposable surgical cap 20 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 21 disposable needle 23 g 22 disposable needle 24 g 23 disposable needle 24x1 / 2 g 24 disposable needle 26 g 25 disposable needle 26x1 / 2 g 26 disposable needle 27 g 27 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair [ 700163 ] 28 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6.5 inch / pair [ 700163 ] 29 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 7 inch / pair [ 700163 ] 30 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 7.5 inch / pair [ 700163 ] 31 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair [ 700163 ] 32 disposable suction cathetor assorted covering all size 33 disposable syringe with needle 50 cc 34 disposable syringe with needle 20 cc 35 disposable syringe with needle 10 cc 36 disposable syringe is with needle isi 5 cc 37 disposable syringe is with needle isi 3 cc 38 disposable syringe is with needle isi 2 cc 39 eye drape disposable ( eye towel ) towel size 70x70cmadhesivearea 08x08cm 40 endotracheal tube size internal diameter 2.5 41 endotracheal tube size internal diameter 3 42 endotracheal tube size internal diameter 3.5 43 endotracheal tube size internal diameter 5 44 endotracheal tube size internal diameter 5.5 45 endotracheal tube size internal diameter 7 46 endotracheal tube size internal diameter 7.5 47 endotracheal tube size internal diameter 8 48 endotracheal tube size internal diameter 6 49 endotracheal tube size internal diameter 6.5 50 foldable iol sterile lens +16 25 d 51 folly, s urinary catheter three way size 16 52 folly, s urinary catheter three way size 18 53 folly, s urinary catheter three way size 20 54 folly, s urinary catheter two way size 16 55 folly, s urinary catheter two way size 18 56 haemoglobin colour scale ( starter kit ) componantss 1. colour scale 1, 2. test strip 1000 / kit, 3 printed literature for method of use / kit, 4. lancent 1000 / kit 57 haemoglobin colour scale strip 1000 strip / pack 58 hot water bag 59 hernia mesh 3 60 hernia mesh 4 61 hernia mesh 6 62 hernia mesh 12 63 id wrist band ( mother & child ) 64 infant feeding tube ( catheter ) 5 g 65 infant feeding tube ( catheter ) 6 g 66 infant feeding tube ( catheter ) 7 g 67 infant feeding tube ( catheter ) 8 g 68 infant feeding tube ( catheter ) 10 g 69 infant mucus extractor pvc 70 infusion ( syringe ) pump conector 71 intravenous set ( adult ) with airway and needle 72 intravenous set ( children ) with airway and needle 73 iv cannula size 18g with inj. valve ( port ) 74 iv cannula size 20g with inj. valve ( port ) 75 iv cannula size 22g with inj. valve ( port ) 76 iv cannula size 24g with inj. valve ( port ) 77 iv cannula size 26g with inj. valve ( port ) 78 mackintosh double colour water proof rubber isi marked 79 micro volume drip set 80 n 95 mask 81 needle hypodermic 0 size 24gx11 1 / 2 82 needle hypodermic 0 size 26gx11 1 / 2 83 non foldable iol sterile lens pc + all size 84 one needle vicril size 01 85 one needle vicril size 02 86 one needle vicril size 1 0 87 one needle vicril size 2 0 88 one needle vicril size 1 89 one needle vicril size 3 0 90 one needle vicril size 4 0 91 rolled bandage 15cm x 5mtr 92 ryles tube ( pvc ) 10 x12 93 ryles tube ( pvc ) 16 x18 94 sugical blade, size 11 95 sugical blade, size 15 96 sugical blade, size 23 97 suture mersilk 8 0 98 suture needles curved and cutting size 1 5 99 suture needles curved and cutting size 6 10 100 suture needles curved and cutting size 11 15 101 suture needles curved and cutting size 16 20 102 suture needles curved1 / 2 circleroundbody assortedsize 1 5 103 suture needles curved1 / 2 circleroundbody assortedsize 11 15 104 suture needles curved1 / 2 circleroundbody assortedsize 16 20 105 disposable three layer surgical mask 106 umblical cord clamp 107 umblical cotton tape length 75 cm 108 urinary drainage bag cap with non return valve ( eo sterile ) , mfg by life o line technologist ( 2 litre ) , consumable [ 700876 ] 109 sics blades cresent knives 110 sics bladess keratome 3.2 knives 111 sics blades 15 degreelance tip knives 112 polythene size 8x10 55 micron ( red / blak ) for immunisation 113 polythene size 7x5 with zip for immunisation 114 buds for eye surgery 50pcs. 115 phaco drape for eye surgery all size 116 autoclavable phaco tubings for abbott soveneir compact machine 117 mvr blades for phaco surgery 118 hand wash sanitizer 100 ml ( antiseptic ) 119 artery forceps mosquitocurved 120 artery forceps mosquito straight 121 artery forceps spencer coachercurveds.s. 122 artery forceps spencer coacherstraights.s. 123 artery forceps spencer well size 12.5cm curved 124 artery forceps spencer well size 12.5cm straight 125 artery forceps spencer well size 15 cm curved 126 artery forceps spencer well size 15 cm straight 127 artery forceps spencer well size 17.5 cm straight 128 autoclave drum 6 x 4 129 drum for autoclave6x6 130 drum for autoclave9 x 5 131 drum for autoclave11 x 5 132 drum for autoclave11 x 9 133 drum for autoclave14 x 9 134 heater for autoclave. 135 strips for autoclave sterlity testing 136 plug and socket. for autoclave. 137 pressure gauge, with colour code. for autoclave. 138 pressure release valve. for autoclave. 139 steam release valve. for autoclave. 140 silicone rubber sralgasket for autoclave 141 baby tray ss 142 basket typeforegin body remover 143 bed pan female with cover s.s. superior quality size standard 144 bed pan male with cover s.s. superior quality size standard 145 biopsy forceps endoscopiyupper urinary tract ( 829 07 ) wolf 146 biopsy forceps endoscopylower urinary tract ( 8952 65 ) wolf 147 bipolar forceps connecting cableof wolf 148 bipolar scissors mayo 149 blood presure instrument digital ( iso / ce ) 150 stethoscope adult 151 stethoscope paediatrics 152 bronchoscopybiopsy forcep 153 chietels forcep 160 mm 154 dormia basket 155 dressing forceps plain s.s. size 12.5cm 156 dressing forceps plain s.s. size 15 cm 157 dressing scissor straight s.s. superiorquality size 12.5 cm 158 dressing scissor straight s.s. superiorquality size 15 cm 159 dressing scissor straight s.s. superiorquality size 17 cm 160 dressing scissor straight s.s. superiorquality size 20 cm 161 dressing drum ( s.s. ) 11x 9 162 dressing drum ( s.s. ) 12x 10 163 dressing drum ( s.s. ) 12x 15 164 dustwin made of birgin plastic with lid 50 ltr all colours as pe specific for biomedical waste 165 dustwin made of birgin plastic with lid 20 ltr all colours as pe specific for biomedical waste 166 dustwin made of birgin plastic with lid 10 ltr all colours as pe specific for biomedical waste 167 polethene for biomedical waste management ( as per rules pollution control boad ) ( any size ) 168 endoscopic rotating multiple clip applier 169 forcep plan 160 mm 170 forcep spring type dressing 160 mm 171 instrument tray with cover s.s. superior quality size 10 x 8 172 instrument tray with cover s.s. superior quality size 10 x 12 173 instrument tray with cover s.s. superior quality size 12 x 15 174 kidney tray s.s. superior quality size 6 175 kidney tray s.s. superior quality size 8 176 kidney tray s.s. superior quality size 10 177 nebuliser kit 178 needle holder 12 179 oxygen cylinder key 180 oxygen flowmetwr with bpc 181 sponge tissue forceps size 15 cm 182 sponge holding forcep ( s.s. ) 15 cm 183 sponge holding forcep ( s.s. ) 20 cm 184 scissor cord cutting curved on flat 160 mm ( s.s. ) 185 scissor surgical straight 140 mm ( s.s. ) 186 stitch scissor s.s. superior quality 187 urine pot male s.s. superior quality size standard 188 urine pot fe male s.s. superior quality size standard 189 suture cutting scissors 190 midwifery with forceps 191 uterine curetts sharp&blunt 192 obstetrical forceps 193 uterine sound sims 194 vaginal speculum sims 195 vaginal speculum cusco 196 uterine depresores sims 197 hand sanitizer 100 ml ( antiseptic ) 198 hand wash solution 500 ml 199 weight machine adult mannual isi / ce certified 200 weight machine adult digital isi / ce certified 201 weight machine child mannual isi / ce certified 202 weight machine child digital isi / ce certified 203 b.p. apparatus with age appropriate calf size ( as per specification rbsk programe ) 204 weghing scale ( mechanical newborn weighing scale ( as per specification rbsk programe ) 205 hight measuring tap ( bangle type ) ( as per specification rbsk programe ) 206 infantometer ( as per specification rbsk programe ) 207 standiometer ( as per specification rbsk programe ) 208 stethoscope ( paediatrics ) ( as per specification rbsk programe ) 209 red ring plastic for child ( as per specification rbsk programe ) 210 plastic box ( 18 inch x 8 inch x 8 inch ) ( as per specification rbsk programe ) 211 vision chart, referance chart ( as per specification rbsk programe ) 212 torch ( small withpencill cell ) ( as per specification rbsk programe ) 213 small bottle with raisins size 450 ml ( as per specification rbsk programe ) 214 colour wool 100 gm ( as per specification rbsk programe ) 215 digital bp instrument branded is / ce crtified 216 digital thermameter ( as per specification for hbnc kit ) 217 digital wrist watch ( as per specification for hbnc kit ) 218 spring weighing scale capacity 5 kg weight ( as per specification for hbnc kit ) 219 spoon for baby feeding ss 5 ml ( as per specification for hbnc kit ) 220 warm bag for newborn ( as per specification for hbnc kit ) 221 bag for home visit ( as per specification for hbnc kit ) 222 peledi ( as per specification for hbnc kit ) 223 baby blanket ( as per specification for hbnc kit ) 224 alkaline phosphatase kinetic 5x10ml semauto 225 bilirubin kit ( semi auto ) 4x60ml 480 test / kit end point 226 blood sugar kit ( god / pod ) 1 ltr 2x200 ml semi auto endpoint 227 blood sugar kit ( god / pod ) 1 ltr 10x100 ml semi auto endpoint 228 blood urea gldh kinetic kit liquid stable 5x10 ml semi auto 229 cholesterol kit end point enzymatic kit 5x20ml semi auto 230 creatininefor semi auto kinetic 4x60ml / 480test / kit 231 liquidstable calcium ocpc auto mono vial 232 liquid stable sgpt semi auto 5x10 mlend point 233 liquid stable sgot semi auto 5x10 ml end point 234 liquid stable serum albumine semi auto 4x50 ml 235 liquid stable serum amylase mono vial semi auto 236 serum total protin kit semi auto end point 237 uric acid kit semi auto 4x50 ml end point 238 liquid stable direct ldl cholesterol 3x10ml semi auto 239 serum creteninkinetic semi auoto 2x50ml 240 serum triglycerid liquid stable anz end point 5x10ml semi auto 241 hbsag kit card 25 card / kit 242 chikunguniya card test kit lgg+lgm 243 dengue card test 10 test 10 test kit lgg + lgm 244 hcv kit test card test 245 hiv kit card 246 hiv test card tridot flow through based 2 dot 247 ra factor kit lates / card 248 crp test kit ( latex?card ) 249 typhaid rapid card igg=igm s / s above 99% 250 malaria card antigen igg+igm pf / pv 251 malaria card antibody igg+igm pf / pv 252 vdrl ( syphlish ) test card 253 urine pregnancy test card 254 strip for albumin urine and suger 100 strip / bottle 255 urin strip multipara 256 urine strip for ketone 100 strip / bottle 257 blood grouping anti sera a monoclonal 258 blood grouping anti sera b monoclonal 259 blood grouping anti sera d monoclonal 260 widal test kit slide test 261 rbcdiluting fluid 500 ml 262 wbc diluting fluid 500ml 263 edta solutions 500ml 264 h2so4 acid 20% 500 ml 265 h2so4 acid ( concentrated ) 266 hcl n / 10 500 ml 267 g6 pd deficiency test kit 268 acetone detection kit 269 absorbable gelatine sponge ip 66 80mm x 50mm x 10mm 270 barium choliride 10% 271 bile pigment kit 25ml 272 cyanemeth solution fot hb 5 litre 273 distill water 5 ltr. for pathology use 274 emersion oil 275 field stain a 276 field stain b 277 fouchets reagent 278 french chalk powder, 400 gm packet 279 geatian violet ( gram stain ) 100 ml 280 gram iodine ( gram stain ) 125ml 281 haemoglobin colour scale with paper 282 hypochioride solution 4% 283 leishman stain 500 ml 284 lence cleaning solution 285 liquid soap 500 ml 286 liquid stable biochemistry callibrator 6x3 ml 287 lithium electrodes each 288 m.t.test 5tu, 10 tu 5 ml 289 mantoux ppd test 1 tu 290 mantoux ppd test 2 tu 291 mantoux ppd test 5 tu 292 methyl blue for ( z n ) 125ml 293 p.h.paper 294 platelett diluting fluid 100 ml 295 potassium kit 296 sidar wood oil 25 ml 297 seman diluting fluid 100 ml 298 seman analysis fluid 299 sodium citrate 3.8% 500ml 300 sodium nitreprosied 500 gram 301 sodium hypochloride concentrat 4% 302 autopipette stand plastic 303 autopipette multiple dispenser 304 beaker 1 lit. plastic 305 beaker 100 ml plastic 306 beaker 2 lit. plastic 307 beaker 250 ml plastic 308 beaker 500 ml plastic 309 beaker 1 lit. glass 310 beaker 100 ml glass 311 beaker 2 lit. glass 312 beaker 250 ml glass 313 beaker 500 ml glass 314 bilirubin cappilary heprinised vitrex 315 bottle brown glass 250ml 316 blood bag 100 ml 317 blood bag 350 ml 318 chloride electrode each 319 flask brown glass 250 ml 320 flask brown glass 1000 ml 321 burrete 25cc 322 burrete stop cok 323 broom stick 8 324 bunsan burner each 325 capiliary tube ( ctbt ) 326 conicalflask 500 ml 327 cover slip squre 22*40mm 328 cover slip squre 22*50mm 329 dreyers tube ( for widal test ) 330 dropping bottle 125cc plastic 331 dropping bottle 250cc plastic 332 disposable dropper 5 ml 333 disposable dropper 500 ml 334 esr tube ( wintrobe tube ) 335 esr tube stand ( wintrobe ) 336 falcon tube 50ml sterilized 337 felix tube ( for widal test 338 filter papers; qualitative 18.5 cm dia; pore size, 20 25 μ; 339 filter paper 8 x 10 rectangular sheet 340 glass funnel 3 341 glass funnel 6 342 glass petridish 3 inch 343 glass petridish 4 inch 344 glass rod for staining 345 glass slide 75*25 mm 346 hemoglobin pipette 347 hemoglobin tube 348 hemoglobin tube ( round ) 349 litmus paper blue / red pack each 350 measuring cylinder 100ml glass 351 measuring cylinder 250ml glass 352 measuring cylinder 500ml glass 353 measuring cylinder 50ml glass 354 micro centrifuge tube 355 pasteur pippet glass 356 pilot tube blood bank 100 piece 357 pipette graduated 01ml 358 pipette graduated 02ml 359 pipette graduated 05ml 360 pipette graduated 10ml 361 pricking needle blood lancet 362 reagent bottle 250cc plastic 363 reagent bottle 500cc plastic 364 ria vial with screw cap, size: 12x75mm, polypropylene. 365 serum test tube stand 366 serum tube 367 test tube 12*100mm. 368 test tube 15*125 369 test tube 15*150mm 370 test tube holder 371 test tube stant for 12 hole plastic 372 test tube stant for 18 hole plastic 373 test tube brush small 374 test tube brush big 375 wash bottle 100 ml plastic 376 wash bottle 50 ml plastic 377 drying rach for slide ( for 50 100 slide ) 378 thermacol box ( od18.5x12.5x13 cm / id 379 permanet marker ( blue, black, red ) 380 smear transporting box plastic 381 smear transporting box wooden 382 neubar chamber 383 glass slide staining rack 384 test tube stand plactic 18 to 24 hole 385 urine container with safety lock 40 ml sterile 386 slide holder metal 387 basin enamal 40 cm diameter 388 bowl enamal 20 cm diameter 389 glass jar narrow mouth with rubber stoper 30 ltr 390 steaker adhesiv label 391 tranparent aprin 392 biohazar label 3x2 393 calory meter reading tube 394 cover slip 18x18mm 10 gm 395 cover slip 22x22 mm 10gm 396 filter paper large sheet 397 edta vail with safety cap 398 glass beekar 100 ml 399 glass marking white each 400 glass micro slide 401 glass test tube 3 without edge 402 glass test tube 3 with edge 403 glass test tube 4 with edge 404 glass test tube with edge 405 glass test tube 5 with edge 406 glass test tube 6 without edge 407 glass test tube 6 with edge 408 hb pippet ( superior ) gdrjarman 409 hb reading tube 410 laboratory dropper 1 ml 411 laboratory dropper 3 ml 412 micro glass coverslim 1x20 pack 413 micropore 1.5 414 n 95 mask 415 pilot tube with cap 5 ml 416 puscher pippet dryer each 417 rubber tips each 418 slide box ( 50 slide ) 419 slide stand 1x4 420 slider forcep each 421 sprit lamp 422 sputum cups 50 ml 423 staining rod alluminium each 424 sterelie container each 5 ml plastic 425 sterelise swab tubes each 426 sterelise swab ( alcoholic ) 427 sterelise culture tube each 428 test tubes ( medium 12x100 size ) 429 test tube ( small 12x75 size ) 430 tips for auto pippertes 2 100 micro liters 431 tips for auto pippetes 200 1000 micro liters 432 tissue roll cotton 200 grams 433 variable auto pippets 10 to 100 micro liters 434 variable auto pippets 5 to 50 micro liters 435 variable auto pippets 100 to 1000 micro liters 436 glucometer strips sd check 437 glucometer strips dr.morpon 438 glucometer strips acusure 439 glucometer strips nipro 440 latex free tourniquet, size : width 1 inch x length 18 inch 441 potassium electrode each 442 septum each 443 sodium electrode each 444 urine culture pot 30 ml 445 storage vials with screw cap polypropylene 2 ml 446 basic fuchin powder 85% 88% ( to calculate the requirement of basic fuschin 447 methylated sprit ethanol denetured + 5 % isopropyle alchohol+5% methanol mol structure: c2h5oh mol.wt. 46.07 purity 90 % 448 methylene blue powder methylionine chloride, structure: c16h18ci3s, mol.wt. 319.9, dye contain: sold be available on the container approximately 82% 449 pottasium dichromate chemical formula k2cr207, formula wt: minimum assay 99.5% 450 phenolic compounds cotaining disinfactants houshold disinfactant, containing phenolic compounds such monochlorophenol, coaltar acid, oils & emulsifiers etc. the a 451 sulphuric acid formula wt 98.08 specific gravity 1:84 minimum assay 98% 452 malachite green hydrochloride, structure:c23h25cin2, molecular wt=364.9, colour:green, dye 453 methyl blue methylene thionine chloride, chem.structure:c16h18cin3s, molecular wt 319.9, dye content approx 82% ( dye content must be mentioned 454 auramine c17h22c1n3, mol. wt. 303.84 455 hydrochloric acid concentrated hcl, mol.wt.: 36.46 specific gravity 1.18 456 pottasium permagnete kmno4 formula wt.158 457 liquid parafin ( heavy grade ) refractive index of 1.48 itshould be colourless, odorless, transparent, free from fluorescence in day light with relative dencity of 0.2 458 sodium citrate trisodium citrate dihydrate, ar grade chemical structure: na3c6h5o7, 2h, o, mol.wt. ( fw ) :294.10 459 pottasium phosphate pottasium dihydrogen ortho phosphate kh2po4, mol.wt. 136.1, minimum assay:99% 460 magnesium sulphate mgso4, 7h2o, mol.wt.246.48, purity: 99.5% 461 magnesium citrate tribasic, c12h10mg3014.9h2o mol.wt. 613.28 462 l asaragine monohydrite c4h8n23.h2o mol.wt. 150.14 463 glyserol formula: ch2ohchohch2oh mol.wt.92.1, purity:99.5 % 464 sodium hydroxide pellet formula: naoh, wt. 40 minimum assay:98% 465 cetyl pyridinium chloride structure: c21h38c1n. h2o / 358 466 sodium chloride nacl mol.wt. 58.44 minimum assay;99.9 467 dihydrostreptomycin sesquisulphate sigma d 7253 468 isonicotinic acid hidrazyde sigma i 3377 469 refampcin sigma r 3501 470 ethambutol dihydrochloride sigma e 4630 471 pnb para nitro benzonic acid formukla wt. 472 filter paper 1, 12.5 cms diameter 4 filtering carbol fuschin using a small funnel of 10 cm maximum diameter, smooth on one 473 diamond mark 6 holder with artificial diamond ( hard stone ) embedded at 1 and with screw cap to mark one microscope glass slide 474 carbolic acid: phenol structure: c6h5oh mol.wt. 94.11 melting point: 40 degree centegrate purity 95 %, please note: the critical concentation of phenol in carbol fuschin is 5%, phenol is highly corosive, handle with extreme care 475 lens paper soft microscope lens cleaning tissue 4x6 booklet, each booklet containing 100 sheet 476 phenyl 40 % 477 ethanol 100 % 478 thermacol box 8x16 479 ppt vials ( 2tu ) 480 stop watch 481 stain stand 482 disposable ecg electrode packet of 100 483 e.c.g. gelly 484 ecg paper ( wax coated ) 50mmx30mtrs 485 ecg paper ( chemical coated ) 50mmx20mtrs 486 ecg paper computerizes triple channel chemical 487 ecg roll 50mmx30mtr 488 radiation protection device 6x15 489 radiation protection device 10x12 490 sonogarphy gelly 491 thermal printing paper roll 492 usg paper roll 493 usg jelly 494 x ray caste size 10x12 495 x ray caste size 12x12 496 x ray caste size 12x15 497 x ray caste size 8x10 498 x ray casset size 6.5x8.5 499 x ray casset with screen blue 6.5x8.5 intensifying 500 x ray casset with screen blue 8x10 intensifying 501 x ray casset with screen blue 10x12 intensifying 502 x ray casset with screen blue 12x15 intensifying 503 x ray casset with screen blue 12x15 intensifying 504 x ray film ways 505 x ray led cover sheet 506 chest stand bowl type 507 chest stand flowr type 508 x ray developing tank ss22 ltr 509 x ray developing tank ss13.5 ltr 510 x ray developing tank ss9.5 ltr 511 led apron medium 22x36 11 lbs ( thickness to lead equibalant 0.5 mm 512 led apron medium 24x38 11 lbs ( thickness to lead equibalant 0.5 mm 513 led protective varier 514 lead partition abc type ( 4x6 ) 515 lead gloves size 5 n0. 516 lead gloves size 7 n0. 517 x ray devolper 13.5 ltr 518 x ray film 10x12 519 x ray film12x15 520 x ray film12x12 521 x ray film 8x10 522 x ray film 6.5x8.5 523 x ray film digital 10x10 ( fuji ) 524 x ray film digital 11x14 ( fuji ) 525 x ray film digital 14x17 ( fuji ) 526 x ray film digital 8x10 ( fuji ) 527 x ray film digital 12x12 ( fuji ) 528 x ray film digital 12x15 ( fuji ) 529 x ray fixor 13.5 ltr 530 x ray fixor 9.5 ltr 531 x ray hangar 10x12 532 x ray hangar 12x12 533 x ray hangar 12x15 534 x ray hangar 8x10 535 x ray hangar 6.5x8.5 536 x ray intensifing screen 6.5x6.8 537 x ray intensifing screen 08x10 538 x ray intensifing screen10x10 539 x ray intensifing screen10x10 540 x ray intensifing screen12x15 541 x ray lead number0 9 542 x ray lead letterr&l symbol 543 x ray lead lettera z 544 x ray view box double 545 x ray view box single 546 ecg roll 108t / 6108t make bpl 547 ecg roll 6208t make bpl 548 ecgroll make gotiz twelve ( 12 ) chanel 549 ecgroll make gotiz six ( 6 ) chanel 550 ecgroll make gotiz three ( 3 ) chanel 551 ecgroll make gotiz single ( 1 ) chanel 552 hanger for dantel x ray 553 safe light for x ray dark room 554 size of film 10 inch x 12 inch digital x ray film ( dihl ( pack of 150 ) ) , film 555 auto dill solution ( erma ) 556 autolyse solution ( erma ) 557 auto clean solution ( erma ) 558 m 52 diff lyse ( bc 5000 ) 559 m 52 lh lyse ( bc 5000 ) 560 m 52 d diluent ( bc 5000 ) 561 probe cleaner ( bc 5000 ) 562 cbc paper roll 563 t3 i chromo analyzer 564 t4 ( nano scan reader ) 565 tsh nano scan reader 566 lugol solution 100 ml 567 potassium di chromate 568 na+ 569 k+ 570 prothrombin time 5 ml 571 a v blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzers ) with side tubing ( for heparinization and av pressure monitoring ) ce and iso certificate essential with protector for all machines types and dialysers ( post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality, each ) , consumable 572 1.3 and 1.4 adult di lyzer 573 hemodialysis fluid for bicarb made ( part a 10 ltr +part b 500gm 2 / pkt ) , consumable [ 700254 ] 574 size of film 8 inch x 10 inch digital x ray film ( dihl ( pack of 150 ) ) , film 575 medicine plaster of paris powder ( medicine pop ) 576 size of film 14 inch x 17 inch digital x ray film ( dihl ( pack of 100 ) ) , film 577 torch igg 4 in 1 casset test kit 578 strips for autoclave sterlity testing ( steam indicator strips class1 ) 579 surgical mop 2 pc. 30 cm x 30 cm 580 laringoscope blade 00 no. 581 laringoscope blade 0 no. 582 laringoscope blade 1 no. 583 laringoscope bulb 584 nasal prong 0 no. 585 ambu bag 250 ml 586 ambu bag 500 ml 587 umblical catheter 588 hub cutter manual 589 hub cutter electric ( electric needle cutter ) 590 prolene mesh 7.6 cm x 15 cm 591 prolene mesh 15 cm x 15 cm 592 anatomical transparent mask size 0 593 anatomical transparent mask size 1 594 anatomical transparent mask size 2 595 anatomical transparent mask size 3 596 anatomical transparent mask size 4 597 anatomical transparent mask size 5 598 baiin circuit adult 599 baiin circuit pediatric jackson rees 600 magells forcep 601 stillitte adult 602 stillitte peadiatric 603 suction catheter disposable 604 airways size 0, 1, 2, 3, 4, 5 605 filter for oxygen concentrator 606 vein detector 607 c pap machine nasal prong size 0 608 c pap machine nasal prong size 1 609 c pap machine circuit 610 kellys pad disposable 611 sanitary pad 612 cidex solution 613 glacial acetic acid 500 ml 614 lugols iodine solution 100 ml 615 dynaplast 10cm x 4 m 616 dynaplast 8cm x 4 m 617 thermometer digital 618 room thermometer 619 refridgerator thermometer 620 spatula ( pap smear ) 621 calf for bp apparatus adult 622 calf for bp apparatus adult 623 dial monitor for bp apparatus 624 bulb for bp apparatys 625 artery forcep 626 mosquito forcep 627 sponge holding forcep 628 bp handle 3no. 629 bp handle 4no. 630 allis forcep 631 mayo scissor curved 632 scissors straight 633 tooth forcep 634 debakey ( non tooth forcep ) 635 nibbler ( rongeur ) 636 periosteal elevator 637 curettes 638 self centering bone holding forcep 639 bone rasp 640 pliers 641 formalin chamber ( l size ) 642 oxygen hood ( pediatric ) 643 bone holding forcep 644 jumbo cutter 645 wire passer 646 lawmans clamp ( m size ) 647 t handle 648 carbon drill bit 649 cannulated drill 650 b.b silk ( 12 foils / pkt ) ( 3 / 8rcut needle 45mm length 76cm, size 2 / 0 ) ( consumable ) 651 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) 652 b.b silk with 1 / 2 cir rb / cutting needle 30 mm length 75 cm non absorbable ( size 2 0, 12 foils / pkt ) 653 b.b silk with 1 / 2 cir rb needle 20 mm length at least 75 cm non absorbable surgical suture usp size 3 0 654 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) 655 b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm ( length at least 75 cm, 12 foils per packet ) 656 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet ( needle 30 mm length 70cm no. 1 0 657 catgut chromic with 1 / 2 cir cutting needle 12mm ( length 70cm no.3 0, 12 foils per pakt ) 658 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) 659 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 660 polyglactin 30 mm 1 / 2 circle round body 90 cm size 1 / 0 ( 12 foils / pkt ) 661 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 20 mm, length 70 cm size 3 / 0 ) 662 polyglactin 30 mm 1 / 2 circle round body 90 cm size 2 / 0 ( 12 foils / pkt ) 663 polyglactin 30 mm 1 / 2 circle round body 90 cm size 3 / 0 ( 12 foils / pkt ) 664 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 90 cm size 2 / 0 ) 665 baby diaper 666 infusion connecting tube 6 inch 667 infusion connecting tube 1.5 inch...

Directorate Of Medical Education - Madhya Pradesh

32061822 tender for purchase of chemical and reagent for mdru dep tender for purchase of chemical and reagent for mdru dep , supply of chemicals and reagents for mdru , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 5 od , r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 5 od , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , tips i. 0.2 20 ?l tips pack size of 1000 each , tips ii. 20 200 ?l tips pack size of 1000 each , tips iii. 200 1000 ?l tips pack size of 1000 each , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tips , filter tips pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tips , filter tips pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tips , mct variable tubes , i. 20 200?l tubes pack size of 1000 psc. , ii. 200 600 ?l tubes each , iii. 500 2000 ?l tubes , nitrile autodextorous gloves pack size of 1000 psc. , mctstands for variable tubes sizes pack size of 1000 psc. each , i. 20 200?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , ii. 200 600 ?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , iii. 500 2000 ?l tubes stand , filter tip boxes pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000ml 05each , graduated beakers50, 100, 500, 1000ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , total rna mini kit ( human skin tissue ) pack size for 100 reaction , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , chloroform 500 ml , phenol 500 ml , isoamyl alcohol 500 ml , hno3 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , cholin cleaner 500 ml , sterilium 500 ml , hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , brown paper for autoclaving 10 rolls , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side 1 psc. each , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen 5ltrpkt. , liquid nitrogen sample handling gloves 5 sets of gloves , phosphate buffer saline 500 ml , formalin 500 ml , slide tray / rack pack of 2 psc. , paraffin wax ( 58 60c ) 250 gm , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 2 psc. , whatman filter paper grade 1 & 2 pack size of 50 psc. , harri’s hematoxylin powder 50 gm , yellow eosin powder 50 gm , coverslip 18x18 ( microscopic ) 100 psc. , dpx mount 50 ml , xylene 250 ml , glycerol 100 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , ammonia 250 ml , hot plate 1 psc. , methanol 250 ml. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , acrylamide / bis ar 500 gm , 10x tbe buffer 100 ml , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100ug , human pai 1 elisa kit pack size of 96 reactions , diethyl pyrocorbonate 5 ml , pbs 500ml , mortar and pestle homogenizers...

Government College - Madhya Pradesh

31937159 rate contract for medical items rate contract for medical items , items , hbsagcard 50 , hiv card 50 , urine for albumin / sugar 100 , urine for pregnancy stip and card 50 , malaria antigen pf / pv 50 , urine strip for 10 para ( laura ) 100 , urine strip for 5 para 100 , syphlis card for vdrl 50 , rapidaso ( latex slide test ) 20 , rapid crp ( latex slide test ) 20 , rapid ra ( latex slide test ) 20 , rapid widal ( o, h, ah, bh ) slide test 4*5ml , widal ( o, h, ah, bh ) test tube method 4x50ml , blood group kit ( antisera ) 3*10ml , glucose ( god pod ) 4x50ml , cholesterol ( chod pod mathod ) 4x25ml , direct hdl cholesterol 2 x 24 / 2 x 8 ml , triglycerides ( gpo pap 4x25ml , bilirubin ( t&d ) ( modified jendrassik method ) 4x50ml , sgot ( ast ) kinetic 5*10ml , sgpt ( alt ) kinetic 5*10ml , alkaline phosphatase ( pnpp ) kinetic 3*10ml , uric acid ( uricase ) 5x5ml , urea ( ned kinetic ) 4 x 20 / 4 x 5ml , creatinine fk ( kinetic ) 2 x 25 / 2 x 25ml , ra ( quantitative immune turbid metric 50ml , aso ( quantitative ) 50ml , calcium ( ocpc ) 1x50ml , crp ( rapid quantitativetest finecare ) 25 test , crp ( quantitative ) 2 x 20 / 2 x 5ml , hba1c ( rapid quantitativetest finecare ) 25 test , electrolyte ( na, k, cl ) medica , electrolyte internal filling solution medica regent pack , electrolyte daily cleaningsolution medica regent pack , electrolyte easily level control medica regent pack , sodium hypochlorite 5 lt , diluent ( 20 liter ) mindraym 30 d , rinse cleaner ( 20 liter ) mindray m 30 r , lyse ( 500ml ) mindray m 30 cfl , probe cleaner ( 17ml ) mindray , quality control ( 17ml ) mindray , vitamin d ( rapid quantitativetest finecare ) 25 test , psa ( rapid quantitativetest finecare ) 25 test , ca 125 ( elisa ) 96 test , vitamin b12 ( elisa ) 96 test , lh ( elisa ) 96 test , fsh ( elisa ) 96 test , prl ( elisa ) 96 test , hbsag ( elisa ) 96 test , ferritin ( elisa ) 96 test , t3 ( rapid quantitativetest finecare ) 25 test , t4 ( rapid quantitativetest finecare ) 25 test , tsh ( rapid quantitativetest finecare ) 25 test , il 6 ( rapid quantitativetest finecare ) 25 test , d dimer ( rapid quantitativetest finecare ) 25 test , t3 ( elisa ) 96 test , t4 ( elisa ) 96 test , tsh ( elisa ) 96 test 96 test , isotonac ( nihon koden ) 18 lt , cleanac ( nihon koden ) 5 ltr , cleanac 3 ( nihon koden ) 2 ltr , hemolynac 3n 500ml , bariumchloride 10% w / v 500ml , benadictsreagent 5lt , fouchet’s reagent 250ml , drabkins solution with standard ( for hb ) 5000ml , glacial acetic acid 500ml , edta 5% w / v 500ml , sulfuric acid con. 500ml , field stain a 500ml , field stain b 500ml , hydrochloric acid n / 10 500ml , immersion oil ( microscopy grade ) dropping bottle 30ml , immersion oil ( microscopy grade ) dropping bottle 25 ml , wbc diluting fluid 500ml , rbc diluting fluid 500ml , reticulocyte counting fluid ( biolab ) 25 ml , semen diluting fluid 100ml , formalin 5 lt , formalin 30lt , fructose 100ml , acetone 250 test , leishman stain with buffer 250ml , sulphur powder 500g , liquor ammonia solution 500gm , sodium nitroproside 100gm , carbol fuchsin ( zn strong ) 500ml , meth line blue 500ml , xyline 2.5ltr , needle 23, 24 1x100nos , sprit 4.5 ltr ( methy ) , distilled water 5ltr , paps smear staining , slide stand alu , esr niddle , micropipete stand , hemocytometr , glucometre dr morphen , glucometer strips 1x50nos dr morphen , micropipette fix volume , micropipette variable volume 0.5 5ul , micropipette variable volume 5 50ul , micropipette variable volume 10 100ul , micropipette variable volume 20 200ul , micropipette variable volume 100 1000ul , incubator ( inner chamber ss digital with fan ) 14x14x14 , water wath ( digital ) 10x12x7 , hemoglobin meter , urinometer , slide box , pipette glass 2.0ml , pipette glass 5.0ml , pipette glass 0.2ml , pipette glass 0.1ml , pipette glass 10*75mm , pipette glass 10*75mm , test tube without rim glass 12*100mm , test tube without rim plastic 1x100nos , test tube without rim 1x100nos , test tube without rim 1x100nos , reagent bottle , reagent bottle 12 inch , plastic droper , glass rod , rbc pipette 100 , wbc pipette 10gm , capillary tube 1x100nos , cover slip 18, or 22mm 1x20 nos pack , wintrobe tube for esr , test tube cleaning brush , pipette bulb , test tube holder , tourniquet , citrate vail , edta k3 vail , fluoridevail , plain vail ( activator ) , ria vail 100 , chattels forceps straight ss , urine container sterile 30 ml 1 pack , micropipete tips 10 100 u and 100 1000 u, 1 pack , tissue paper , filterpaper 100 pack , insulin syringe , polythene gloves 100 , surgical gloves 6; no 7 n0 , non dispo gloves 100 , postmortem gloves , syringe 50ml , syringe , 20 ml , syringe 10 ml , syringe , 5ml , syringe 2ml , ecg gelly 250ml , usg gelly 250ml , cotton roll 500 g , usg roll upp 1105 in ( 110mmx20m ) thirmal print media ) , dental x ray film ( 1.0.p.a.25x33mm ) , gloves powder 500gm , povidione solution 500 ml , povidione ointment 15gm , savlon 1ltr , dettol 1ltr., , dettol500ml, , dettol 100ml , hydrogen peroxide 450 ml 30ml , lignocaine gelly 2% , lignocaine inj with adrenol 2% 30ml , lignocaine spray 10 % , lignocaine inj 2% , lignocaine inj 4% , lignocaine tropical vail 4% , tinbenzone 100ml , pure hand , bandage ( antiseptic ) , micropore 2inch , micropore 4inch , n. saline, dns, d5, d10 , scalpvan set , berbar thred 20 no. , enima pot , enima pipe with nozal , hot water beg , rubber catheter red , bandage than , roll bandage 0.5x 0.5, 7 , roll bandage 5x 5 , roll bandage 10x5 , ecg roll ( 12 channel gotiz ) , mechontosh , head cap disposable 100 , sanityzer 5lt , x ray film digital fuzi 14x17 , x ray film digital duzi 8 x 10 , nylon silk suture4.0 , 31inch*72inch color white non woven fabric for single use bedsheet , weighing machine adult , weighing machine child , weighing machine digital , stethoscope adult , stethoscope child , bp instrument led mercury , glucometer strips 1x50nos dmorphen , formalin4.5 lt , pulse oximeter , non contact thermometer , face mask disposable 3 layar , n 95 face mask , occult blood card , alkaline phosphatase kit ( alp ) , alanine aminotransferase kit ( alt ) , ? amylase kit ( amy ) , aspartate aminotransferase kit ( ast ) , bilirubin direct kit , bilirubin direct kit , bilirubin total kit , bilirubin total kit , calcium kit , c reactive protein kit ( 1*40ml+1*10ml ) , gamma–glutamyltransferase kit ;ggt , glucose kit ( 4*40ml+2*20ml ) , hdl cholesterol kit ( 1*40ml+1*14ml ) , ldl cholesterol kit ( 1*40ml+1*14ml ) , total cholesterol kit ( 4*40ml ) , triglycerides kit ( 4*40ml ) , uric acid kit ( 4*40ml+2*20ml ) , urea kit ( 4*35ml+2*18ml ) , creatine...

Directorate Of Health Services - Madhya Pradesh

31881514 materials surgical, lab regents, consumables materials surgicals, lab regents, consumables 1.00 lab test kits and reagent 1.01 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.02 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 1.00 each 1.03 anti abd grouping serum 3x10ml consumable 1.00 each 1.04 anti a sera igm ( 10 vial ) , consumable 1.00 each 1.05 anti b sera igm ( 10 vial ) , consumable 1.00 each 1.06 anti d sera igg+igm 10ml vial ( each ) , consumable 1.00 each 1.07 anti d ( polyvalent ) ( 1x10 ml ) , consumable 1.00 each 1.08 anti h sera 1.00 each 1.09 auto pippets fixed volume 10 micro liters each 1.00 each 1.10 auto pippets fixed volume 1000 micro liters each 1.00 each 1.11 auto pippets fixed volume 20 micro liters each 1.00 each 1.12 benedicts qualitative reagent ( 1x5 lit ) , consumable 1.00 each 1.13 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.14 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.15 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 1.00 each 1.16 bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable 1.00 each 1.17 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.18 blood agar powder ( 500 grm ) , consumable 1.00 each 1.19 blood bag 100ml 1.00 each 1.20 blood bag 350ml 1.00 each 1.21 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 1.00 each 1.22 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 1.00 each 1.23 blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 1.00 each 1.24 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 1.00 each 1.25 blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 1.00 each 1.26 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) 1.00 each 1.27 blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 1.00 each 1.28 blood urea ( bun ) uv ( 1000 ml ) , consumable 1.00 each 1.29 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable 1.00 each 1.30 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable 1.00 each 1.31 blood urea ( arba ) , consumable 1.00 each 1.32 capillary tube 100 pieces consumable 1.00 each 1.33 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 1.00 each 1.34 cholesterol kit end point enzymatic kit 50 test / kit 1.00 each 1.35 cholesterol kit end point enzymatic kit 5x20ml 200 test / kit 1.00 each 1.36 conc hcl ( 1x500 ml = 500 ml ) , consumable 1.00 each 1.37 cover slip 18 x 18 mm 10gm 1.00 each 1.38 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 1.00 each 1.39 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 1.00 each 1.40 creatinin kit 1.00 each 1.41 crp kit 1x100 biolab qualitative ) 1.00 each 1.42 crp latex slide per test 1.00 each 1.43 crp test kit ( latex / card ) ( 25 test / kit ) 1.00 each page 11 of 22 1.44 crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable 1.00 each 1.45 dengu card antigen ( 25 card / pkt ) , consumable 1.00 each 1.46 dengue card test 100 test kit 1.00 each 1.47 developer powder ( 22.5 ltr ) 1.00 each 1.48 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 1.00 each 1.49 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 1.00 each 1.50 digital x ray film 10x12 ( 150 films / pkt ) 1.00 each 1.51 digital x ray film 11x14 ( 150 films / pkt ) 1.00 each 1.52 digital x ray film 8x10 ( 150 films / pkt ) 1.00 each 1.53 echo jelly 20ml bottle 1.00 each 1.54 echo jelly 250 ml ( mfg by precious life care ) , bottle 1.00 each 1.55 edta k3 vial each 1.00 each 1.56 edta solutions k3 ( 500 ml ) 1.00 each 1.57 edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable 1.00 each 1.58 field stain a 500ml 1.00 each 1.59 field stain b 500ml 1.00 each 1.60 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 1.00 each 1.61 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 1.00 each 1.62 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 1.00 each 1.63 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable 1.00 each 1.64 gel matrix group card 1.00 each 1.65 gel matrix cross match card 1.00 each 1.66 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 1.00 each 1.67 glacial acetic acid ( 2.5 liter ) , consumable 1.00 each 1.68 glass slide 75mm x 25mm 1.1 mm 1.00 each 1.69 glass slide 75mm x 25mm 1.35 mm 1.00 each 1.70 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. iiglazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 1.00 each 1.71 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt 1.00 each 1.72 glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt 1.00 each 1.73 glass test tube 5 without edge 1.00 each 1.74 glucometer strip ( 1x100 ) 1.00 each 1.75 glucose kit ( god / pod ) ( 350ml ) , digonstic 1.00 each 1.76 h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable 1.00 each 1.77 hba ag elisa 96 kit 1x96 ( each ) , consumable 1.00 each 1.78 hba ag rapid card test ( each ) , consumable 1.00 each 1.79 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 1.00 each 1.80 hcl n / 10 ( 500 ml bottle ) 1.00 each 1.81 hcv elisa ( 96 test kit ) , consumable 1.00 each 1.82 hcv kit card test ( 25 test / kit ) , digonstic 1.00 each 1.83 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 1.00 each 1.84 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 1.00 each 1.85 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 1.00 each 1.86 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 1.00 each 1.87 hiv kit card ( 25 test / kit ) 1.00 each 1.88 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 1.00 each 1.89 k3 blood vaccutainer edta 100 tubes / pkt 1.00 each 1.90 leishman stain 500 ml 1.00 each 1.91 malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) 1.00 each page 12 of 22 1.92 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 1.00 each 1.93 malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species 1.00 each 1.94 malaria pf / pv antigen card 1.00 each 1.95 malaria pf / pv rapid test 1.00 each 1.96 methyline blue ( 100 ml ) , solution 1.00 each 1.97 micro pipet 1000 fix and variable each 1.00 each 1.98 micropiptte 100 1000 1.00 each 1.99 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 1.00 each 1.100 n / 10 hcl 500ml 1.00 each 1.101 nebulization mask kit ( pediatrics ) 1.00 each 1.102 nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable 1.00 each 1.103 nebulization mask kit ( adult ) 1.00 each 1.104 new born baby kit [ 4 piece set ] 1.00 each 1.105 pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable 1.00 each 1.106 ra factor 50 test kit qualicative 1.00 each 1.107 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 1.00 each 1.108 test tube 12 x 100 ( medicm size ) 100 / pkt 1.00 each 1.109 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 1.00 each 1.110 test tube 15x125 1.00 each 1.111 tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each 1.00 each 1.112 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 1.00 each 1.113 tips for auto pippetes 10 to 100 micro litres 1.00 each 1.114 tissue paper roll ( each ) , consumable 1.00 each 1.115 tourniquet with belt ( good quality pairs ) , pairs 1.00 each 1.116 tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable 1.00 each 1.117 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 1.00 each 1.118 typhoid test card. 1.00 each 1.119 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 1.00 each 1.120 umbical cord clamps plastic material ( box of 100 clamps ) , consumable 1.00 each 1.121 urine albumin & suger 1.00 each 1.122 usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable 1.00 each 1.123 usg thermal paper 1.00 each 1.124 vdrl ( rpr ) 1x100 sd strip 1.00 each 1.125 vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable 1.00 each 1.126 vdrl kit ( strip ) ( 50 test / kit ) , consumable 1.00 each 1.127 widal 2x2 sera slide kit 1.00 each 1.128 widal 2x2 tube test kit 1.00 each 1.129 widal 4x5 ml 1.00 each 1.130 slide blue star 1.00 each 1.131 sputum cup with sticker 1.00 each 1.132 paraffin strip roll 1.00 each 1.133 zipper polybag 1.00 each 1.134 alluminium foil roll 1.00 each 1.135 hand wash liquid 1.00 each 1.136 falcon tube 1.00 each 1.137 thermacol box 1.00 each 1.138 gel pack 1.00 each 1.139 bamboo stick 1.00 each 1.140 tape roll 1.00 each 1.141 spirit lamp 1.00 each 2.00 disposible material page 13 of 22 2.01 adhesive plasters usp 7.5 cm x 10 mts / roll 1.00 each 2.02 adhesive plasters usp 7.5 cm x 5 mts / roll 1.00 each 2.03 adhesive roll 1 inch x 5 m / roll 1.00 each 2.04 baby oxygen mask set of all sizes 1.00 each 2.05 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag 1.00 each 2.06 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag 1.00 each 2.07 disposable appron 1.00 each 2.08 disposable cap 1.00 each 2.09 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 1.00 each 2.10 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 1.00 each 2.11 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 1.00 each 2.12 disposable needles 22g consumable 1.00 each 2.13 disposable needles is 10654:2002 22g 1.00 each 2.14 disposable needles is 10654:2002 24g 1.00 each 2.15 disposable needles is 10654:2002 26 g ( ) , ne 2.16 disposable paper gloves size 7 inches consumable 1.00 each 2.17 disposable paper gloves size 7, 1 / 2 inches consumable 1.00 each 2.18 disposable plastic appron ( full size ) 1.00 each 2.19 disposable pricking lancet ( pkt of 200 units ) 1.00 each 2.20 disposable pricking lancet 100 units consumable 1.00 each 2.21 disposable scalp vein set size 20 no 1.00 each 2.22 disposable scalp vein set size 22 no 1.00 each 2.23 disposable sharp collection containers 1.5 l 1.00 each 2.24 disposable sharp collection containers 5 ltr 1.00 each 2.25 disposable sideport knife ( num ) , consumable 1.00 each 2.26 disposable sterile gloves size 6 inches consumable 1.00 each 2.27 disposable sterile gloves size 6, 1 / 2 inches consumable 1.00 each 2.28 disposable sterile gloves size 7 inches consumable 1.00 each 2.29 disposable sterile gloves size 7, 1 / 2 inches consumable 1.00 each 2.30 disposable sterile hypodermic syringe 10ml ( each ) , consumable 1.00 each 2.31 disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable 1.00 each 2.32 disposable suction catheter ( size 12 ) , consumable 1.00 each 2.33 disposable suction catheter ( size 14 ) , consumable 1.00 each 2.34 disposable surgeon cap ( box of 100 caps ) 1.00 each 2.35 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 1.00 each 2.36 disposable syringe with needle ( 2ml each ) , syrings 1.00 each 2.37 disposable syringe with needle ( 3ml each ) , syrings 1.00 each 2.38 disposable syringe with needle ( 5ml each ) , needle 1.00 each 2.39 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 1.00 each 2.40 kellys pad disposable 1.00 each 2.41 n 95 mask ( as per attached specification ) , consumable 1.00 each 2.42 oxygen mask adult ( standard size ) 1.00 each 2.43 oxygen mask paediatric ( standard size ) 1.00 each 2.44 plain disposable vial 3ml ( each ) , consumable 1.00 each 2.45 scalp vein set ( size 24g, disposable ) , consumable 1.00 each 2.46 three layer surgical mask 1.00 each 2.47 urine container 5ml disposable ( 50 per pkt ) 1.00 each 2.48 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 1.00 each 3.00 x ray related 3.01 x ray film 10 x 12 50 sheets / pack 1.00 each 3.02 x ray film 12 x 12 50 sheets / pack 1.00 each 3.03 x ray film 12 x 15 50 sheets / pack 1.00 each page 14 of 22 4.00 catgut / b.b. silk 4.01 b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable 1.00 each 4.02 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle 1.00 each 4.03 b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle 1.00 each 4.04 b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material 1.00 each 4.05 b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material 1.00 each 4.06 black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) 1.00 each 4.07 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable 1.00 each 4.08 black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt 1.00 each 4.09 black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt 1.00 each 4.10 catgut chromic size:2 / 0 length 150 cm 1.00 each 4.11 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet 1.00 each 4.12 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable 1.00 each 4.13 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable 1.00 each 4.14 chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable 1.00 each 4.15 chromic catgut , round body needle no. 1.0 1.00 each 4.16 chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) 1.00 each 4.17 chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt 1.00 each 4.18 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle 1.00 each 4.19 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 1.00 each 4.20 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 1.00 each 4.21 non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable 1.00 each 4.22 non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable 1.00 each 4.23 silk no 1 cutting needle 1x12 ( 1x12 ) , consumable 1.00 each 4.24 suture mersilk 8 0 ( 12 foil ) 1.00 each 4.25 silver nitrate solution 1 ltr. 1.00 bottle 4.26 urine bag 2 ltr. 1.00 each 4.27 plaster of paris 4 10x5mtr 1.00 each 4.28 plaster of paris 6 15x 5mtr 1.00 each 4.29 cumb sera 1.00 each 4.30 albumin 1.00 each 4.31 laryngo scope bulb 1.00 each 4.32 auto clave quil 1.00 each 4.33 idetification tag 1.00 each 4.34 peadiatric drip set 1.00 each 4.35 dresing pad 1.00 each 4.36 endotracheal tube no. 6 1.00 each 4.37 endotracheal tube no. 2.5 to 5 ml. 1.00 each 4.38 dynaplast 10 cm. 1.00 each 4.39 sicklewive test kit 1.00 each 4.40 autoclave indicator 1.00 each 5.00 cotton and related, chadar, bedsheet 5.01 absorbent cotton roll 100 gm each consumable 1.00 each 5.02 absorbent cotton wool ip 500 grms ( each ) , consumable 1.00 each 5.03 cotton crape bandage 10cm x 4m ( box of 10 bandages ) 1.00 each 5.04 cotton crape bandage 15cm x 4m ( box of 10 bandages ) 1.00 each 5.05 cotton delivery belt 1.00 each 6.00 adhesive tape 6.01 adhesive tape 7.5cm x10 ( mtr / roll ) , consumable 1.00 each 6.02 cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable 1.00 each page 15 of 22 6.03 paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable 1.00 each 6.04 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll 1.00 each 6.05 paper adhesive plaster microporous surgical tape 2 inch x 5m / roll 1.00 each 6.06 paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll 1.00 each 6.07 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 1.00 each 6.08 paper adhesive plaster microporous surgical tape 6 inch x 5m / roll 1.00 each 6.09 umblical cotton tape length 75cm. 1.00 each 7.00 catheter 7.01 disposable suction catheter ( size 12 ) , consumable 1.00 each 7.02 disposable suction catheter ( size 14 ) , consumable 1.00 each 7.03 feeding tube ( catheter ) 10g 1.00 each 7.04 foleys catheter size 12 2 way ( 10 each ) , consumable 1.00 each 7.05 foleys catheter size 14 2 way 1.00 each 7.06 foleys catheter size 14 3 way 1.00 each 7.07 foleys catheter size 16 2 way ( 11 each ) , consumable 1.00 each 7.08 foleys catheter size 18 2 way 1.00 each 7.09 foleys catheter size 20 2 way ( 12 each ) , consumable 1.00 each 7.10 foleys catheter size 22 2 way ( 13 each ) , consumable 1.00 each 7.11 foleys catheter size 24 2 way ( 14 each ) , consumable 1.00 each 7.12 foleys urinary catheter 2 way size 8 1.00 each 7.13 infant feeding tube ( catheter ) size: 3g 1.00 each 7.14 infant feeding tube ( catheter ) size: 4g 1.00 each 7.15 infant feeding tube ( catheter ) size: 5g 1.00 each 7.16 infant feeding tube ( catheter ) size: 6g 1.00 each 8.00 blade 8.01 surgical blade isi marked, size 15 ( 100 per packet ) , surgical material 1.00 each 8.02 surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material 1.00 each 8.03 surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material 1.00 each 8.04 surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material 1.00 each 8.05 surgical blade isi marked, size 25 ( 100 / pkt ) , surgical material 1.00 each 8.06 surgical blade, size 11 1.00 each 9.00 ecg 9.01 ecg jelly 250 gms 1.00 each 9.02 ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable 1.00 each 9.03 ecg paper computerizesd triple channel 20m 1.00 each 9.04 ecg paper ( chemical coated ) 50mm x 20mm roll 1.00 each 9.05 ecg paper ( chemical coated ) 50mm x 30 mtr. roll 1.00 each 9.06 ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll 1.00 each 9.07 ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable 1.00 each 9.08 ecg roll three channel 20m 1.00 each 9.09 ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable 1.00 each 10.00 needle 10.01 absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) 1.00 each 10.02 absorable surgical suture rb needle size no 1 , 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) 1.00 each 10.03 absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable 1.00 each 10.04 blood vessel introducers needles 16g, sterilized, set 1.00 each 10.05 chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle 1.00 each 10.06 chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle 1.00 each 10.07 chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle 1.00 each 10.08 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 1.00 each 10.09 intravenous set with airway and needle ( ( adult ) ) , surgical material 1.00 each 10.10 intravenous set with airway and needle ( children ) , surgical material 1.00 each page 16 of 22 10.11 spinal needle no. 23 1.00 each 10.12 sterile hypodermic syring with needle 10 ml 1.00 each 10.13 sterile hypodermic syring with needle 20 ml 1.00 each 10.14 sterile hypodermic syring with needle ( 5 ml ) , syrings 1.00 each 10.15 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable 1.00 each 10.16 vicryl no. 1 rb 1.00 each 10.17 vicryl no. 2.0 rb 1.00 each 11.00 iv cannula 11.01 cannula fixer set consumable 1.00 each 11.02 i.v cannula with injection valve size : 18g 1.00 each 11.03 i.v. cannula with injection valve 20g 1.00 each 11.04 iv cannula ( two way ) size 20 1.00 each 11.05 iv cannula ( two way ) size 22 1.00 each 11.06 iv cannula ( two way ) size 24 1.00 each 11.07 iv cannula size 26g ( ) , consumable 1.00 each 11.08 biomedical waste collection plastic bag small ( all colours ) 1.00 each 11.09 biomedical waste collection plastic bag medium ( all colours ) 1.00 each 11.10 biomedical waste collection plastic bag large ( all colours ) 1.00 each 11.11 mattress 5kg cotton 3 ft x 6 ft 1.00 each 11.12 pillow with 2kg cotton 1.00 each 11.13 tericot sharee 1.00 each 11.14 compunder dress ( male ) 1.00 each 11.15 bed sheet single bed ( white ) 1.00 each 11.16 bedsheet double bed ( white ) 1.00 each 11.17 bed sheet single bed ( coloured ) 1.00 each 11.18 bedsheet double bed ( coloured ) 1.00 each 11.19 baby diapers small ( 10 diaper per pkt ) 1.00 each 11.20 chair cushion box type 1.00 each 11.21 chair cushion box type 1.00 each 11.22 chair cushion cover 1.00 each 11.23 compounder coat / lab tec / xry tec std size 1.00 each 11.24 curtain green redymade 1.00 each 11.25 curton cloth rangeen 1.00 each 11.26 curton cloth rangeen design 1.00 each 11.27 dionised water 5 ltr cane ( each ) 1.00 each 11.28 front aprin 1.00 each 11.29 metresses 3x6 with raxine cover 4 density 1.00 each 11.30 napkin sup. quality std size ( white ) 1.00 each 11.31 napkin sup. quality std size ( coloured ) 1.00 each 11.32 peticote blauge cloth shuti rangeen 1.00 each 11.33 peticote / blauge cloth shuti bleach 1.00 each 11.34 pillow cover cloth bleach 1.00 each 11.35 rangeen baag print kapda 1.00 each 11.36 rangeen baag print kapda 1.00 each 11.37 rangeen design towel beev kapda 1.00 each 11.38 rangeen design weft stripe kapda 1.00 each 11.39 table cloth rangeen ( small ) 1.00 each 11.40 table cloth rangeen ( large ) 1.00 each 11.41 biomedical waste collection plastic dustbin small ( all colours ) 1.00 each 11.42 biomedical waste collection plastic dustbin medium ( all colours ) 1.00 each 11.43 biomedical waste collection plastic dustbin large ( all colours ) ...

Government Medical College - Madhya Pradesh

31823117 supply of chemical, reagents and consumables 2 2, 4 dnph 3 2, 6 dichloro phenol 4 4, amino antipyrine 5 acetic anhydriye 6 acetone 7 agar 8 agarose 9 alpha keto glutaric acid 10 alpha naphthol 11 amino acids 12 ammonia 13 ammonium molybdate 14 ammonium oxalate 15 ammonium persulphate 16 ammonium sulphate powder 17 amonical silver nitrate 18 anitmonic trichloride 19 arabinose 20 arsenic acid 21 barium chloride 22 benzidine powder 23 beta mercepto ethanol 24 bile pigments 25 bis acrylamide 26 blue litmus paper 27 bromophenol blue 28 butanol 29 calcium chloride 30 casein 31 ccl4 32 charcoal 33 cholesterol crystals 34 citric acid 35 concentrated h2so4 36 concentrated hno3 37 concentrated hcl 38 coomassie brilliant blue r 250 stain 39 copper sulphate 40 creatinine pure 41 cupric acetate 42 dextrin powder 43 di sodium phenyl phosphate 44 diacetyl monoaxime 45 diethyl pyrocarbonate 46 disodium monohydrogen ortho phosphate 47 dithiothreitol 48 dl alanine 49 dl aspartic acid 50 edta 51 eosin 52 ether 53 ethyl alcohol 54 ferric chloride 55 filter papers 56 filter papers whatmans no. 1 sheets 57 fluroglucinol powder 58 formaldehyde 59 formic acid 60 fructose powder 61 galactose powder 62 gelatin 63 glacial acetic acid 64 globulin 65 glucose powder 66 glycerol 67 hydrogen peroxide 68 hydroxy quinoline 69 iodine crystals 70 isopropanol 71 k2hpo4 72 keratin 73 kh2po4 74 lactic acid 75 lactose powder 76 lead acetate 77 lead oxide 78 liquid bromine 79 lithium chloride 80 low retention auto pipette tips 81 magnesium chloride 82 magnesium oxide 83 magnesium sulphate 84 maltose powder 85 mercuric chloride 86 mercuric sulphate 87 methanol absolute 88 methyl red 89 methylene blue 90 molybdic acid 91 monosodium dihydrogen phosphate 92 ninhydrin 93 nitrocellulose membranes 94 orcinol 95 orthophosphoric acid 96 paradimethylamino benzaldehyde 97 pasture pipettes 98 peptone powder 99 perchloric acid 100 ph papers range 2 14 101 phenol 102 phenolphthelin indicator 103 phenyl hydrazine hydrochloride 104 phenyl mercuric acetate 105 phenyl phosphate 106 phloroglucinol 107 phosphomolybdic acid 108 picric acid 109 potassium chloride 110 potassium ferricyanide 111 potassium ferrocyanide 112 potassium hydroxide 113 potassium iodide 114 potassium oxalate 115 potassium permanganate 116 potassium sodium tartarate 117 protein molecular weight markers 118 pvdf membranes 119 red litmus paper 120 resorcinol 121 silver nitrate 122 sodium acetate powder 123 sodium benzoate 124 sodium bicarbonate 125 sodium carbonate 126 sodium chloride 127 sodium citrate 128 sodium dithionite 129 sodium dodisyl sulphate ( sds ) 130 sodium hydroxide 131 sodium hypobromide 132 sodium hypochromate 133 sodium nitrite 134 sodium nitropruside crystals 135 sodium pyruvate 136 sodium sulphite 137 sodium tungstate 138 sprit lamps stainless steel 139 starch powder 140 sucrose powder 141 sudan black 142 sulphanilic acid 143 sulphosalysilic acid 144 sulphur powder 145 tannic acid 146 temed 147 thiosemicarbazide 148 thymol blue indicator 149 toffers indicator 150 trichloro acetic acid 151 tricine 152 tris base 153 urea 154 urease powder 155 uric acid crystals 156 vaniline 157 vitamin a 158 vitamin c 159 zinc chloride 160 zinc sulphate 161 bovine serum albumin 162 di sodium edta 163 ethidium bromide 164 xylene cyanol 165 potassium dichromate 166 twin 20 167 coomassie brilliant blue g 250 168 sodium deoxy cholate 169 glycine 170 amido black 171 6 amino hexanoic acid 172 ponceau s 173 fast green fcf 174 guanidine chlorid 175 ethidium bromide 176 bromophenol blue 177 methylene blue 178 bromocresol green s 179 lithium carbonate 180 bacteriological peptone 181 beef extract 182 yeast extract 183 malt extract 184 nutrient agar 185 blood agar base 186 cystine lactose electrolyte deficient agar 187 macconkey agar 188 agar agar 189 robertson cooked meat broth 190 bile salt agar 191 thiosulphate citrate bile salt sucrose 192 2.92 bile aesculin agar 193 brain heart infusion broth 194 2.94 mueller hinton agar 195 pikes media ( h. inf. ) 196 plet media ( b. anthracis ) 197 pnf medium ( s. pyogenes ) 198 lj medium 199 sda 200 bile salt agar 201 ss agar 202 sorbotolmacconkey agar ( ehec ) 203 tetrathionate broth 204 selenite f broth 205 stuart transport medium 206 thayer martin medium 207 triple sugar iron agar 208 sim medium 209 simmon’s citrate agar 210 christensen urea agar 211 dca 212 pre reduced anaerobically sterilized media 213 mannitol salt agar 214 xld agar 215 wilson blair brilliant green bismuth sulphite agar 216 hoyle’s tellurite lysed blood agar 217 mrvp broth 218 glucose 219 sucrose 220 lactose 221 maltose 222 mannitol 223 inulin 224 amikacin 30μg 225 amoxicillin 25 μg 226 ampicillin / cloxacillin 10 μg 227 amoxicillin + clavulanic acid 20+10 μg 20+10 μg 228 ampicillin +salbactam 10+10 μg 10 vial each 229 azithromycin 15 μg 230 aztreonam 30 μg 231 bacitracin 130 μg / μl 232 carbenicillin 100 μg 233 cefaclor 30 μg 30 μg 234 cefalexin 30 μg 30 μg 235 cefazolin 30 μg 30 μg 236 cefepime 30 μg 237 cefixime 5 μg 238 cefoperazone 75 μg 239 cefoparazone+ salbactam 75+30 μg 240 cefotaxime 30 μg 241 cefotetan 30 μg 242 cefoxitin 30 μg 243 cefpirome 30 μg 244 cefpodoxime 10 μg 245 ceftazidime 30 μg 246 ceftriaxone 30 μg 247 cefuroxime 30 μg 248 cephalotin 30 μg 249 chloramphenicol 30 μg 250 ciprofloxacin 5 μg 251 clarithromycin 15 μg 252 clindamycin 2 μg 253 colistin 10 μg 254 doripenem 10 μg 255 doxycycline 30 μg 256 ertapenem 10 μg 257 erythromycine 15 μg 258 fosfomycin 200 μg 259 gentamicin 10 μg 260 gentamicin ( high load ) 120 μg 261 imipenem 10 μg 262 kanamycin 30 μg 263 levofloxacin 5 μg 264 lincomycin 15 μg 265 linezolid 30 μg 266 meropenem 10 μg 267 moxifloxacin 5 μg 268 nalidixic acid 30 μg 269 netilmicin 30 μg 270 nitrofurantoin 300 μg 271 norfloxacin 10 μg 272 ofloxacin 5 μg 273 oxacillin 1 μg 274 penicillin 6 μg / 10iu 275 piperacillin 100 μg 276 piperacillin+tazobactam 100+10 μg 277 polymixin 50 μg / 300 ui 278 quinupristin dalfopristin 15 μg 279 rifampicin 5 μg 280 spectinomycin 100 μg 281 streptomycin 10 μg 282 streptomycin ( high load ) 300 μg 283 teicoplanin 30 μg 284 tetracycline 30 μg 285 ticarcillin 75 μg 286 ticarcillin+clavulanic acid 75+10 μg 287 tigecycline 15 μg 288 tobramycin 10 μg 289 trimethoprim+sulfamethoxazole 1.25+23.75 μg 290 trimethoprim 5 μg 291 vancomycin 30 μg 292 polymyxin b 30 μg 293 elisa kit for hbsag 294 elisa kit for dengue ns 1 295 elisa kit for dengue igm 296 rapid card test dengue ns1 297 elisa kit for chikungunya igm 298 torch nanoplex igg / igm ( nano elisa kit ) 299 aso latex agglutination test 300 crp latex agglutination test 301 ra latex agglutination test 302 widal slide agglutination test 303 rpr test kit 304 vdrl test 305 hbsag card test 306 malaria card test 307 hav igm card test 308 hcvigm card test 309 gram stain 310 acid fast bacilli staining 311 india ink 312 albert stain 313 potassium hydrochloride 314 lectophenol cotton blue 315 lugols iodine 316 nacl crystal 317 stain a and stain b 318 methanol 319 surgical spirit 320 melachite green 321 nigrosine 322 h2so4 323 kmno4 crystal 324 iodine 325 hydrogen peroxide 326 oxidase reagent ( tetramethyl p phenylenediaminedihydochloride ) 327 rabbit plasma 328 kovac’s reagent or ehrlich reagent 329 potassium nitrate ( kno3 ) 330 optochin disc 331 sodium deoxycholate 332 bacitracin disk 333 potassium iodide 334 potassium hydroxide 335 formaldehyde 40% 336 glycerine 337 potassium acetate 338 pyridine 339 sodium hydrosulphite 340 thymol crystal 341 2 propanol 342 xylene 343 paraffin wax 344 pap stain 345 giemsa stain 346 hematoxylene stain 347 eosin stain 348 sodium metabisulphite 349 brilliant cresyl blue 350 leishman stain 351 ethyl alcohol 352 methanol 353 glacial acetic acid 354 dpx 355 cdi tissue marking dyes 356 sodium iodate 357 potassium alum 358 citric acid 359 chloral hydrate 360 1% aq potassiumferrocyanide 361 2% aq. hydrochloric acid 362 turk diluting fluid 363 pandy’s reagent 364 trichloroacetic acid 365 ehrlich’s reagent 366 lugol’s iodine 367 n / 10 hcl 368 semen diluting fluid 369 sulfur powder 370 bovine albumin 371 g6pd reagent 372 cedar wood oil 373 drabkin solution for hb 374 edta powder 375 filter paper sheet 376 fouchets reagent 377 liquid ammonia 378 methylene blue 379 rbc dilution fluid 380 rectified spirit 381 3% acetic acid 382 chlorhexidine 0.5% hand rub 383 fluorescein 384 rhodamine 385 acridine orange 386 salmonella diagnostic antiserum 2ml – 0:2 387 salmonella diagnostic antiserum 2ml – 0:4 388 salmonella diagnostic antiserum 2ml – o:9 389 salmonella diagnostic antiserum 2ml – h d 390 salmonella diagnostic antiserum poly o’ a g 2ml 391 vibrio cholera diagnostic antiserum ogawa 2ml 392 vibrio cholera diagnostic antiserum inaba 2ml 393 vibrio cholera diagnostic antiserum 2ml – poly’o’ 394 shigella boydii antiserum polyvalent 2ml 395 shigella dysenteriae antiserum polyvalent 2ml 396 shigella flexneri antiserum polyvalent 2ml 397 shigella sonnei antiserum polyvalent 2ml 398 desorb u 399 owner koller buffer 400 cacl2 0.025 m 401 cephascreen 402 neoplastine solvent 2 403 listest d di plus ( layex ) 404 listest d di ( buffer ) 405 liquid fib 406 liatest control n 407 neoplastine c1 plus r 2 408 lh lyse m52 409 diff lyse m52 410 diluent m52 411 prob cleaner 412 aspen m 68 diluent 413 aspen m 68 lb lyse 414 aspen m 68 lh lyse 415 aspen m 68 ld lyse 416 aspen m 68 fd dye 417 aspen probe cleaner 418 alfa lyse 419 alfa dilutents...

Madhya Pradesh Power Generating Company Limited - Madhya Pradesh

31599391 procurement of fine chemicals at chemistry laboratory, 2x660 mw, ph ii, sstpp, mppgcl, dongalia procurement of fine chemicals at chemistry laboratory, 2x660 mw, ph ii, sstpp, mppgcl, dongalia , 2 propanol packing size 2.5 l ( detail technical specification as per tender schedule ) , glacial acetic acid packing size 2.5 l ( detail technical specification as per tender schedule ) , hydroxylammonium chloride packing size 100 g ( detail technical specification as per tender schedule ) , sodium hydroxide pellets packing size 500 g ( detail technical specification as per tender schedule ) , ammonium acetate packing size 500 g ( detail technical specification as per tender schedule ) , sodium sulfite packing size 500 g ( detail technical specification as per tender schedule ) , oxalic acid packing size 500 g ( detail technical specification as per tender schedule ) , hydrochloric acid ( 35% ) packing size 5 l ( detail technical specification as per tender schedule ) , test chlor packing size 100 ml ( detail technical specification as per tender schedule ) , kcl standard solution ( 1413 ?s ) packing size 480 ml ( detail technical specification as per tender schedule ) , potassium chloride packing size 500 g ( detail technical specification as per tender schedule ) , universal ph indictaor packing size 500 ml ( detail technical specification as per tender schedule ) , 0.45?m membrane filter paper ( dia. 47mm ) packing size 1 pc. ( 100 in each ) ( detail technical specification as per tender schedule ) , kcl standard solution ( 147 ?s ) packing size 500 ml ( detail technical specification as per tender schedule ) , mercuric iodide red packing size 100 g ( detail technical specification as per tender schedule ) , toluene packing size 2.5 l ( detail technical specification as per tender schedule ) , edta disodium salt packing size 500 g ( detail technical specification as per tender schedule ) , 1, 10 phenanthroline packing size 25 g ( detail technical specification as per tender schedule ) , sodium metabisulfite packing size 1 kg ( detail technical specification as per tender schedule ) , buffer tablets ph 4.0 packing size 1 pc ( 20 tab ) ( detail technical specification as per tender schedule ) , buffer tablets ph 7.0 packing size 1 pc ( 20 tab ) ( detail technical specification as per tender schedule ) , buffer tablets ph 9.0 packing size 1 pc ( 20 tab ) ( detail technical specification as per tender schedule ) , turbidity standard 4000 ntu packing size 100 ml ( detail technical specification as per tender schedule ) ...

Public Health Engineering Department - Madhya Pradesh

31433312 schedule of quantity for supply of chemicals for crm 11 parameters nabl for subdivision laboratory ambah 1 auto zero burette capacity 50 ml with reservior capacity 2000ml 50ml ( ambar ) ( nabl ceritified ) 2 measuring cylinder 25ml ( nabl ceritified ) 3 sample bottle 2 ltr plastic 4 edta solution n / 50 500ml 5 sulphuric acid n / 50 500 ml 6 silver nitrate 0.0141 500 ml 7 nacl 500gram 8 ammonia buffer solution 500ml 9 eriochrome black t indicator 100ml 10 ammonium purpurate 5gram 11 naoh 500ml 12 potassium chromate 100ml 13 1:10 phenon throlime 500ml 14 cons. hcl 500ml 15 sodium acetate 500 ml 16 hydroxyl amine hydro chloride 500ml 17 pda 500ml 18 amonia solution 500ml 19 barium chloride 500gram 20 conditioning reagent 500ml 21 alizarin red zirconyl mix indicator 500ml 22 ammonium per sulphate 500gram 23 cons. sulphuric acid 500ml 24 phonophaline indicator 100ml 25 mixed indicator 100ml 26 o.t. solution 500ml 27 universal indicator 500ml 28 methanol 500 ml 29 m 7 fc agar media 500 gram 30 sodium thiosulphate 500ml 31 nitric acid 500ml 32 ph buffer standard 7.0 500ml bnd 33 ph buffer standard 4.0 500ml, bnd 34 ph buffer standard 9.2 500ml, bnd 35 calcium satandard 1000mg 475ml bnd 36 alkalinity standard 500ml ( sodium carbonate ) , bnd, 0.1 n bnd 37 chloride standard 500mg / lit. , bnd 38 iron standard 475ml , bnd 39 nitrate standard 475ml , bnd 40 fluoride standard 500ml, bnd 41 manganese standard 500ml, bnd 42 sulphate standard 500ml, bnd 43 colour standard 250ml , bnd 44 conductivity standard 475ml bnd 45 turbidity standard 400ntu 500ml , bnd 46 what men filter paper 12.5cm 1pkt 47 membrane filter 0.45 1pkt 48 cottan 500gram 49 burette pump rubber 50 spefula law steel 51 tong steel 52 washing brush 53 tissue paper 1pkt 54 special reagent 500ml 55 glacial acetic acid 500ml 56 tds meter 308 orion systronics, ranges 0.1 ppm to 200 ppt, accuracy ±15 ( nabl ceritified ) 57 hot air oven capacity 71 ltr temp. range rt+20 250 degree c ambient temp. 5 40 degree c inner dimension 450*450*350mm ) 58 thermometer 2.0 degree c, 0 to 360degree c with calibration certificate 59 memran filter assembly 47 mm with pump ( tarson ) 60 water bath 61 laboratory bacteriological incubater 45*45*45cm 90ltr. cube ft. 3 shelves 3 fully ss body temprature range ambient +5 to +90 degree c ( nabl ceritified ) 62 fist aid kit 63 weight box e 2, 23 weight including fractitional weights 200 gm...

Directorate Of Health Services - Madhya Pradesh

31311197 supply for medicine , material, and equipment etc. , tablet and capsuls 1 tablet and capsuls 2 acetazolamide tab ( 250mg ) , tablet 3 acyclovir tab 400 mg ( 400 mg ) , tablet 4 acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet 5 acyclovir ( 800mg ) , tablet 6 albendazole ip ( 400mg ) , tablet 7 alfacalcidiol capsule ( 0.25 mcg ) , capsule 8 alprazolam ( 0.5mg ) , tablet 9 alprazolam ( tab 0.25mg ) , tablet 10 amiodarone ( 100mg tab ) , tablet 11 amlodipin tab ( 5mg ) , tablet. 12 amlodipine ( 10 mg ) , tablet 13 amlodipine ( 2.5mg ) , tablet 14 amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet 15 amoxicillin cap. 250 mg. 16 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg 17 amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet 18 amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet 19 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet 20 amoxycilline ( 500mg ) , capsule 21 ampicillin trihydrate capsules ( 500mg 10x10 ) , capsule 22 anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet ) 23 antioxident ( cap ) , capsule 24 artesunate + sulphadoxine + pyrimethamineip ( age group 15 or above ) ( 200 mg ( 3tab ) + 750 mg ( 2tab ) + 37.5 mg ( 1tab ) ) , combi blister pack 25 artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 year ) ( 50 mg ( 3 tab ) +500 mg ( 1 tab ) +25 mg ( 1 tab ) ) , combi blister pack 26 ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet 27 aspirin low dose 75mg tab 28 atenolol ( 100mg ) , tablet 29 atenolol ( 25 mg ) , tablet 30 atenolol ( 50mg tab ) , tablet 31 atorvastatin ( 10 mg ) , tablet 32 atorvastatin ( 20mg ) , tablet 33 azithromycin ( 250mg ) , tablet 34 azithromycin ( 500mg tab ) , tablet 35 b complex minerals with zinc cap ( ) , capsule 36 betahistine ( 8 mg tab ) , tablet 37 betamethasone ( 0.5 mg ) , tablet 38 bisacodyl ( 5mg tab ) , tablet 39 calcium carbonate ( 500 mg ) , tablet 40 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet 41 carbamazepine ( 200 mg ) , tablet 42 carbimazole ( 10 mg ) , tablet 43 cefadroxil 250 mg tab 44 cefadroxil 500 mg tab 45 cefixime ( 200 mg tab ) , tablet 46 cefixime ( 50 mg dt ) , tablet 47 cefpodoxime 100 mg ( ) , tablet 48 cefpodoxime ( 200 mg ( dispersible tab ) , tablet 49 cefpodoxime ( 50 mg ) , tablet 50 cefuroxime 250 mg, tablet 51 cefuroxime 500 mg, tablet 52 cephalexin dispersible ( 125 mg ) , tablet 53 cephalexine ( 250mg ) , capsule 54 cephalexine ( 500mg ) , capsule 55 cetirizine ( 10 mg ) , tablet 56 chewable antacid tablet 57 chloraxozone + paracetamol ( 250 mg + 500 mg ) tab 58 chloroquine phosphate tab. ( 250mg ) , tablet 59 chlorpromazine hydrochloride ( 25 mg ) , tablet 60 chlorpromazine ( 100 mg ) , tablet 61 chlorpromazine ( 50 mg ) , tablet 62 cinnarizine ( 25 mg ) , tablet 63 ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet 64 ciprofloxacin 500mg + tinidazole 600mg ( ) , tablet 65 ciprofloxacin ( 250mg ) , tablet 66 ciprofloxacin ( 500mg ) , tablet 67 clobazam ( 5 mg ) , tablet 68 clomiphene citrate ( 50 mg tab ) , tablet 69 clonazepam 0.25 mg ( tablet ) , tablet 70 clonazepam ( 0.5mg ) , tablet 71 clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule 72 clopidogrel ( 75 mg ) , tablet 73 clotrimazole ( vaginal tab ) 500 mg ( with applicator ) , tablet 74 cloxacillin capsules 500mg 75 deferasirox dispersible ( 250mg ) , tablet 76 deferasirox dispersible ( 500mg ) , tablet 77 deriphylline tablet ( sustained release ) , tablet 78 dexamethasone ( 0.5mg ) , tablet 79 dexamethasone ( 4 mg ) , tablet 80 diazepam ( 5 mg ) , tablet 81 diclofenac 50mg +seratopeptidase 10mg tab ( 10mg ) , tablet 82 diclofenac sodium + paracetamol +serratiopeptidase 50 mg +325 mg + 10 mg tab 83 diclofenac sodium 50mg + paracetamol 325mg tab 84 diclofenac sodium ( 50 mg ) , tablet 85 diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet 86 dicyclomine hydrochloride ( 20 mg ) , tablet 87 dicyclomine tab. 10mg 88 diethylcarbamazine tab ( 100mg ) , tablet 89 diethylcarbamazine ( 50 mg ) , tablet 90 digoxin tab ( 0.25mg ) , tablet 91 diltiazem ( 30 mg ) , tablet 92 diphenylhydantoin tablet ( 100 mg ) , tablet 93 dispersible zinc tab ( 10mg ) , tablet 94 dispersible zinc ( 20mg ) , tablet 95 divalproex sodium 250 mg tab 96 divalproex sodium 500 mg tab 97 domperidone ( 10mg ) , tablet 98 doxycycline capsule 100mg 99 doxycycline tab. 100mg ( ) , tablet 100 doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet 101 doxylamine succinate ( 10 mg ) , tablet 102 drotaverine ( 40 mg ) , tablet 103 dydrogesterone 10 mg tab 104 each combipack red colour blister pack contains 3tab of artesunate 150mg and 2 tab of sulphadoxine pyrimethamine ( 500mg + 25mg ) ( age group 9 to 14 years ) , tablet 105 enalapril maleate tab ( 2.5mg ) , tablet 106 enalapril maleate tab ( 5mg ) , tablet 107 erythomycin stearate ( 250mg ) , tablet 108 erythromycin stearate ( 500 mg ) , tablet 109 escitalopram 10 mg tab ( 10 mg ) , tablet 110 escitalopram ( 5 mg ) , tablet 111 ethamsylate 250mg tablet 112 etiophylline ( 77 mg ) + theophylline ( 23 mg ) tab 113 etiophylline theophylline sr tab. 300mg ( ) , tablet 114 etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet 115 ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet 116 fluconazole 100 mg tab 117 fluconazole ( 150 mg ) , tablet 118 flunarizine 10 mg tab 119 fluoxetine cap ( 20 mg ) , capsule 120 fluoxetine ( 10 mg ) , tablet or capsule 121 fluphenazine ( 2.5 mg ) , tablet 122 folic acid ip ( 5 mg ) , tablet 123 furazolidone ( 100mg ) , tablet 124 furosemide tab ( 40mg ) , tablet 125 gabapentine ( 100 mg ) , tablet 126 glibenclamide ( 5 mg ) , tablet 127 gliclazide ( 80 mg ) , tablet 128 glimepiride ( 1 mg ) , tablet 129 glimepiride ( 2 mg ) , tablet 130 griseofulvin ( tablet 250 mg ) , tablet 131 haloperidol ( 5mg ) , tablet 132 hydrochlorothiazide tab ( 25 mg ) , tablet 133 hydrochlorthiazide ( 12.5 mg ) , tablet 134 ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet 135 ibuprofen ( 200 mg ) , tablet 136 ibuprofen ( 400mg ) , tablet 137 imipramine ( 25 mg ) , tablet 138 iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg ( blue tablet ) 139 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet 140 iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet 141 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet 142 iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet 143 iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet 144 iron folic acid sugar coated tablet dried ferrous sulphate ip eq. to 45mgferrous iron and 400mcg folic acid ip ( pink coloured tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 45mg + 400mcg ) , tablet 145 isosorbide dinitrate tab ip ( 5mg ) , tablet 146 isosorbide mononitrate ( 20mg ) , tablet 147 isosorbide 5 mononitrate ( tab.20 mg ) , tablet 148 isoxsuprine ( 10mg ) , tablet 149 itraconazole cap ( 100 mg ) , capsule 150 ketoconazole tab 200mg ( ) , tablet 151 labetalol ( 100 mg ) , tablet 152 lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet 153 levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet 154 levofloxacin ( 250mg ) , tablet 155 levofloxacin ( 500mg ) , tablet 156 lithium carbonate ( 300 mg ) , tablet 157 lorazepam 1 mg tab 158 lorazepam ( 2 mg ) , tablet 159 losartan tab 25 tablet 160 losartan ( 50 mg ) , tablet 161 magnesium hydroxide and aluminium hydroxide ( ) , tablet 162 medroxy progesterone acetate 10 mg tab 163 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 164 mefenamic acid + drotaverine hcl 250 mg + 80 mg tab 165 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule 166 metformin + glimepiride 500 mg + 2 mg tab 167 metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet 168 metformin ( 500 mg ) , tablet 169 metformine 500mg + glibenclamide 5mg ( tab ) , tablet 170 methyl ergometrine maleate tab. 0.125mg 171 methyl prednisolone sodium succinate tablet 8 mg 172 methyl prednisolone tab ( 16 mg ) , tablet 173 methyl prednisolone ( 4mg ) , tablet 174 methyl prednisolone ( 8mg ) , tablet 175 methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule 176 methylcobalamin / mecobalamin ( 500 mcg ) , tablet 177 methyldopa tab. 250mg 178 metoclopramide ( 10mg ) , tablet 179 metoprolol ( 50mg ) , tablet 180 metronidazole tab ( 400mg ) , tablet 181 micronised progesterone ( 100 mg ) , tablet 182 micronised progesterone ( 400 mg ) , capsule 183 micronised progestrone ( 200 mg ) , tablet 184 mifepristone ( 200 mg ) , tablet 185 mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet 186 mirtazapine 15 mg ( tablet ) , tablet 187 misoprostol 400 mcgtablets 188 misoprostol ( 200mcg ) , tablet 189 multivitamin sugar coated tab nfi formula multivitamin sugar ( item with additional vitamin will also be considered ) , tablet 412 190 nifedipine ( sublingual ) 10 mg ( ) , capsule 191 nifedipine capsule 5mg cap 192 nifedipine tablets 10mg tab 193 nimesulide +paracetamol ( 100 + 325 mg ) , tablet 194 nimesulide ( 100 mg ) , tablet 195 nitrofruantoin ( 100mg ) , tablet 196 nitroglycerine ( glyceryl trinitrate ) ( sublingual tab 0.5 mg ) , tablet 197 norfloxacin tab. 400mg 198 norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet 199 ofloxacin + ornidazole ( 200mg and 500mg ) , tablet 200 ofloxacin tab 200mg 201 ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet 202 olanzapine 2.5 mg tab 203 olanzapine 7.5 mg tab 204 olanzapine ( 5 mg ) , tablet 205 omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule 206 omeprazole capsule ( 40 mg ) , capsule 207 omeprazole ( 20mg ) , capsule 208 ondansetron tab 4 mg 209 ornidazole tab ( 500 mg ) , tablet 210 pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet 211 pantoprazole tab ( 40 mg ) , tablet 212 paracetamol tab 650 mg ( 650 mg ) , tablet 213 paracetamol ( 500mg ) , tablet 214 penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet 215 pentoprazole 40mg, domperidone 10mg tab tablet 216 phenobarbitone tab. 60 mg ( ) , tablet 217 phenobarbitone ( 30 mg ) , tablet 218 phenobarbitone ( 60 mg tab ) , tablet 219 phenytoin sodium ( 100mg ) , tablet 220 piroxicam ( 20 mg ) , capsule 221 prednisolone tab 20 mg ( dispersible tablet also acceptable ) , tablet 222 prednisolone ( 10 mg ) , tablet 223 prednisolone ( 5mg ) , tablet 224 primaquin ( 2.5mg ) , tablet 225 primaquin ( 7.5mg ) , tablet 226 primaquine ( 15mg ) , tablet 227 promethazine tab ( 25 mg ) , tablet 228 promethazine ( 50 mg ) , tablet 229 propranolol tab ( 10 mg ) , tablet 230 pyridoxine tab 10mg 231 quinine sulphate ( 300mg ) , tablet 232 quinine sulphate ( ip 600mg ) , tablet 233 rabeprazole ( 20 mg ) , tablet 234 ramipril ( 2.5 mg ) , tablet 235 ramipril ( 5 mg ) , tablet 236 ranitidine ( 150mg ) , tablet 237 risperidone ( 2 mg ) , tablet 238 roxithromycin 150mg tablet 239 salbutamol sulphate ( 4mg ) , tablet 240 secnidazole ( 500 mg tab ) , tablet 241 serratiopeptidase 10 mg tab 242 sodium valporate 300 mg tab 243 sodium valproate + valproate 333 mg + 145 mg ( tablet ) , tablet 244 sodium valproate enteric coated tab. bp ( 200 mg ) , tablet 245 sodium valproate ( 200mg ) , tablet 246 sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet 247 sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet 248 sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet 249 sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet 250 tablet paracetamole 250mg 251 telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet 252 telmisatran ( 40 mg ) , tablet 253 thyroxine sodium tab 100 mcgtablet 254 thyroxine sodium tab ( 50mcg ( 100 tab bottle ) ) , tablet 255 tinidazole ( 300 mg ) , tablet 256 tinidazole ( 500mg ) , tablet 257 torasemide tab ( 20mg ) , tablet 258 torasemide ( 10mg ) , tablet 259 tramadol cap ( 50mg ) , capsule 260 tramadol ( 50mg ) , tablet 261 tranexamic acid 500 mg tab tablet 262 trihexyphenidyl ( 2mg ) , tablet 263 verapamil ( 40 mg ip ) , tablet 264 vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule 265 vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule 266 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet 267 vitamin c tab 500 mg tablet 268 vitamin c ( 100 mg ) , tablet 269 vitamin. b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet 270 vitamin. b complex ( nfi ( prophylactic ) tablet 271 vitamin e usp ( 400 mg ) , capsule 272 voglibose ( 0.3mg tab ) , tablet 273 warfarin sodium ( 5 mg ) , tablet 274 zinc dispersible ( 20mg ) , tablet 275 zinc sulphate dispersible ( 10mg ) , tablet 276 zolpidem 10 mg ( tablet ) , tablet 277 syrup 278 albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup 279 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup 280 alkaline citrate with k oral solution ( 100ml ) , syrup 281 ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( 100ml bottle ) , syrup 282 amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , suspension 078 283 ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 284 antacid mint flavour ( 170ml ) , syrup 285 antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup 286 anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup 287 azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , suspension 288 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup 289 bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup 290 calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup 291 calcium syp 100ml syrup ( 240mg / 5 ml ) 292 carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , syrup 293 cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 294 cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension 295 cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup 296 cetirizine syrup ( 5mg / 5ml 30 ml bottle ) , syrup 297 cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup 298 chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension 299 cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) 300 cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup 301 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 302 dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup 303 dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syrup 304 dicyclomine syrup 305 diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup 306 disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup 307 domperidone suspension 1mg / ml ( 30ml bottle ) , suspension 308 drop paracetamol 100mg / 15ml 309 etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup 310 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup 311 ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup 312 iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup 313 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals ( if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. ( as per attached specification ) ( 50ml bottle with auto dispenser ) ) , syrup 314 lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution 315 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup 316 metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup 317 metronidazole 100mg / 5ml ( 30ml ) , syrup 318 metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension 319 milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup 320 multivitamin 200ml syrup 321 multivitamine 100ml syrup ( 100 ml ) , syrup 322 norfloxacin + tinidazole ( ( 100 mg + 100 mg ) 30ml syrup ) , syrup 323 norfloxacin +metronidazole 30ml syrup 324 ofloxacin+ metronidazole ( 30ml ) , syrup 325 ondansetron ( 2mg / 5ml 30ml bottle ) , syrup 326 oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup 327 paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) 328 paracetamol ( 125 mg / ml ) , drop 329 paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml ) syrup 330 phenobarbitone syp 200mg / 5ml ( ) , syrup 331 potassium chloride syrup 200ml ( each ) , syrup 332 promethazine 5 mg / 5ml ( 60 ml bottle ) , syrup 333 quinine sulphate 150mg / 5ml syrup 60 ml 334 salbutamol sulphate ( 2mg / 5ml 60ml ) , syrup 335 salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup 336 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 337 sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 mlsuspension ( 50 ml bottle ) , suspension 338 syp. cefodroxil 125mg / 30ml syrup 339 syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup 340 syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup 341 syrup cefpodoxime 50 mg 342 syrup paracetamole 250mg / ml 343 vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup 344 vitamin b complex nfi formula ( 100ml bottle ) , syrup 345 vitamin b complex nfi formula ( 200ml bottle ) , syrup 346 vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup 347 zinc sulphate 10 mg elemental zinc / 5 ml ( 100 ml bottle ) , syrup 348 zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup 349 inhaler / powder 350 bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) , powder 351 budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension 352 budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler 353 budesonide ( inhalation 200 mcg per dose ) , inhaler 354 charcoal activated ( powder ) ( 100 gm box / pouch ) , oral powder 355 glucose pouch ( 75 gm ) ( powder ( product copp exempted for this item ) ) , powder 356 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder 357 ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l 358 salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler 359 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 360 salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule 361 vitamin d3 granules ( 60000 iu sachet ) , powder 362 injection 363 acyclovir inj ( 250 mg / vial ) , injection 364 acyclovir inj ( 500mg / vial ) , injection solution for 365 adenosine inj 6 mg / 2ml ( 2ml amp ) 366 adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection 367 alpha beta arteether ( 150mg / 2ml ) , injection 368 amikacin ( 100mg / 2ml vial ) , injection 369 amikacin ( 250mg / 2ml ) , injection 370 amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection 371 aminophylline ( 25 mg / ml 10 ml vial ) , injection 372 amiodarone 50mg / ml ( 3ml vial / amp ) , injection 373 amoxicillin + clavulanic acid ( 125 mg + 25 mg / vial ) , injection 374 amoxicillin 250mg + clavulanic acid 50mg inj vial 375 amoxicillin ( 250 mg / vial ) , injection 376 amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection 377 amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection 378 amoxycilline and clavulanic acid inj 379 amphotericin b inj ip ( 50 mg ) , injection 380 ampicillin inj. 250 mg / vial 381 ampicillin ( 1 gm vial ) , injection 382 ampicillin ( 500 mg / vial ) , injection 383 ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection 384 anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection 385 anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for 386 anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection 387 anti rabies vaccine i.p. inj. human ( tissue culture ) for i / d and i / m route 2.5 iu with ( 1ml diluents ) , vial 388 anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection 389 artesunate ( 60 mg / vial ) , injection 390 atracurium besylate ( 10mg / ml inj amp ) , injection 391 atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection 392 atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection 393 azithromycin inj 100mg / 5ml 394 azithromycin ( 500 mg / 5ml inj ) , vial 395 benzathine penicillin ( 6 lakh iu / vial ) , vial 396 benzathine penicilline 12 lac iu / vial vial 397 benzyl penicillin 10lac / vial ( penicillin g ) , injection 398 betamethasone sodium phosphate ( ml contain betamethasone na phosphate equal to 4mg of betame ( 1ml amp ) ) , injection 399 biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection 400 bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp ( 4 ml amp ) , injection 401 bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule 402 bupivacaine hydrochloride inj 0.25% ( 20 ml vial ) ( 20 ml vial ) , injection 403 bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection 404 caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection 405 calcium gluconate ( 10% ( 10 ml vial ) ) , injection 406 calcium leucovorin 50 mg / vial inj 407 carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection 408 carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection 409 cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection 410 cefoperazone 500mg + sulbactam 500mg ( vial ) , injection 411 cefotaxime sodium inj ( 500 mg / vial ) , injection 412 cefotaxime sodium ( 1 gm vial ) , injection 413 cefotaxime sodium ( 250 mg vial ) , injection 414 cefotaxime sodium ( 500 mg / vial ) , injection 415 ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection 416 ceftriaxone inj 500mg vial 417 ceftriaxone ( 1g ) , injection 418 ceftriaxone ( 250mg vial ) , injection 419 ceftriaxone ( 500mg vial ) , injection 420 ceftriaxone+tazobactum 250mg+31.25mg inj ( vial ) , injection solution for 421 ceftrioxone inj.usp ( 1gm / vial ) , injection 422 chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection 423 chlorpheniramine maleate 10mg / ml inj 10 ml vial 424 chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for 425 ciprofloxacin inj 200 mg / 100 ml ( 100 ml ffs bottle ) , injection 426 cloxacillin sodium inj. 500mg 427 dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection 428 dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection 429 dextrose 25% ( 500ml ffs bottle ) , injection 430 dextrose 5% ( 500ml ffs bottle ) , injection 431 dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection 432 dextrose ( 10% inj 500 ml ffs btl ) , injection 433 dextrose ( 25% 100 ml ffs bottle ) , injection 434 diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection 435 diclofenac sodium 25 mg / ml ( 3ml amp ) , injection 436 dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection 437 digoxin 250mcg / ml ( 2ml amp ) , injection 438 dobutamine hcl 50 mg / ml ( 5ml amp ) , injection 439 dobutamine ( 12.5 mg / ml 20 ml vial ) , injection 440 dobutamine ( 50 mg / 5 ml ) , injection 441 dopamine hcl 40 mg / ml ( 5ml amp ) , injection 442 doxorubicin ( lypholozed ) ( 50mg vial ) , injection 443 drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection 444 enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection 445 enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection 446 erythropoietin ( 4000 iu inj vial ) , injection 447 ethamsylate inj ( 250mg ( 2ml amp ) ) , injection 448 etiophylline and theophylline ( 220 mg / 2ml ) , injection 449 fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampoule 450 ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection 451 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection 452 fluphenazine 1 ml amp ( 25 mg / ml ) , injection 453 frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection 454 gentamicin inj ( 40 mg / ml 2 ml amp ) , injection 455 gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection 456 gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection 457 glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for 458 glycopyrolate 0.5% 5ml and neostigmin 2.5 mg / 5 ml injection ( each ) , injection 459 glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection 460 haloperidol inj 5mg / ml ( 1 ml amp ) 461 hcg ( human chorionic gonadotropin ) inj 5000 iu vial 462 heparin inj ( 5000iu / ml 5ml vial ) , injection solution for 463 heparin ( 1000iu / ml 5ml vial ) , injection 464 hepatitis b immunoglobulin im inj 200 iu / vial 465 hepatitis b immunoglobulin ( 100 iu / vial ) , vial 466 human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution for 467 human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection 468 human chorionic gonadotropin inj 5000 iu 1ml amp 469 human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection 470 human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection 471 human normal immunoglobin ( 5gm / 100ml ) , injection 472 hydrocortisone sodium succinate ( 100 mg / vial ) , injection 473 hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection 474 insulin human mixtard inj. 30:70 ( ) , injection solution for 475 insulin soluble inj. 40 iu / ml 476 iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection 477 iron sucrose ( 20 mg ) , injection 478 isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for 479 iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection 480 ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection 481 labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection 482 lidocaine 2% inj. 30 ml vial ( ) , injection solution for 483 lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection 484 lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial 485 lorazepam2 mg / ml1 ml vial 486 magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule 487 magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection 488 mannitol inj. 20% 350ml ffs bottle 489 medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection 490 mephentermine inj 30mg / ml ( 10 ml vial ) , injection 491 meropenem ( 1gm ) , injection 492 meropenem ( 500 mg / vial ) , injection 493 methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection 494 methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vial 495 methyl prednisolone sodium succinate inj. usp 500mg 496 methyl prednisolone sodium succinate inj.1000mg vial 497 metoclopramide inj. 5mg / ml ( 2 ml amp ) 498 metoprolol inj 1 mg / ml ( 5ml vial ) , injection solution for 499 metronidazole 500mg / 100 ml ( 100 ml ffs bottle ) , injection 500 micronised progestrone ( 50 mg / ml 4 ml amp ) , injection 501 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 502 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 503 morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection 504 morphine sulphate inj. ip 15mg / ml 505 multivitamin 10ml amp inj 506 n acetyl cysteine inj 200mg / ml in 10ml amp 507 naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for 508 neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection 509 nitroglycerine inj. usp 25 mg / 5ml ( 5ml amp ) 510 noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection 511 omeprazole 40mg ( vial ) , injection 512 ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection 513 oxytocin 10 iu / ml ( per ampolule ) , injection 514 oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection 515 paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection 516 pentaprazole inj vial ( 40 mg ) , injection 517 pentazocin lactate ( 30mg / ml ( 1 ml amp ) ) , injection 518 pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection 519 phenobarbitone ( 200 mg / ml ) , injection 520 phenytoin sodium inj. 100 mg ( ) , vial 521 phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection 522 phytomenadione injection ( 10 mg / ml ) , injection 523 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection 524 piperacillin + tazobactum ( 4.5 g ) , injection 525 pralidoxime ( pam ) inj. 25 mg / ml ( 20 ml amp / vial ) , injection 526 promethazine inj 25 mg / ml ( 2 ml amp ) ( 2 ml amp ) , injection 527 promethazine ( 50mg ( 25mg / ml ) ) , injection 528 propofol 1% ( 10ml / 5ml 20ml ) , injection 529 quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection 530 quinine sulphate inj. 300mg / ml . 531 rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection 532 rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution for 533 ranitidine ( 50mg / 2ml , 2ml amp ) , injection 534 ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , injection solution for 535 risperidone ( 12.5 mg ) , injection 536 snake venom anti serum ip liquid form ( ) , injection 537 sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule 538 sodium chloride n / 2 injection ip ( 0.45% ) ( 500ml ffs bottle ) , injection 539 sodium thiopentone inj. 0.5 gm powder / vial ( 20ml vial ) 540 sodium thiopentone ( 500mg ) , injection powder for 541 soluble insulin 30% isophane insulin 70% 100 iu inj 542 streptokinase inj 15 lac iu ( vial / amp ) , injection 543 succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection 544 teicoplanin ( 200 mg / vial ) , injection 545 tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection 546 tetanus toxide inj 5ml 547 tetanus toxiod 0.5ml 548 tramadol ( 100mg / ml ( 2 ml amp ) ) , injection 549 tramadol ( 50mg / ml ( 2ml amp ) ) , injection 550 tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection 551 urokinase ( 5 lac iu / vial inj ) , injection powder for 552 vecuronium bromide inj 2mg / ml ( 2ml amp ) 553 vecuronium bromide inj 4mg / ml amp 554 vitamin b complex injection nfi formula 30ml / vial ( 30ml / vial ) , injection 555 vitamin b12 inj 500 mcg / ml ( 30 ml amp ) 556 vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection 557 water for injection 5 ml amp 558 water for injection inj 10 ml amp 559 water for injection ip ( 2 ml amp ) , injection 560 iv fluid 561 ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) 562 dextrose 10% 500ml 563 dextrose 25% 100ml 564 dextrose 25% inj 500ml 565 dextrose 5% 500ml 566 dextrose with saline 5% + 0.9% inj 500ml 567 electrolyte m inj 500ml 568 electrolyte p inj 500ml 569 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection 570 halothane bp 250ml 571 human normal immunoglobin ( 5gm / 100ml ) , injection 572 isoflurane inhalation 573 mannitol inj. 20% 350ml ffs bottle 574 mannitol injection i.p. 20% 100ml bottle 575 normal saline 0.9% 500ml 576 ringer lactate inj iv 500ml 577 sodium chloride 0.9% injection ip 100ml bottle 578 eye drops / ear drops 579 atropine sulphate 1% ( 5 ml vial ) , eye drop 580 atropine sulphate eye drops 1% ( 5 ml vial ) ( 5 ml vial ) , eye drops / ointment 581 atropine sulphate eye ointment ( 1% ) , ointment 582 carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop 583 carboxymethylcellulose ( 5 ml ) , eye drop 584 cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops 585 chloramphenicol 0.5% ( 5ml ) , eye drop 586 chloramphenicol eye ointment 1% ( 4 gram ) , tube 587 chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop 588 ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop 589 ciprofloxacin 0.3% ( 5ml vial ) , eye drop 590 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 591 clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop 592 clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial 593 combo ear drop ( chloramphenicol 5% w / v + clotrimazole 1% + lignocaine hydrochloride 2% ) , ear drop 594 fluconazole eye drop 3 mg / ml ( 10 ml vial ) ( 3 mg ) , eye drop 595 gentamicin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop 596 moxifloxacine eye drop 0.5%w / v 597 ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop 598 ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop 599 ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop 600 timolol maleate eye drop i.p. 0.5 %w / v ( 5 ml vial ) ( 5 ml ) , solution 601 cream / ointment 602 aciclovir 3% ( 5gm tube ) , ointment 603 aciclovir cream 5% ( 5g tube ) ( ) , cream 604 acyclovir 5% ( 5gm ) , ointment or cream 605 atropine sulphate eye ointment 1% ( 3 gm tube ) 606 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream 607 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment 608 benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment 609 benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube 610 betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream 611 betamethasone valerate cream 0.05% ( 15gm tube ) , ointment 612 betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment 613 betamethasone valerate oint / cream ip. 0.12% 614 bisacodyl ( 5 mg ) , suppository 615 calaminelotion ( ( contains per 1000 ml: calamine 150 gm, zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml ) 50 ml bottle ) , lotion 616 cetrimide cream bp ( 0.1% w / w ) , tube 617 cetrimide cream solution 20% concentrative for dilution ( 0.2 mg ) , cream 618 chloramphenicol eye ointment 1% ( 4 gram ) , tube 619 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 620 clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream 621 clotrimazole cream 1% ( 15 gm tube ) , cream 622 clotrimazole i.p. 2%w / w ( 15gm tube ) , cream 623 compound benzoic acid ointment 624 framycetin sulphate 1% cream ( 30 gm tube ) , cream 625 fusidic acid 0.02 ( 15 gm ) , cream 626 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 627 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 628 gamma benzene hexachloride solution / lotion 1% ( ( 100 ml ) ) , bottle 629 gentamycin sulphate 0.1% ( 15gm tube ) , ointment 630 lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) ) , gel 631 miconazole cream i.p. 2% w / w ( 15 gm tube ) , cream 632 mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment 633 neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube 634 permethrin 5% ( 30 gm ) , cream 635 permethrin lotion 5% w / v 60 ml bottle 636 povidone iodine cream 250 gm 637 povidone iodine ointment 5% 15gm tube 638 povidone iodine ointment 5% 250gm jar ( ) , each 639 povidone iodine ointment 5% ( 15gm tube ) , tube 640 povidone iodine vaginal ( 200 mg ) , pessary 641 povidone iodine ( 5% 100 ml ) , solution 642 salicylic acid ointment ( 6% ) , ointment 643 salicylic acid ( 0.02 30 gm ) , ointment 644 silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream 645 silver sulphadiazine cream ( usp 1% w / w 25gm ) , tube 646 soframycin ointmenttube / ointment 647 consumables / disposible material 648 adhesive plasters usp 7.5 cm x 5 mts / roll 649 adhesive roll 1 inch x 5 m / roll 650 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 651 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 652 auto pippets fixed volume 10 micro liters each 653 auto pippets fixed volume 1000 micro liters each 654 auto pippets fixed volume 20 micro liters each 655 benedicts qualitative reagent ( 1x5 lit ) , consumable 656 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 657 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 658 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 659 bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable 660 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 661 blood agar powder ( 500 grm ) , consumable 662 blood bag 100ml 663 blood bag 350ml 664 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 665 blood grouping anti sera a monoclonal 666 blood grouping anti sera a, b and d combo kit monoclonal 667 blood grouping anti sera b monoclonal 668 blood grouping anti sera d monoclonal 669 blood urea reagent kit 670 capillary tube 100 pieces consumable 671 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 672 cholesterol kit end point enzymatic kit 5x20ml 200 test / kit 673 conc hcl ( 1x500 ml = 500 ml ) , consumable 674 cover slip 18 x 18 mm 10gm 675 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 676 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 677 creatinin kit 678 crp kit 1x100 biolab qualitative ) 679 crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable 680 cvc diluent 681 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 682 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 683 digital x ray film 10x12 ( 150 films / pkt ) 684 digital x ray film 11x14 ( 150 films / pkt ) 685 digital x ray film 8x10 ( 150 films / pkt ) 686 disposable appron consumable 687 disposable cap 688 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 689 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 690 disposable needles 22g consumable 691 disposable needles is 10654:2002 26 g ( ) , needle 692 disposable paper gloves size 7 inches consumable 693 disposable paper gloves size 7, 1 / 2 inches consumable 694 disposable plastic appron ( full size ) 695 disposable pricking lancet ( pkt of 100 units ) 696 disposable sharp collection containers 1.5 l 697 disposable sterile gloves size 61 / 2 inches consumable 698 disposable sterile gloves size 7, 1 / 2 inches consumable 699 disposable sterile hypodermic syringe 10ml ( each ) , consumable 700 disposable suction catheter ( size 12 ) , consumable 701 disposable suction catheter ( size 14 ) , consumable 702 disposable surgeon cap ( box of 100 caps ) 703 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 704 disposable syringe with needle ( 2ml each ) , syrings 705 disposable syringe with needle ( 3ml each ) , syrings 706 disposable syringe with needle ( 5ml each ) , needle 707 edta k3 vial each 708 falcon tube 709 field stain a 500ml 710 field stain b 500ml 711 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 712 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 713 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 714 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable 715 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 716 glacial acetic acid ( 2.5 liter ) , consumable 717 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 718 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt 719 glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt 720 glucometer strip ( 1x100 ) 721 glucose kit ( god / pod ) ( 350ml ) , digonstic 722 hand wash liquid 500ml 723 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 724 hcl n / 10 ( 500 ml bottle ) 725 hcv kit card test ( 25 test / kit ) , digonstic 726 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 727 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 728 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 729 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 730 hiv kit card ( 25 test / kit ) 731 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 732 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 733 ice gel pack 734 kellys pad disposable 735 leishman stain 500 ml 736 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 737 methyline blue ( 100 ml ) , solution 738 micro pipet 1000 fix and variable each 739 micropiptte 100 1000 740 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 741 n 95 mask ( as per attached specification ) , consumable 742 nebulization mask kit ( pediatrics ) 743 nebulization mask kit ( adult ) 744 new born baby kit [ 4 piece set ] 745 oxygen mask adult ( standard size ) 746 oxygen mask paediatric ( standard size ) 747 paraffin strip roll 748 pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable 749 ra factor 50 test kit qualicative 750 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 751 sputum cup 752 test tube 12 x 100 ( medicm size ) 100 / pkt 753 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 754 test tube 15x125 755 thermacol box 756 three layer surgical mask 757 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 758 tips for auto pippetes 10 to 100 micro litres 759 tissue paper roll ( each ) , consumable 760 tourniquetbelt 761 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 762 typhoid test card. 763 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 764 umbical cord clamps plastic material ( box of 100 clamps ) , consumable 765 urine albumin & suger 766 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 767 usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable 768 vdrl ( rpr ) 1x100 sd strip 769 vdrl kit ( strip ) ( 50 test / kit ) , consumable 770 zipper polybag 771 surgical spirit ( 100ml ) , bottle...

Public Health Engineering Department - Madhya Pradesh

31147814 schedule of quantity for supply of chemicals for crm 11 parameters nabl for subdivision laboratory ambah and sabalgarh distt morena 1 auto zero burette capacity 50 ml with reservior capacity 2000ml 50ml ( white colour ) ( nabl ceritified ) 2 auto zero burette capacity 50 ml with reservior capacity 2000ml 50ml ( ambar ) ( nabl ceritified ) 3 pipette 10ml ( nabl ceritified ) 4 pipette 20ml ( nabl ceritified ) 5 pipette 50ml ( nabl ceritified ) 6 measuring cylinder 10ml ( nabl ceritified ) 7 measuring cylinder 25ml ( nabl ceritified ) 8 measuring cylinder 50ml hexagonal ( nabl ceritified ) 9 measuring cylinder graduate 100ml ( nabl ceritified ) 10 measuring cylinder 500ml ( nabl ceritified ) 11 pipette controller plastic graduate 10ml 12 pipette controller plastic graduate 20ml 13 pipette controller plastic graduate 50ml 14 petry disk 0.47ml 15 conical flask 250ml 16 conical flask 400ml 17 beaker 100ml 18 beaker 400ml 19 beaker 2000ml 20 beaker 2000ml 21 reagent bottle 100ml ( fshm ) 22 reagent bottle 250ml ( fshm ) 23 reagent bottle 500ml ( fshm ) 24 pipette graduate 1ml ( nabl ceritified ) 25 volumetric flask 100ml ( nabl ceritified ) 26 funnel 4 dia 27 nesselar cylinder 100ml 28 gooch crucibal 30ml 2.1 or 2.4 ( nabl ceritified ) 29 sintered disk g 5 1 2 ( nabl ceritified ) 30 sample bottle 2 ltr plastic 31 sample bottle 4 ltr plastic 32 beaker 250ml 33 glass beeds 500 gram 34 glass rod 4 50pkt 35 pipette 5ml ( nabl ceritified ) 36 reagent bottle 125 ml 37 beaker 50ml 38 beaker 200ml 39 bod bottle 300 ml 40 bod bottle 500 ml 41 reagent bottle 2000ml 42 test tube 50x150 43 test tube 50x100 1 edta solution n / 50 ml 2 sulphuric acid n / 50 500 ml 3 silver nitrate 0.0141 500 ml 4 nacl 500gram 5 ammonia buffer solution 500ml 6 eriochrome black t indicator 100ml 7 ammonium purpurate 5gram 8 naoh 500ml 9 potassium chromate 100ml 10 1:10 phenon throlime 500ml 11 cons. hcl 500ml 12 sodium acetate 500 ml 13 hydroxyl amine hydro chloride 500ml 14 pda 500ml 15 ammonia solution 500 ml 16 barium chloride 500gram 17 conditioning reagent 500ml 18 alizarin red zirconyl mix indicator 500ml 19 ammonium per sulphate 500gram 20 cons. sulphuric acid 500ml 21 phonophaline indicator 100ml 22 mixed indicator 100ml 23 o.t. solution 500ml 24 universal indicator 500ml 25 methanol 500 ml 26 m 7 fc agar media 500 gram 27 sodium thiosulphate 500ml 28 nitric acid 500ml 29 ph buffer standard 7.0 500ml nist 30 ph buffer standard 4.0 500ml, nist 31 ph buffer standard 9.2 500ml, nist 32 calcium satandard 2000mg 475ml nist 33 alkalinity standard 500ml ( sodium carbonate ) , nist, 0.1 n nist 34 chloride standard 500mg / lit. , nist 35 iron standard 475ml , nist 36 nitrate standard 475ml , nist 37 fluoride standard 500ml, nist 38 manganese standard 500ml, nist 39 sulphate standard 500ml, nist 40 colour standard 250ml , nist 41 turbidity standard 400ntu 500ml , nist 42 what men filter paper 12.5cm 1pkt 43 membrane filter 0.45 1pkt 44 cottan 500gram 45 burette pump rubber 46 spefula law steel 47 tong steel 48 washing brush 49 tissue paper 1pkt 50 paper acid washed 2 2.5 cm 51 distilled water iron free 52 conductivity standard 475ml nist 53 special reagent 500ml 54 glacial acetic acid 500ml 1 turbidity meter meter model no. 135 systronics, 4 ranges 0 1, 0 10, 0 100, 0 2000 , orion ( nabl ceritified ) 2 ph meter model no. 362 orion systronics, ranges 0 14, resolution 0.001, accuracy ±0.002 ph, ( nabl ceritified ) 3 tds meter 308 orion systronics, ranges 0.1 ppm to 200 ppt, accuracy ±15 ( nabl ceritified ) 4 conductivity meter 304 orion systronics, ranges 0.1 micromhose to 200 ms ( nabl ceritified ) 5 spectrophotometer 166 systronics ( nabl ceritified ) 6 oven ( hot air ) 12”x12” 7 auto clave 14”x22” 8 distillation plant 9 fridge 10 sample fridge ( with temperature 0 80 c ) ( nabl ceritified ) 11 memran filter assembly 47 mm with pump ( tarson ) 12 water bath 13 incubater bod ( nabl ceritified ) 14 hot plate 15 electronic balance lc 0.1mg, 200 gm capacity ( nabl ceritified ) 16 hydrometer range 1 2 point gradation ( nabl ceritified ) 17 hygrometer, for humidity and temperature range 0 100% ( nabl ceritified ) 18 digital therm meter ( nabl ceritified ) 19 apron 20 google 21 fist aid kit 22 weight box e 2, 23 weight including fractitional weights 200 gm 23 vaccum desicator 250 mm with cover borosil ( nabl ceritified ) ...

Madhya Pradesh Power Generating Company Limited - Madhya Pradesh

31042486 procurement of fine chemicals at chemistry laboratory, 2x660 mw, ph ii, sstpp, mppgcl, dongalia p 1 2 propanol ( packing size 2.5 l ) 2 glacial acetic acid ( packing size 2.5 l ) 3 hydroxylammonium chloride ( packing size 100 g ) 4 sodium hydroxide pellets ( packing size 500 g ) 5 ammonium acetate ( packing size 500 g ) 6 sodium sulfite ( packing size 500 g ) 7 oxalic acid ( packing size 500 g ) 8 hydrochloric acid ( 35% ) ( packing size 5 l ) 9 test chlor ( packing size 100 ml ) 10 kcl standard solution ( 1413 μs ) ( packing size 480 ml ) 11 potassium chloride ( packing size 500 g ) 12 universal ph indictaor ( packing size 500 ml ) 13 0.45μm membrane filter paper ( dia. 47mm ) ( packing size 1 pc. ( 100 in each ) ) 14 kcl standard solution ( 147 μs ) ( packing size 500 ml ) 15 mercuric iodide red ( packing size 100 g ) 16 toluene ( packing size 2.5 l ) 17 edta disodium salt ( packing size 500 g ) 18 1, 10 phenanthroline ( packing size 25 g ) 19 sodium metabisulfite ( packing size 1 kg ) 20 buffer tablets ph 4.0 ( packing size 1 pc ( 20 tab ) ) 21 buffer tablets ph 7.0 ( packing size 1 pc ( 20 tab ) ) 22 buffer tablets ph 9.0 ( packing size 1 pc ( 20 tab ) ) 23 turbidity standard 4000 ntu ( packing size 100 ml ) ...

Department of Higher Education - Madhya Pradesh

30982231 bids are invited for ferocyanide , glacial acetic acid , glucose , ferroussulphate , calcium sulphate , hydrochloric acid ( dilute ) , hydrochloric acid ( conc. ) , hydroxyl amine , isoproponol , formic acid , iodoform , iodine crystal , iodine solution , dinitro benzene , isopropyl alcohol , iron particles , charkol , lead oxide , liquid ammona , lead acetate solution , meryric chloride , meta dinipobenzene , methyl orangeinclicator , methyl alcohol , methyl acetate , magnesiumcrystal , manganese dioxide , magnisium carbonate ( mgco3 ) , methyl oxalate , mercuric nitrate , nitric acid ( cone ) , nitric acid ( dil. ) , 2.4 dinitrophenylhydrazine , naphthoi , b naphthol , nitro benzene , nickel choride , oxalic acid , potessium hydroxide , potassium todide , phenolphthalein indicator , phenol , potassium permagnate , prcaic acid , pthadic acid , potassium dichoomate , potassium nipate , resorcinol , raney nickel , stannouschloride , strontium choride , sodium metal , sulphuric acid ( conc. ) , sulphuric aud ( dilute ) , sodium nitropruside , sodium nitropate , sodium hydroxide , salicylic acid , silicon, silver , salt of lead , sodium bicarbonate , shiff reagent , sodium sulphate , sodium nitrite , succinic acid , succinicanhydride , starch , sodium hypochlorite , silica gel , sodium thiosulphate , phthalic anhydride , seric ammoniumnitrate , thiourea , tartearic acid , tissue paper , trinitrobenzene , toluene , tollen reagents , sodiumchloride , urea , sucrose , watch glass ( 3?&4 ) , testtube holder , funnel ( glass ) , flask ( 250ml ) , flask ( 100ml ) , flask ( 50 ml ) , conical flask ( 250 ml ) , conical flask ( 20 ml ) , conical flask ( 50 ml ) , testtube ( 10ml ) , reagent bottle ( 100ml ) , reagent bottle ( 50ml ) , beaker ( 100ml ) , beaker ( 250 ml ) , beaker ( 500ml ) , test tube holder , beaker ( 50ml ) , beaker ( 20ml ) 2 / 112ml ) , test tube holder , beaker ( 50ml ) , beaker ( 20ml ) total quantity : 80622...

Directorate Of Health Services - Madhya Pradesh

30887701 supply of drugs surgical sutures materials equipment etc supply of drugs surgical sutures materials equipment etc , tablet , acetazolamide tab ( 250mg ) , tablet , acyclovir tab 400 mg ( 400 mg ) , tablet , acyclovir ( 800mg ) , tablet , albendazole tablets ip 400mg , alprazolam ( 0.5mg ) , tablet , aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethecon ( tab 300 mg+50mg + 25 mg+25 mg ) , tablet , amlodipin tab ( 5mg ) , tablet , amlodipine ( 10mg ) , tablet , amlodipine ( 2.5mg ) , tablet , amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet , amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet , amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet , amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet , antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp , anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet , aspirin low dose 75mg tab , atenolol ( 100mg ) , tablet , atenolol ( 25 mg ) , tablet , atorvastatin ( 10 mg ) , tablet , atorvastatin ( 20mg ) , tablet , atorvastatin ( 40mg ) , tablet , atorvastatin ( 5 mg ) , tablet , carbamazepine ( sr ) 100 mg tab , carbamazepine tab ( 400mg ) , tablet , carbamazepine ( 200 mg ) , tablet , cefadroxil 250 mg tab , cefadroxil 500 mg tab , cefixime ( 50 mg dt ) , tablet , cefpodoxime 100 mg ( ) , tablet , cefpodoxime ( 200 mg ( dispersible tab ) ) , tablet , cefpodoxime ( 50 mg ) , tablet , cefuroxime 250 mg, tablet , cefuroxime 500 mg, tablet , cephalexin dispersible ( 125 mg ) , tablet , cetirizine ( 10 mg ) , tablet , chewable antacid containing magnesium hydroxide minimum 250mg to 500mg+aluminimum hydroxide minimum 250mg to 500mg +simethecon / dimethicon minimum 25mg to 50mg tab ( additional component will also be accept ) , tablet , chloraxozone + paracetamol 250 mg + 500 mg tab , chlorpromazine hydrochloride ( 25 mg ) , tablet , chlorpromazine ( 50 mg ) , tablet , cinnarizine ( 25 mg ) , tablet , ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet , ciprofloxacin 500mg + tinidazole 600mg ( ) , tablet , clobazam ( 5 mg ) , tablet , clobazam ( 10 mg ) , tablet , clonazepam 0.25 mg ( tablet ) , tablet , clonazepam ( 1 mg ) , tablet , clopidogrel ( 75 mg ) , tablet , deferasirox dispersible ( 250mg ) , tablet , deferasirox dispersible ( 500mg ) , tablet , dexamethasone ( 0.5mg ) , tablet , dexamethasone ( 4 mg ) , tablet , diazepam ( 5 mg ) , tablet , diclofenac 50mg +seratopeptidase 10mg tab ( 10mg ) , tablet , diclofenac sodium + paracetamol +serratiopeptidase 50 mg +325 mg + 10 mg tab , diclofenac sodium 50mg + paracetamol 325mg tab , diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet , dicyclomine hydrochloride ( 20 mg ) , tablet , diethylcarbamazine tab ( 100mg ) , tablet , diethylcarbamazine ( 50 mg ) , tablet , digoxin tab 0.25mg ( 25x10 ) , tablet , dilitiazem tablets i.p. 30 mg , diltiazem tablet ( 60 mg ) , tablet , dispersible zinc tab ( 10mg ) , tablet , dispersible zinc ( 20mg ) , tablet , disulfiram 250 mg tab , divalproex sodium 250 mg tab , divalproex sodium 500 mg tab , divalproex sodium 750 mg tab , domperidone ( 10mg ) , tablet , doxycycline tab. 100mg ( ) , tablet , doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet , doxylamine succinate ( 10 mg ) , tablet , drotaverine ( 40 mg ) , tablet , drotaverine ( 80 mg ) , tablet , dydrogesterone 10 mg tab , enalapril maleate tab ( 5mg ) , tablet , erythomycin stearate ( 250mg ) , tablet , erythromycin stearate ( 500 mg ) , tablet , escitalopram 10mg tablet ( 10x10 ) , tablet , escitalopram ( 20 mg ) , tablet , escitalopram ( 5 mg ) , tablet , ethamsylate 250mg tablet , ethamsylate tab 250 mg ( ) , tablet , etiophylline theophylline sr tab. 300mg ( ) , tablet , etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet , ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg tablet , fluconazole 100 mg tab , fluconazole ( 150 mg ) , tablet , flunarizine 10 mg tab , fluphenazine ( 2.5 mg ) , tablet , folic acid ip ( 5 mg ) , tablet , furazolidone ( 100mg ) , tablet , gabapentine ( 100 mg ) , tablet , glibenclamide ( 5 mg ) , tablet , gliclazide ( 80 mg ) , tablet , griseofulvin ( tablet 250 mg ) , tablet , haloperidol ( 5mg ) , tablet , hydrochlorthiazide ( 12.5 mg ) , tablet , ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet , ibuprofen ( 200 mg ) , tablet , ibuprofen ( 400mg ) , tablet , iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg ( blue tablet ) , iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet , iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet , iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet , isosorbide mononitrate ( 20mg ) , tablet , isosorbide 5 mononitrate ( tab.20 mg ) , tablet , isoxsuprine ( 10mg ) , tablet , ketoconazole tab 200mg ( ) , tablet , labetalol ( 100 mg ) , tablet , lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet , levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet , levofloxacin ( 250mg ) , tablet , levofloxacin ( 500mg ) , tablet , lorazepam 1 mg tab , lorazepam ( 2 mg ) , tablet , losartan tab 25 mg ( 10x10 ) , tablet , losartan ( 50 mg ) , tablet , magnesium hydroxide and aluminium hydroxide ( ) , tablet , medroxy progesterone acetate 10 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl 250 mg + 80 mg tab , metformin + glimepiride 500 mg + 2 mg tab , metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet , metformin ( 500 mg ) , tablet , metformine 500mg + glibenclamide 5mg ( tab ) , tablet , methyl prednisolone sodium succinate tablet 8 mg , methyl prednisolone tab ( 16 mg ) , tablet , methyl prednisolone ( 4mg ) , tablet , methyl prednisolone ( 8mg ) , tablet , methylcobalamin / mecobalamin ( 500 mcg ) , tablet , metoclopramide ( 10mg ) , tablet , metoprolol ( 50mg ) , tablet , metronidazole tab ( 400mg ) , tablet , micronised progesterone ( 100 mg ) , tablet , micronised progestrone ( 200 mg ) , tablet , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet , mirtazapine 15 mg ( tablet ) , tablet , misoprostol 400 mcg 4 tablets / strip , misoprostol ( 200mcg ) , tablet , nifedipine tablets 10mg tab , nimesulide +paracetamol ( 100 + 325 mg ) , tablet , nimesulide ( 100 mg ) , tablet , nitrofruantoin ( 100mg ) , tablet , norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet , ofloxacin + ornidazole ( 200mg and 500mg ) , tablet , ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet , olanzapine 2.5 mg tab , olanzapine 7.5 mg tab , olanzapine ( 5 mg ) , tablet , ornidazole tab ( 500 mg ) , tablet , pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet , pantoprazole tab ( 40 mg ) , tablet , paracetamol tab 650 mg ( 650 mg ) , tablet , paracetamol ( 500mg ) , tablet , penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet , pentoprazole 40mg, domperidone 10mg tab tablet , phenobarbitone tab. 60 mg ( ) , tablet , phenobarbitone ( 30 mg ) , tablet , phenytoin sodium ( 100mg ) , tablet , prednisolone ( 10 mg ) , tablet , prednisolone ( 5mg ) , tablet , primaquin ( 2.5mg ) , tablet , primaquin ( 7.5mg ) , tablet , promethazine tab ( 25 mg ) , tablet , promethazine ( 50 mg ) , tablet , propranolol tab ( 10 mg ) , tablet , quinine sulphate ( 300mg ) , tablet , quinine sulphate ( ip 600mg ) , tablet , rabeprazole ( 20 mg ) , tablet , ramipril ( 2.5 mg ) , tablet , ramipril ( 5 mg ) , tablet , ranitidine ( 150mg ) , tablet , roxithromycin 150mg tablet , salbutamol sulphate ( 4mg ) , tablet , secnidazole ( 500 mg tab ) , tablet , serratiopeptidase 10 mg tab , sodium valporate 300 mg tab , sodium valproate + valproate 333 mg + 145 mg ( tablet ) , tablet , sodium valproate enteric coated tab. bp ( 200 mg ) , tablet , sodium valproate ( 200mg ) , tablet , sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet , sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet , sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet , sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet , telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet , telmisatran ( 40 mg ) , tablet , thyroxine sodium tab 100 mcg ( 100 tab bottle ) ( 100 tab ) , tablet , tinidazole ( 300 mg ) , tablet , tinidazole ( 500mg ) , tablet , torasemide tab ( 20mg ) , tablet , torasemide ( 10mg ) , tablet , tramadol ( 50mg ) , tablet , tranexamic acid 500 mg tab tablet , verapamil ( 40 mg ip ) , tablet , vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet , vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet , vitamin c tab 500 mg tablet , vitamin. b complex ( nfi ( prophylactic ) ) , tablet , voglibose ( 0.3mg tab ) , tablet , warfarin sodium 5 mg ( 5 mg ) , tablet , zinc sulphate dispersible ( 10mg ) , tablet , capsule , alfacalcidiol capsule ( 0.25 mcg ) , capsule , amoxicillin cloxacillin and lactic acid bacillus capsules 250mg , amoxycilline ( 500mg ) , capsule , ampicillin trihydrate ( 500mg ) , capsule , antioxident ( cap ) , capsule , b complex minerals with zinc cap ( ) , capsule , cephalexine ( 250mg ) , capsule , cephalexine ( 500mg ) , capsule , clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule , cloxacillin capsules 500mg , doxycycline ( 100 mg ) , capsule , itraconazole cap ( 100 mg ) , capsule , mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule , methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule , micronised progesterone ( 400 mg ) , capsule , nifedipine ( sublingual ) 10 mg ( ) , capsule , nifedipine capsule 5mg cap , omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule , omeprazole capsule ( 40 mg ) , capsule , omeprazole ( 20mg ) , capsule , piroxicam ( 20 mg ) , capsule , tramadol cap ( 50mg ) , capsule , vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule , vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule , vitamin e usp ( 400 mg ) , capsule , syrup , albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup , alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup , alkaline citrate with k oral solution ( 100ml ) , syrup , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( 100ml bottle ) , syrup , ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup , ampicilline 125mg / 30ml syrup , antacid mint flavour ( 170ml ) , syrup , antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup , anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup , bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup , bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup , calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup , calcium syp 100ml syrup ( 240mg / 5 ml ) , carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , syrup , cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup , cefixime syrup 50mg / 5ml ( 30 ml bottle ) , syrup , cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup , cetirizine syrup ( 5mg / 5ml 30 ml bottle ) , syrup , cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup , chloroquine phosphate ( ) , syrup , cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) , cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup , dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup , dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup , dextromethorphan syrup ( ) , syrup , dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syrup , dicyclomine syrup , diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup , disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup , drop paracetamol 100mg / 15ml , etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup , ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup , ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup , iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup , iron syrup 200 ml ( elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg / 5 ml ) , consumable , magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup , metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup , metronidazole 100mg / 5ml ( 30ml ) , syrup , milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup , multivitamin 200ml syrup , multivitamine 100ml syrup ( 100 ml ) , syrup , norfloxacin + tinidazole ( ( 100 mg + 100 mg ) 30ml syrup ) , syrup , norfloxacin +metronidazole 30ml syrup , ofloxacin+ metronidazole ( 30ml ) , syrup , ondansetron syrup 2mg / ml , ondansetron ( 2mg / 5ml 30ml bottle ) , syrup , oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) , paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml ) syrup , phenobarbitone syp 200mg / 5ml ( ) , syrup , potassium chloride syrup 200ml ( each ) , syrup , quinine sulphate 150mg / 5ml syrup 60 ml , salbutamol sulphate ( 2mg / 5ml 60ml ) , syrup , salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup , syp. cefodroxil 125mg / 30ml syrup , syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup , syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup , syrup cefpodoxime 50 mg , vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup , vitamin b complex nfi formula ( 100ml bottle ) , syrup , vitamin b complex nfi formula ( 200ml bottle ) , syrup , vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup , zinc sulphate 10 mg elemental zinc / 5 ml ( 100 ml bottle ) , syrup , zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup , inhaler / powder , budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler , budesonide ( inhalation 200 mcg per dose ) , inhaler , salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule , ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l , vitamin d3 granules ( 60000 iu sachet ) , powder , injection , acyclovir inj 250 mg / vial , acyclovir inj ( 500mg / vial ) , injection solution for , adenosine inj 6 mg / 2ml ( 2ml amp ) , adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection , alpha beta arteether ( 150mg / 2ml ) , injection , amikacin ( 100mg / 2ml vial ) , injection , amikacin ( 250mg / 2ml ) , injection , amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection , aminophylline ( 25 mg / ml 10 mg vial ) , injection , amiodarone 50mg / ml ( 3ml vial / amp ) , injection , amoxicillin + clavulanic acid ( 125 mg + 25 mg / vial ) , injection , amoxicillin 250mg + clavulanic acid 50mg inj vial , amoxicillin ( 250 mg / vial ) , injection , amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection , amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection , amoxycilline and clavulanic acid inj , amphotericin b inj ip ( 50 mg ) , injection , ampicillin inj. 250 mg / vial , ampicillin ( 1 gm vial ) , injection , ampicillin ( 500 mg / vial ) , injection , ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection , anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection , anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for , anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection , anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection , artesunate ( 60 mg / vial ) , injection , atracurium besylate ( 10mg / ml inj amp ) , injection , atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection , atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection , azithromycin inj 100mg / 5ml , azithromycin ( 500 mg / 5ml inj ) , vial , benzyl penicillin 10lac / vial ( penicillin g ) , injection , betamethasone sodium phosphate ( ml contain betamethasone na phosphate equal to 4mg of betame ( 1ml amp ) ) , injection , biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection , biphasic isophane insulin ( 30 / 70 40iu / ml ( 10 ml vial ) ) , injection , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp ( 4 ml amp ) , injection , bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule , bupivacaine hydrochloride inj 0.25% ( 20 ml vial ) ( 20 ml vial ) , injection , caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection , calcium chloride inj. ( ) , injection solution for , calcium gluconate ( 10% ( 10 ml vial ) ) , injection , calcium leucovorin 50 mg / vial inj , carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection , carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection , cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection , cefoperazone 500mg + sulbactam 500mg ( vial ) , injection , cefotaxime sodium inj ( 500 mg / vial ) , injection , cefotaxime sodium ( 1 gm vial ) , injection , cefotaxime sodium ( 250 mg vial ) , injection , ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection , ceftriaxone inj 500mg vial , ceftriaxone ( 1g ) , injection , ceftriaxone ( 250mg vial ) , injection , ceftriaxone+tazobactum 250mg+31.25mg inj ( vial ) , injection solution for , ceftrioxone inj.usp ( 1gm / vial ) , injection , chlorpheniramine maleate 10mg / ml inj 10 ml vial , chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for , cloxacillin sodium inj. 500mg , dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection , diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection , diclofenac sodium 25 mg / ml ( 3ml amp ) , injection , dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection , digoxin 250mcg / ml ( 2ml amp ) , injection , dobutamine hcl 50 mg / ml ( 5ml amp ) , injection , dobutamine ( 12.5 mg / ml 20 ml vial ) , injection , dobutamine ( 50 mg / 5 ml ) , injection , dopamine hcl 40 mg / ml ( 5ml amp ) , injection , doxorubicin ( lypholozed ) ( 50mg vial ) , injection , drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection , enoxaparin ( 20mg / 0.2ml ) ( 0.2 ml prefilled syringe ) , injection , enoxaparin sodium 40mg ( 20mg / 0.2ml ) prefilled syringe inj ( ) , syrings , enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection , enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection , erythropoietin ( 4000 iu inj vial ) , injection , ethamsylate inj ( 250mg ( 2ml amp ) ) , injection , etiophylline and theophylline ( 220 mg / 2ml ) , injection , fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampoule , ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection , fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection , gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection , gentamicin inj. 40 mg / ml, 2ml amp , gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection , glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for , glycopyrolate 0.5% 5ml and neostigmin 2.5 mg / 5 ml injection ( each ) , injection , glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) ( 1 ml amp ) , injection solution for , haloperidol inj 5mg / ml ( 1 ml amp ) , hcg ( human chorionic gonadotropin ) inj 5000 iu vial , heparin inj ( 5000iu / ml 5ml vial ) , injection solution for , heparin ( 1000iu / ml 5ml vial ) , injection , hepatitis b immunoglobulin im inj 200 iu / vial , human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution for , human chorionic gonadotropin inj 5000 iu 1ml amp , human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection , human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection , human normal immunoglobin ( 5gm / 100ml ) , injection , hydrocortisone inj 100 mg / vial ( ) , injection , hydrocortisone sodium succinate inj. 200mg vial ( ) , injection , hydrocortisone sodium succinate ( 100 mg / vial ) , injection , hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection , inj.iv dns ( ) , injection , insulin biphasic / premix 50:50 ( 100 iu / ml ( 10 ml vial ) ) , injection , insulin biphasic / premix 50:50 ( 40 iu / ml ( 10 ml vial ) ) , injection , insulin human mixtard inj. 30:70 ( ) , injection solution for , insulin soluble inj. 40 iu / ml , iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection , iron sucrose ( 20 mg ) , injection , isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for , iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection , ketamine hydrochloride inj. 50mg / ml ( 2 ml amp ) , ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection , ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection , labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection , lidocaine 2% inj. 30 ml vial ( ) , injection solution for , lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection , magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule , magnesium suplhate injection i.p.50 % w / v 10ml amp , magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection , medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection , mephentermine inj 30mg / ml ( 10 ml vial ) , injection , meropenem ( 1gm ) , injection , meropenem ( 500 mg / vial ) , injection , methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection , methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vial , methyl prednisolone sodium succinate inj. usp 500mg , methyl prednisolone sodium succinate inj.1000mg vial , metoclopramide inj. 5mg / ml ( 2 ml amp ) , metoprolol inj 1 mg / ml ( 5ml vial ) , injection solution for , micronised progestrone ( 50 mg / ml 4 ml amp ) , injection , midazolam ( 1mg / ml ( 10ml vial / amp ) ) , injection , midazolam ( 1mg / ml ( 5ml amp ) ) , injection , morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection solution for , morphine sulphate inj. ip 15mg / ml , multivitamin 10ml amp inj , n acetyl cysteine inj 200mg / ml in 10ml amp , naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for , neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection , nitroglycerine inj. usp 25 mg / 5ml ( 5ml amp ) , noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection , noraderanaline inj. 2 mg base / 2 ml amp , omeprazole 40mg ( vial ) , injection , ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection , oxytocin 10 iu / ml ( per ampolule ) , injection , oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection , pantaprazole ( 40mg ) , injection , paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection , pentaprazole inj vial ( 40 mg ) , injection , pentazocin lactate ( 30mg / ml ( 1 ml amp ) ) , injection , pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection , phenobarbitone ( 200 mg / ml ) , injection , phenytoin sodium 250 mg / 5 ml ( 5ml vial ) , injection , phenytoin sodium inj. 100 mg ( ) , vial , phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection , piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection , piperacillin + tazobactam 2000 mg + 250 mg 20ml vial ( ) , injection , piperacillin + tezobactin ( 4.5 g ) , injection , potassium chloride inj. 150 mg / 10ml , pralidoxime ( pam ) inj. 25 mg / ml ( 20 ml amp / vial ) , injection , promethazine inj 25 mg / ml ( 2 ml amp ) ( 2 ml amp ) , injection , propofol 1% ( 10ml / 5ml 20ml ) , injection , quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection , quinine sulphate inj. 300mg / ml . , rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection , rabies vaccine inj ( vero cell culture ) inj. intra dermal ( ) , vial , rabies vaccine ip human ( ( cell culture ) ) , injection solution for , rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution for , ranitidine ( 50mg / 2ml , 2ml amp ) , injection , snake venom anti serum ip liquid form ( ) , injection , sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule , sodium thiopentone ( 500mg ) , injection powder for , soluble insulin 30% isophane insulin 70% 100 iu inj , streptokinase inj 15 lac iu ( vial / amp ) , injection , streptokinase inj ( ) , injection solution for , succinyl choline inj. 50mg / ml 1ml amp , succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection , teicoplanin ( 200 mg / vial ) , injection , tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection , tetanus toxide inj 5ml ( ) , injection solution for , tetanus toxiod ( inj. ) , injection , tetanus toxoid ( adsorbed ) ip ( 5ml vial ) , injection , tramadol ( 100mg / ml ( 2 ml amp ) ) , injection , tramadol ( 50mg / ml ( 2ml amp ) ) , injection , tranexamic acid inj. 125mg / ml amp , tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection , urokinase ( 5 lac iu / vial inj ) , injection powder for , vancomycin hydrochloride ( 1000mg vial ) , injection , vecuronium bromide inj 2mg / ml ( 2ml amp ) , vecuronium bromide inj 4mg / ml amp , vitamin b complex injection nfi formula 30ml / vial ( 30ml / vial ) , injection , vitamin b12 inj 500 mcg / ml ( 30 ml amp ) , vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection , water for injection 5 ml amp , water for injection inj 10 ml amp , water for injection ip ( 2 ml amp ) , injection , iv fluid , ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) , dextrose 10% 500ml bfs bottle ( ) , injection solution for , dextrose 10% ( ffs / bfs 500ml bottle ) , injection , dextrose 25% inj 500ml bfs bottle ( ) , injection solution for , dextrose 25% inj 500ml ffs / bfs bottle ( ) , injection solution for , dextrose 25% inj ( 100ml ffs / bfs bottle ) , injection solution for , dextrose 25% ( 500ml ffs bottle ) , injection , dextrose 5% 500ml bfs bottle ( ) , injection , dextrose 5% inj 500ml ffs / bfs bottle ( ) , bottle , dextrose 5% ( 500ml ffs bottle ) , injection , dextrose 50% inj 100ml ffs / bfs bottle ( dextrose 50% inj 100ml ffs / bfs bottle ) , injection solution for , dextrose 50% inj. bottle ( 500ml ffs / bfs ) , injection solution for , dextrose with saline 5% + 0.9% inj 500ml bfs bottle , dextrose with saline 5% + 0.9% inj 500ml ffs / bfs bottle , dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection , electrolyte g inj 500ml bfs bottle ( ) , injection solution for , electrolyte g inj ffs / bfs bottle ( 500ml ) , injection solution for , electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) intravenous fluid [ each 100ml contains: anhydrous dextrose 5 gm, sod.chloride 0.37g, potassium chloride 0.13g, ammonium chloride 0.37g ] ( 500ml ffs bottle ) ( 500 ml ) , bottle , electrolyte m inj 500ml bfs bottle ( ) , injection solution for , electrolyte m inj 500ml ffs / bfs bottle ( ) , injection solution for , electrolyte m inj ( 500ml ffs bottle ) , injection solution for , electrolyte p inj 500ml bfs bottle ( ) , injection solution for , electrolyte p inj 500ml ffs / bfs bottle ( ) , injection solution for , electrolyte p inj ( 500ml ffs bottle ) , injection solution for , fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection , human normal immunoglobin ( 5gm / 100ml ) , injection , mannitol inj. 20% 350ml ffs bottle , mannitol injection i.p. 20% 100ml bottle ( ) , injection solution for , moxifloxacin ( 100ml ) , injection , normal saline ( 0.9% ( 500ml ffs bottle ) ) , injection , ofloxacin infusion ( 2mg / 1ml ( 100ml ffs bottle ) ) , bottle , ofloxacin inj 2mg / 1ml 100ml , ringer lactate inj iv 500ml bfs bottle ( ) , injection solution for , ringer lactate inj iv 500ml ffs / bfs bottle ( ) , injection solution for , ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , injection solution for , sodium chloride 0.9% injection ip 100ml bottle ( ) , injection powder for , surgical spirit ( 100ml ) , bottle , eye drops / ear drops , atropine sulphate eye drops 1% ( 5 ml vial ) ( 5 ml vial ) , eye drops / ointment , carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop , carboxymethylcellulose ( 5 ml ) , eye drop , chloramphenicol 0.5% ( 5ml ) , eye drop , chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop , ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop , ciprofloxacin 0.3% ( 5ml vial ) , eye drop , clotrimazole 1%w / v +lignocaine 2%w / v ( 10ml ) , eye drop , fluconazole eye drop 3 mg / ml ( 10 ml vial ) ( 3 mg ) , eye drop , gentamycin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop , moxifloxacin 0.5% w / v ( 5 ml ) , eye drop , moxifloxacine eye drop 0.5%w / v , ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop , ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop , ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop , cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops , clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop , clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial , cream / ointment , aciclovir 3% ( 5gm tube ) , ointment , aciclovir cream 5% ( 5g tube ) ( ) , cream , acyclovir 5% ( 5gm ) , ointment or cream , atropine sulphate eye ointment 1% ( 3 gm tube ) , beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream , beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment , benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment , benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube , betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream , betamethasone valerate cream 0.05% ( 15gm tube ) , ointment , betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment , betamethasone valerate oint / cream ip. 0.12% , cetrimide cream bp ( 0.1% w / w ) , tube , chloramphenicol eye ointment 1% ( 4 gram ) , tube , ciprofloxacin eye ointment 0.3% ( 3gm tube ) , clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream , clotrimazole cream 1% ( 15 gm tube ) , cream , clotrimazole cream 1% ( 15 gm tube ) , cream , clotrimazole i.p. 2%w / w ( 15gm tube ) , cream , compound benzoic acid ointment , cream sumag ( ) , cream , framycetin sulphate 1% cream ( 30 gm tube ) , cream , fusidic acid 0.02 ( 15 gm ) , cream , fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube , gentamycin sulphate 0.1% ( 15gm tube ) , ointment , miconazole cream i.p. 2% w / w ( 15 gm tube ) , consumable , mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube , permethrin 5% ( 30 gm ) , cream , povidone iodine cream 250 gm , povidone iodine ointment 5% 15gm tube , povidone iodine ointment 5% 250gm jar ( ) , each , salicylic acid ointment ( 6% ) , ointment , salicylic acid ( 0.02 30 gm ) , ointment , silver sulphadiazine cream usp 1% w / w 25gm , silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream , soframycin ointment 30 mg tube ( ) , ointment , lab test kits and reagent , alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable , anti abd grouping serum 3x10ml consumable , anti b sera igm ( 10 vial ) , consumable , anti d sera igg+igm 10ml vial ( each ) , consumable , anti d ( polyvalent ) ( 1x10 ml ) , consumable , auto pippets fixed volume 10 micro liters each , auto pippets fixed volume 1000 micro liters each , auto pippets fixed volume 20 micro liters each , benedicts qualitative reagent ( 1x5 lit ) , consumable , bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable , bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , blood agar powder ( 500 grm ) , consumable , blood bag 100ml , blood bag 350ml , blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable , blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml , blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml , blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) , blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable , blood urea ( bun ) uv ( 1000 ml ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable , blood urea ( arba ) , consumable , capillary tube 100 pieces consumable , cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable , cholesterol kit end point enzymatic kit 50 test / kit , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit , conc hcl ( 1x500 ml = 500 ml ) , consumable , cover slip 18 x 18 mm 10gm , cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable , creatine calorimeter for semi auto kinetica 4x60ml 480 test kit , creatinin kit , crp kit 1x100 biolab qualitative ) , crp latex slide per test , crp test kit ( latex / card ) ( 25 test / kit ) , crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable , dengu card antigen ( 25 card / pkt ) , consumable , dengue card test 100 test kit , developer powder ( 22.5 ltr ) , diagnostic strips for urine sugar / albmin packing: 100 strip / pkt , dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 , digital x ray film 10x12 ( 150 films / pkt ) , digital x ray film 11x14 ( 150 films / pkt ) , digital x ray film 8x10 ( 150 films / pkt ) , echo jelly 20ml bottle , echo jelly 250 ml ( mfg by precious life care ) , bottle , edta k3 vial each , edta solutions k3 ( 500 ml ) , edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable , field stain a 500ml , field stain b 500ml , filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr , fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr , formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable , g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable , glacial acetic acid ( 2.5 liter ) , consumable , glass slide 75mm x 25mm 1.1 mm , glass slide 75mm x 25mm 1.35 mm , glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable , glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt , glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt , glass test tube 5 without edge , glucometer strip ( 1x100 ) , glucose kit ( god / pod ) ( 350ml ) , digonstic , h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable , hba ag elisa 96 kit 1x96 ( each ) , consumable , hba ag rapid card test ( each ) , consumable , hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic , hcl n / 10 ( 500 ml bottle ) , hcv elisa ( 96 test kit ) , consumable , hcv kit card test ( 25 test / kit ) , digonstic , heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable , hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit , hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable , hiv kit card ( 25 test / kit ) , hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable , k3 blood vaccutainer edta 100 tubes / pkt , leishman stain 500 ml , malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) , malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab , malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species , malaria pf / pv antigen card , malaria pf / pv rapid test , methyline blue ( 100 ml ) , solution , micro pipet 1000 fix and variable each , micropiptte 100 1000 , microtips ( 2 200 ul ) 1x1000 ( each ) , consumable , n / 10 hcl 500ml , nebulization mask kit ( pediatrics ) , nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable , nebulization mask kit ( adult ) , new born baby kit [ 4 piece set ] , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable , ra factor 50 test kit qualicative , ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes , test tube 12 x 100 ( medicm size ) 100 / pkt , test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube , test tube 15x125 , tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each , tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each , tips for auto pippetes 10 to 100 micro litres , tissue paper roll ( each ) , consumable , tourniquet with belt ( good quality pairs ) , pairs , tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable , typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) , typhoid test card. , umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable , umbical cord clamps plastic material ( box of 100 clamps ) , consumable , urine albumin & suger , usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable , usg thermal paper , vdrl ( rpr ) 1x100 sd strip , vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable , vdrl kit ( strip ) ( 50 test / kit ) , consumable , widal 2x2 sera slide kit , widal 2x2 tube test kit , widal 4x5 ml , slide blue star , sputum cup with sticker , paraffin strip roll , zipper polybag , alluminium foil roll , hand wash liquid , falcon tube , thermacol box , gel pack , bamboo stick , tape roll , spirit lamp , disposible material , adhesive plasters usp 7.5 cm x 10 mts / roll , adhesive plasters usp 7.5 cm x 5 mts / roll , adhesive roll 1 inch x 5 m / roll , baby oxygen mask set of all sizes , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag , blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag , disposable appron consumable , disposable cap , disposable examination gloves made of natural rubber latex, pre powdered, non streile medium , disposable examination gloves made of natural rubber latex, pre powdered, non streile small , disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large , disposable needles 22g consumable , disposable needles is 10654:2002 22g , disposable needles is 10654:2002 24g , disposable needles is 10654:2002 26 g ( ) , needle , disposable paper gloves size 7 inches consumable , disposable paper gloves size 7, 1 / 2 inches consumable , disposable plastic appron ( full size ) , disposable pricking lancet ( pkt of 200 units ) , disposable pricking lancet 100 units consumable , disposable scalp vein set size 20 no , disposable scalp vein set size 22 no , disposable sharp collection containers 1.5 l , disposable sharp collection containers 5 ltr , disposable sideport knife ( num ) , consumable , disposable sterile gloves size 6 inches consumable , disposable sterile gloves size 61 / 2 inches consumable , disposable sterile gloves size 7, 1 / 2 inches consumable , disposable sterile hypodermic syringe 10ml ( each ) , consumable , disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , disposable surgeon cap ( box of 100 caps ) , disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable , disposable syringe with needle ( 2ml each ) , syrings , disposable syringe with needle ( 3ml each ) , syrings , disposable syringe with needle ( 5ml each ) , needle , hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable , kellys pad disposable , n 95 mask ( as per attached specification ) , consumable , oxygen mask adult ( standard size ) , oxygen mask paediatric ( standard size ) , plain disposable vial 3ml ( each ) , consumable , scalp vein set ( size 24g, disposable ) , consumable , three layer surgical mask , urine container 5ml disposable ( 50 per pkt ) , urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable , x ray related , x ray film 10 x 12 50 sheets / pack , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack , catgut / b.b. silk , b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable , b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle , b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material , b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material , black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) , black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable , black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt , black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt , catgut chromic size:2 / 0 length 150 cm , catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable , catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable , chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable , chromic catgut , round body needle no. 1.0 , chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) , chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt , chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 , non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable , non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable , silk no 1 cutting needle 1x12 ( 1x12 ) , consumable , suture mersilk 8 0 ( 12 foil ) , cotton and related, chadar, bedsheet , absorbent cotton roll 100 gm each consumable , absorbent cotton wool ip 500 grms ( each ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) , cotton crape bandage 15cm x 4m ( box of 10 bandages ) , cotton delivery belt , adhesive tape , adhesive tape 7.5cm x10 ( mtr / roll ) , consumable , cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable , paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable , paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 2 inch x 5m / roll , paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll , paper adhesive plaster microporous surgical tape 6 inch x 5m / roll , umblical cotton tape length 75cm. , catheter , disposable suction catheter ( size 12 ) , consumable , disposable suction catheter ( size 14 ) , consumable , feeding tube ( catheter ) 10g , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 14 3 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys catheter size 22 2 way ( 13 each ) , consumable , foleys catheter size 24 2 way ( 14 each ) , consumable , foleys urinary catheter 2 way size 8 , infant feeding tube ( catheter ) size: 3g , infant feeding tube ( catheter ) size: 4g , infant feeding tube ( catheter ) size: 5g , blade , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material , surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material , surgical blade, size 11 , ecg , ecg jelly 250 gms , ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable , ecg paper computerizesd triple channel 20m , ecg paper ( chemical coated ) 50mm x 20mm roll , ecg paper ( chemical coated ) 50mm x 30 mtr. roll , ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll , ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable , ecg roll three channel 20m , ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable , needle , absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) , absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable , blood vessel introducers needles 16g, sterilized, set , chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle , chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle , chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle , insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( children ) , surgical material , sterile hypodermic syring with needle 10 ml , sterile hypodermic syring with needle 20 ml , sterile hypodermic syring with needle ( 5 ml ) , syrings , sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable , iv cannula , cannula fixer set consumable , i.v cannula with injection valve size : 18g , i.v. cannula with injection valve 20g , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula size 26g ( ) , consumable , biomedical waste collection plastic bag small ( all colours ) , biomedical waste collection plastic bag medium ( all colours ) , biomedical waste collection plastic bag large ( all colours ) , mattress 5kg cotton 3 ft x 6 ft , pillow with 2kg cotton , tericot sharee , compunder dress ( male ) , bed sheet single bed ( white ) , bedsheet double bed ( white ) , bed sheet single bed ( coloured ) , bedsheet double bed ( coloured ) , baby diapers small ( 10 diaper per pkt ) , chair cushion box type , chair cushion box type , chair cushion cover , compounder coat / lab tec / xry tec std size , curtain green redymade , curton cloth rangeen , curton cloth rangeen design , dionised water 5 ltr cane ( each ) , front aprin , metresses 3x6 with raxine cover 4 density , napkin sup. quality std size ( white ) , napkin sup. quality std size ( coloured ) , peticote blauge cloth shuti rangeen , peticote / blauge cloth shuti bleach , pillow cover cloth bleach , rangeen baag print kapda , rangeen baag print kapda , rangeen design towel beev kapda , rangeen design weft stripe kapda , table cloth rangeen ( small ) , table cloth rangeen ( large ) , biomedical waste collection plastic dustbin small ( all colours ) , biomedical waste collection plastic dustbin medium ( all colours ) , biomedical waste collection plastic dustbin large ( all colours ) , others , azithromycin ( 250mg ) , tablet [ 110083 ] , azithromycin ( 500mg ) , tablet [ 110083 ] , adrenochrome inj , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection [ 110037 ] , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet [ 120030 ] , ciprofloxacin ( 500mg ) , tablet [ 4350032 ] , diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection [ 110366 ] , atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection [ 110012 ] , disposable syringe with needle ( 10ml each ) , needle , paracetamol ( 500mg ) , tablet [ 110027 ] , diclofenac sodium 25 mg / ml ( 3ml amp ) , injection [ 110024 ] , ranitidine ( 150mg ) , tablet [ 110277 ] , doxycycline ( 100 mg ) , capsule [ 110113 ] , zinc dispersible ( 20mg ) , tablet [ 110421 ] , alcohol based hand sanitizer ( 500 ml bottle ) , consumable , alcohol based hand sanitizer ( 100 ml bottle ) , consumable , alcohol based hand sanitizer ( 50 ml bottle ) , consumable , n 95 mask , disposable three layer mask , surgical gloves 7 , surgical gloves 7.5 , surgical gloves 6.5 , surgical gloves 6 , surgical gloves 8 , typhoid test card , malaria test card , syphilis test card , digital b.p. apparatus , finger pulse oxymeter , non contact thermometer , oxygen cylinder d type , oxygen cylinder b type , stethosocpe , postmartom box , digital x ray machine , a amylase 6x25 ml , a amylase 5x5 ml , acid phosphatase 1x40ml , alanine aminotransferase ( alt / gpt ) 1x50ml – biosystem / amalgum / aqurro , alanine aminotransferase ( alt / gpt ) 1x200ml– biosystem / amalgum / aqurro , alanine aminotransferase ( alt / gpt ) 1x500ml– biosystem / amalgum / aqurro , albumin 1x250ml – biosystem / amalgum / aqurro , albumin 2x250ml – biosystem / amalgum / aqurro , alkaline phosphatase ( amp ) 1x200ml– biosystem / amalgum / aqurro , alkaline phosphatase ( dea ) 1x200ml– biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 1x50ml – biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 1x200ml– biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 1x500ml– biosystem / amalgum / aqurro , bilirubin ( direct ) 4x50ml– biosystem / amalgum / aqurro , bilirubin ( direct ) 2x500ml – biosystem / amalgum / aqurro , bilirubin ( total ) 4x50ml – biosystem / amalgum / aqurro , bilirubin ( total ) 2x500ml – biosystem / amalgum / aqurro , bilirubin ( total & direct ) 2+2x50ml – biosystem / amalgum / aqurro , bilirubin ( total & direct ) 500+500ml– biosystem / amalgum / aqurro , calcium az 1x200ml – biosystem / amalgum / aqurro , calcium az 1x500ml– biosystem / amalgum / aqurro , cholestrol 1x50ml – biosystem / amalgum / aqurro , cholestrol 1x200ml – biosystem / amalgum / aqurro , cholestrol 1x500ml– biosystem / amalgum / aqurro , cholestrol hdl direct 1x80ml – biosystem / amalgum / aqurro , cholestrol ldldirect 1x80ml – biosystem / amalgum / aqurro , cholestrol hdl 2x50+2x50ml– biosystem / amalgum / aqurro , cholestrol hdl ppt 1x50ml– biosystem / amalgum / aqurro , cholestrol ldl ppt1x20ml – biosystem / amalgum / aqurro , ck ifcc liq 1x50ml– biosystem / amalgum / aqurro , ck ifcc liq 4x50ml – biosystem / amalgum / aqurro , ck mb liq 1x50ml– biosystem / amalgum / aqurro , creatinine 2x50ml– biosystem / amalgum / aqurro , creatinine 4x50ml – biosystem / amalgum / aqurro , creatinine 1x1000ml– biosystem / amalgum / aqurro , fructosamine 2x50ml– biosystem / amalgum / aqurro , ggt 1x50ml – biosystem / amalgum / aqurro , glucose 1x500ml– biosystem / amalgum / aqurro , glucose 5x200ml – biosystem / amalgum / aqurro , iron ferrozine 4x50ml – biosystem / amalgum / aqurro , iron chromazurol4x50ml biosystem / amalgum / aqurro , iron binding capacity ( tibc ) 50test– biosystem / amalgum / aqurro , lactate dehydrogenase ( ldh ) ifcc 1x50ml – biosystem / amalgum / aqurro , lipase 1x60ml– biosystem / amalgum / aqurro , magnesium 4x50ml – biosystem / amalgum / aqurro , phosphorus 170 ml – biosystem / amalgum / aqurro , total protein 1x250ml – biosystem / amalgum / aqurro , total protein 2x250ml – biosystem / amalgum / aqurro , protein ( urine ) 4x50ml– biosystem / amalgum / aqurro , triglycerides 1x50ml – biosystem / amalgum / aqurro , triglycerides 4x50ml – biosystem / amalgum / aqurro , triglycerides 2x250ml – biosystem / amalgum / aqurro , urea ( bun colour ) 4x50ml – biosystem / amalgum / aqurro , urea ( bun uv ) 4x50ml – biosystem / amalgum / aqurro , urea ( bun uv ) 2x250ml– biosystem / amalgum / aqurro , uric acid 1x50ml – biosystem / amalgum / aqurro , uric acid 1x200ml – biosystem / amalgum / aqurro , fructose 1x50ml– biosystem / amalgum / aqurro , citrate 1x50ml – biosystem / amalgum / aqurro , micro albumin 1x20ml – biosystem / amalgum / aqurro , micro albumin 1x50ml– biosystem / amalgum / aqurro , apolipoprotein a1 1x50ml – biosystem / amalgum / aqurro , apolipoprotein b 1x50ml – biosystem / amalgum / aqurro , hs crp 1x50ml – biosystem / amalgum / aqurro , complement component c3 1x50ml – biosystem / amalgum / aqurro , complement component c4 1x50ml– biosystem / amalgum / aqurro , ferritin 1x15ml– biosystem / amalgum / aqurro , ferritin 1x45ml– biosystem / amalgum / aqurro , immunoglobilin a ( iga ) 1x50ml – biosystem / amalgum / aqurro , immunoglobilin a ( igg ) 1x50ml – biosystem / amalgum / aqurro , immunoglobilin a ( igm ) 1x50ml – biosystem / amalgum / aqurro , transferrin 1x50ml– biosystem / amalgum / aqurro , aso 1x50ml– biosystem / amalgum / aqurro , crp1x50ml – biosystem / amalgum / aqurro , rf 1x50ml– biosystem / amalgum / aqurro , prealbumin 1x50ml– biosystem / amalgum / aqurro , anti thermbin lll 1x50ml– biosystem / amalgum / aqurro , a1 acid glycoprotein 1x50ml– biosystem / amalgum / aqurro , b2 mircoglobulin 1x50ml– biosystem / amalgum / aqurro , anti streptolysin ( aso ) slide 50 test– biosystem / amalgum / aqurro , anti streptolysin ( aso ) slide 150 test– biosystem / amalgum / aqurro , c reactive protein ( crp ) slide 50test – biosystem / amalgum / aqurro , c reactive protein ( crp ) slide 150 test– biosystem / amalgum / aqurro , rheumatoid factor ( rf ) slide 50 test – biosystem / amalgum / aqurro , rheumatoid factor ( rf ) slide 150 test– biosystem / amalgum / aqurro , hba1c turbi 1x50ml – biosystem / amalgum / aqurro , bilirubin standard 1x5ml– biosystem / amalgum / aqurro , biochemistry calibrator 5x5ml – biosystem / amalgum / aqurro , apolipoprotein a1 standard 1x1ml– biosystem / amalgum / aqurro , apolipoprotein b standard 1x1ml – biosystem / amalgum / aqurro , protein calibrator 5x1ml– biosystem / amalgum / aqurro , hdl / ldl standard 1x1ml– biosystem / amalgum / aqurro , prealbumin standard 1x1ml – biosystem / amalgum / aqurro , heamoglobin a1c control normal 1x0.5ml– biosystem / amalgum / aqurro , heamoglobin a1c control elevated 1x0.5ml– biosystem / amalgum / aqurro , control urine 1x5ml – biosystem / amalgum / aqurro , micro albumin standard 1x1ml – biosystem / amalgum / aqurro , aso standard 1x1ml – biosystem / amalgum / aqurro , alpha 1 microglobulin standard 3ml– biosystem / amalgum / aqurro , ada control 2x1ml – biosystem / amalgum / aqurro , ada standard 1ml– biosystem / amalgum / aqurro , lipid control l 3x1ml – biosystem / amalgum / aqurro , lipid control ll 3x1ml – biosystem / amalgum / aqurro , biochemistry control serum ( human ) l1 5x5ml – biosystem / amalgum / aqurro , biochemistry control serum ( human ) l2 5x5ml – biosystem / amalgum / aqurro , biochemistry control serum l1 5x5ml – biosystem / amalgum / aqurro , biochemistry control serum l1 20x5 ml– biosystem / amalgum / aqurro , biochemistry control serum l2 5x5 ml– biosystem / amalgum / aqurro , biochemistry control serum l2 20x5ml – biosystem / amalgum / aqurro , rheumatoid control serum l1 3x1ml – biosystem / amalgum / aqurro , rheumatoid control serum l2 3x1ml – biosystem / amalgum / aqurro , crp / hs crp standard 1x1ml – biosystem / amalgum / aqurro , ferritin standard 1x3ml – biosystem / amalgum / aqurro , hba1c standard 1x2ml – biosystem / amalgum / aqurro , rf standard 1x3ml – biosystem / amalgum / aqurro , prevecal human control serum 12x5ml– biosystem / amalgum / aqurro , protein ( total ) 10x50ml – biosystem / amalgum / aqurro , protein ( urine ) 5x50m– biosystem / amalgum / aqurro , creatinine 10x50ml – biosystem / amalgum / aqurro , glucose 10x50ml – biosystem / amalgum / aqurro , cholestrol 10x50ml – biosystem / amalgum / aqurro , phosphorus 2x50ml – biosystem / amalgum / aqurro , iron ferrozine 5x50ml – biosystem / amalgum / aqurro , bilirubin total 5x50ml– biosystem / amalgum / aqurro , bilirubin direct 5x50ml– biosystem / amalgum / aqurro , magnesium 2x50ml– biosystem / amalgum / aqurro , alkaline phosphate dea 5x20ml– biosystem / amalgum / aqurro , urea / bun uv 5x50ml– biosystem / amalgum / aqurro , alkaline phosphate amp 5x20ml– biosystem / amalgum / aqurro , ggt 5x50ml– biosystem / amalgum / aqurro , uric acid 10x50ml – biosystem / amalgum / aqurro , triglycerides 10x50ml – biosystem / amalgum / aqurro , aspartate aminotransferase ( ast / got ) 5x50ml– biosystem / amalgum / aqurro , alanine aminotransferase ( alt / gpt ) 5x50ml– biosystem / amalgum / aqurro , albumin 5x50ml– biosystem / amalgum / aqurro , a amylase 5x20ml– biosystem / amalgum / aqurro , hdl direct 4x20ml – biosystem / amalgum / aqurro , ldl direct 4x20ml – biosystem / amalgum / aqurro , calcium az 10x50ml– biosystem / amalgum / aqurro , lactate dehydrogenase ( ldh ) 5x50ml– biosystem / amalgum / aqurro , ada 4x10ml – biosystem / amalgum / aqurro , ck 3x15ml – biosystem / amalgum / aqurro , ck mb 3x15ml – biosystem / amalgum / aqurro , lipase 3x15ml – biosystem / amalgum / aqurro , conc wash solution 100ml – biosystem / amalgum / aqurro , conc system liquid 1000ml– biosystem / amalgum / aqurro , sta neoplastine ci+5 6x5ml– edan / swelab / stago / sysmex , sta cephascreen 4 12x4ml edan / swelab / stago / sysmex , sta satellite cuvettes 6x200– edan / swelab / stago / sysmex , sta coag control n+p 12x2x1ml edan / swelab / stago / sysmex , sta system control n+p– 12x2x1 edan / swelab / stago / sysmex , sta liatest control n+p 12x2x1ml edan / swelab / stago / sysmex , sta thrombin 2 12x2 ml edan / swelab / stago / sysmex , sta liquid fib 12x4 ml – edan / swelab / stago / sysmex , sta liatest d dimer 6x6 ml – edan / swelab / stago / sysmex , sta – cacl2 0.025 m 24x15ml – edan / swelab / stago / sysmex , sta uniclibrator 6x1 ml – edan / swelab / stago / sysmex , ptt – la 6x2 ml – edan / swelab / stago / sysmex , sta dificient viii 6x1 ml – edan / swelab / stago / sysmex , sta dificient ix 6x1 ml–edan / swelab / stago / sysmex , sta difficient vii 6x1 ml– edan / swelab / stago / sysmex , sta difficient v 6x1 ml– edan / swelab / stago / sysmex , sta difficient ii 6x1 ml–edan / swelab / stago / sysmex , sta difficient xi 6x1 ml – edan / swelab / stago / sysmex , sta difficient ix 6x1 ml– edan / swelab / stago / sysmex , sta sifficient x 6x1 ml–edan / swelab / stago / sysmex , sta staclot protein c 3x1 ml– edan / swelab / stago / sysmex , sta staclot protein s 2x1ml –edan / swelab / stago / sysmex , sta stachrom at iii 3 4x3 ml– edan / swelab / stago / sysmex , sta owren koller 24x15ml – edan / swelab / stago / sysmex , sta cleaner solution 6x2500ml – edan / swelab / stago / sysmex , sta desorb u 24x15 ml – edan / swelab / stago / sysmex , white stirring bar 1 pc – edan / swelab / stago / sysmex , red stirring bar 1 pc – edan / swelab / stago / sysmex , sta micro cups 100 pc – edan / swelab / stago / sysmex , m 52 diff lyse 500ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 lh lyse 100ml– amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 diluent 20 ltr –amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 probe cleaner 50 ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 52 paper roll– amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 diluent 20 ltr – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 cfl lyse 500ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 rinse 20 ltr– amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 probe cleanzer 17ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , m 18 e z cleaner 100ml – amalgum / aqurro / edan / swelab / stago / sysmex / mindray , paper roll 30 mtr , electrolyte pack 900ml sensacore / amalgum / aqurro / edan / swelab / stago / sysmex / mindray , hba1c analyzer biosystem / amalgum / aqurro / heidelco / edan / swelab / stago / sysmex , na, k+ analyzer sensacore / biosystem / aqurro / heidelco / edan / swelab / stago / sysmex , cbc machine biosystem / amalgum / aqurro / heidelco / edan / swelab / stago / sysmex , horizontal autoclave malgum / aqurro / p.l.tandon / yorco / sems / tanco / heidelco / sai engineerings , dual reordered pack biosystem / amalgum / aqurro / bio rad / heidelco / edan / swelab / stago / sysmex , cholestrol hdl calibrator biosystem / amalgum / aqurro , cholestrol ldl calibrator biosystem / amalgum / aqurro , ck mb calibrator biosystem / amalgum / aqurro , rf calibrator biosystem / amalgum / aqurro , crp calibrator biosystem / amalgum / aqurro , calcium chlorite ( cacl2 ) biosystem / amalgum / aqurro , desktop computer i3 , desktop computer i5 , laptop i5 , laptop i3 , air condition 1.5 ton , printer three in one , printer mfc , air condition 2 ton , nayi pahle kit , cord clamp , thermocal box for covid sampling , revolving office chair , revolving executive office chair , office table with racks 3*4 , computer table , s.s waiting chair , cooler , room heater , b.p aparatus digital , weigthing machine ( adult ) , weigthing machine ( adult ) digital , weighting machine neo natal , b.p aparatus professional , room heater with blower , parafilm...

Public Health And Family Welfare - Madhya Pradesh

30443234 bids are invited for acetonitrile lcms / hplc , n hexane ar , dimethyl sulfoxide ar , dimethyl farmamide ar , methonol lcms lcms , iso octane ar , cyclohexane lcms , diethylene glycol ar , hydrochloric acid ( 35% w / w ) ar , triphenyphosphine sr , methylene chloride gcms , p&t methanol p&t , methyl tetra butylether hplc , ethyl acetate extra pure ar , glacial acetic acid ar , formic acid ar / lcms , trifluoroacetic acid ar , orthophosphoric acid 85+%extra ar , dichloromethane99+%extra ar , ammonia solution ar , ammonium acetate lcms grade , ammonium formate lcms , sodium chloride anhydrous ar , sodium sulfate anhydrous ar , magnesium sulfate anhydrous ar , di ethyl either ar , chloroform ar , acetic acid ar , acetone ar , toluene ar , hydrochloric acid ar , ico propyl alcohol ar , n heptane ar , n pentane ar , n n di methyl forma mide ar , cyclohexane ar ar , benzene ar , naoh ar , koh ar , sodium hydrogen sulphate mono hydrate ar , boron trifluride reagent ar , sodium methoxide ar total quantity : 1...

Department of Higher Education - Madhya Pradesh

30317622 bids are invited for science equipment 1 jaeger’s apparatus to determine the surface tension , science equipment 2 barton’s apparatus to determine modulus of rigidity , science equipment 3 stock’s apparatus to determine coefficient of viscosity , science equipment 4 calendar and barne’s apparatus to determine the value of mechanical equivalent of heat , science equipment 5 complete apparatus to determine the heating efficiency of electrical kettle with variable voltages , science equipment 6 lee’s apparatus to determine the heat conductivity of bad conductors of different geometry , science equipment 7 searle’s apparatus to determine the coefficient of thermal conductivity , science equipment 8 joule calorimeter apparatus to determine mechanical equivalent of heat , science equipment 9 complete apparatus to study the oscillations of mass under different combinations of spring , science equipment 10 carey foster bridge apparatus to determine the temperature coefficient of a resistance , science equipment 11 variation of thermo emf with temp for thermo couple complete apparatus with all accessories , science equipment 12 study of various network theorems , science equipment 13 transistor characteristics apparatus with built in power supply and meters , science equipment 14 apparatus to study characteristics of zener diode , science equipment 15 apparatus to study characteristics of fet , science equipment 16 apparatus for determinecharging or discharging of capacitor , science equipment 17 complete apparatus for study of optical rotation , science equipment 18 crt mounted on wooden stand, power supply, a pair of bar magnet, compass box, a wodden stand with scale , science equipment 19 digital millimeter , science equipment 20 viscous liquid ( glycerin ) 800ml , science equipment 21 small steel balls of different diameter , science equipment 22 keysone way , science equipment 23 keystwo way , science equipment 24 grating , science equipment 25 quartz prism , science equipment 26 measuring cylinder100 ml , science equipment 27 spherometer2 , science equipment 28 electric weighing machine , science equipment 29 alluminium chloride , science equipment 30 alluminium pott. sulphate , science equipment 31 alluminium sulphate , science equipment 32 ammonium acetate , science equipment 33 ammonium carbonate , science equipment 34 ammonium chloride , science equipment 35 ammonium dicromate , science equipment 36 ammonium molyblade , science equipment 37 ammonium oxalate , science equipment 38 ammonium solution ( liquer ) , science equipment 39 ammonium sulphate , science equipment 40 ammonium thiocynate , science equipment 41 arsenic oxide , science equipment 42 di ammonium hydrozene phasphet , science equipment 43 barium chloride , science equipment 44 calcium oxide , science equipment 45 calcium chloride , science equipment 46 camphor , science equipment 47 cobalt chloride , science equipment 48 cobalt nitrate , science equipment 49 copper acetare , science equipment 50 copper carbonate , science equipment 51 copper sulphate , science equipment 52 ferric ammonium sulphate , science equipment 53 ferric chloride , science equipment 54 iron filings , science equipment 55 lead acetate , science equipment 56 lead nitrate , science equipment 57 magnesius sulphate , science equipment 58 magnesium carbonate , science equipment 59 manganese oxide , science equipment 60 pottassium chloride , science equipment 61 pottassium cromate , science equipment 62 pottassium dicromate , science equipment 63 pottassium iodide , science equipment 64 silver nitrate , science equipment 65 silica gel , science equipment 66 sodium carbonate , science equipment 67 sodium bicarbonate , science equipment 68 sodium hydroxide , science equipment 69 sodium thiocynate , science equipment 70 sodium thiosulphate , science equipment 71 sodium hypochloride , science equipment 72 sodium nitrate , science equipment 73 sodium nitrite , science equipment 74 sodium metal , science equipment 75 titan yellow , science equipment 76 zinc carbonate , science equipment 77 zink chloride , science equipment 78 zink oxide , science equipment 79 hydrochloric acidcon. , science equipment 80 sulphuric acidcon. , science equipment 81 nitric acidcon. , science equipment 82 acetamide , science equipment 83 acetic acid ( glacial ) , science equipment 84 acetone , science equipment 85 alizrine , science equipment 86 alpha napthol , science equipment 87 aniline , science equipment 88 anthracene , science equipment 89 benzamide , science equipment 90 benzene , science equipment 91 benzoic acid , science equipment 92 benzophinol , science equipment 93 b napthol , science equipment 94 boric acid , science equipment 95 bromine water , science equipment 96 chlorofarm , science equipment 97 dimethyle glyoxime , science equipment 98 ether , science equipment 99 ethyle acetate , science equipment 100 ethyle alcohal , science equipment 101 glucose , science equipment 102 glycerol , science equipment 103 iodine , science equipment 104 m dinitrobenzene , science equipment 105 methyle alchohol , science equipment 106 methyle red , science equipment 107 napthalene , science equipment 108 n butanol , science equipment 109 oxalic acid , science equipment 110 para di chlorobenzene , science equipment 111 paraffine liquid , science equipment 112 picric acid , science equipment 113 salicylic acid , science equipment 114 starch , science equipment 115 succinic acid , science equipment 116 tartaric acid , science equipment 117 urea , science equipment 118 beaker 100 ml , science equipment 119 beaker 250ml , science equipment 120 beaker500ml , science equipment 121 beaker 100 ml , science equipment 122 conical flask 100ml , science equipment 123 conical flask 150ml , science equipment 124 capillary tube , science equipment 125 fannlsglass , science equipment 126 thils tube for melting points / boiling point , science equipment 127 bottles regent with ground in dust proof flat stoppered n m , science equipment 128 bottles regent with ground in dust proof flat stoppered w m , science equipment 129 viscometer college patterns size 8þ , science equipment 130 burettes pinch cock type with rubber tube andnozzle 50 x 1 / 10 ml , science equipment 131 pipette volumatric with mark , science equipment 132 ingnition tubes in 5 gross packing , science equipment 133 glass rod , science equipment 134 glass tube , science equipment 135 thermameter duly alchohaly filled in case , science equipment 136 thermameter duly alchohaly filled in case , science equipment 137 polythine measuring cylinder with single graduated , science equipment 138 polythine fannls , science equipment 139 measuring cylinder polythine 50 ml , science equipment 140 measuring cylinder polythine 100 ml , science equipment 141 rubber pipette bulb , science equipment 142 tripod stand iron size 8 x 4 , science equipment 143 bunsen burner made of thick bross pipe with air regular and iron base , science equipment 144 sand both g.t.steel , science equipment 145 spetula metal , science equipment 146 pinch clip for burette , science equipment 147 tongs , science equipment 148 rubber tubing soft and red colour indian make 6mm , science equipment 149 rubber tubing soft and red colour indian make 8 mm , science equipment 150 rubber cork assorted size 1 to 10 no. , science equipment 151 rubber cork assorted size 1 to 10 no. , science equipment 152 rubber cork assorted size 1 to 10 no. , science equipment 153 filter paper sheet best kalpin make size 46x57 cms , science equipment 154 whatman filter paper sheetsno. 01 ( pkt ) , science equipment 155 nostoc sp. , science equipment 156 chara sp. ( veg ) t.s , science equipment 157 chara ( repd. ) v.s , science equipment 158 oedogonium t.s , science equipment 159 oedogoniumwith hold fast t.s , science equipment 160 oedogonium capcell v.s , science equipment 161 oedogonium ( antheridal ) v.s , science equipment 162 oedogonium ( repd ) t.s , science equipment 163 oedogonium ( macrandrous ) t.s , science equipment 164 oedogonium t.s , science equipment 165 oedogonium ( akinetes ) t.s , science equipment 166 spriogayar ( t.s ) , science equipment 167 spriogayar , science equipment 168 spriogayar ( scalariform conj t.s , science equipment 169 vaucheriya ( veg ) t.s , science equipment 170 vaucheriya ( rep.d ) v.s , science equipment 171 volvox ( veg. ) t.s , science equipment 172 volvox ( rep.d ) v.s , science equipment 173 volvox ( daughter colonies ) t.s , science equipment 174 volvox ( oogonial ) v.s , science equipment 175 volvox ( antheridial ) t.s , science equipment 176 volvox ( zygosporate ) v.s , science equipment 177 dictyota ( veg ) v.s , science equipment 178 dictyota ( rep.d ) t.s , science equipment 179 ectocarpus sp. ( veg ) t.s , science equipment 180 ectocarpus ( unilocular ) v.s , science equipment 181 ectocarpus ( plurilocular ) t.s , science equipment 182 batrachosparmum ( veg ) t.s , science equipment 183 batrachosparmum ( chantransia v.s , science equipment 184 batrachosparmum ( rep.d ) t.s , science equipment 185 polysiphonia ( sp. ) t.s , science equipment 186 polysiphonia ( rep.d ) t.s , science equipment 187 polysiphonia ( tetrasporic ) t.s , science equipment 188 polysiphonia ( antheridial ) t.s , science equipment 189 lichen ( sp. thallus ) v.s , science equipment 190 volvox ( oogonial ) v.s , science equipment 191 lichen ( fruticose ) v.s , science equipment 192 lichen ( crustose ) v. s , science equipment 193 lichen ( usnea ) v.s , science equipment 194 lichen ( parmelia ) v.s , science equipment 195 lichen ( cladonia ) t.s , science equipment 196 puccinia triticina ( acideo ) t.s , science equipment 197 puccinia triticina ( basideo ) t.s , science equipment 198 puccinia triticina ( pycnideo ) t.s , science equipment 199 puccinia triticina ( uredo ) t.s , science equipment 200 puccinia triticina ( teleuto ) v.s , science equipment 201 alternaria on tomato leaves v.s , science equipment 202 early blight on potato leaves v.s , science equipment 203 cercospora on potato leaves v.s , science equipment 204 cercospora personata ( tikka d.v.s , science equipment 205 cercospora rose leaves t.s , science equipment 206 cercospora sp. v.s , science equipment 207 collatotricum sp.t.s , science equipment 208 red rot of sugarcane v.s , science equipment 209 little leaf of brinjal v.s , science equipment 210 tomato wilt t.s , science equipment 211 leaf spot of turmeric t.s , science equipment 212 phyllactinia on dalbergia t.s , science equipment 213 penicilliumt.s , science equipment 214 aspergillus v.s , science equipment 215 peziza v.s or t.s , science equipment 216 rhizopus t.s , science equipment 217 mucor v.s , science equipment 218 anthocerosev.s thallus , science equipment 219 anthocerose ( female ) v.s , science equipment 220 anthocerose ( sporophyte ) l.s , science equipment 221 marchantia palmata ( veg ) v.s , science equipment 222 marchantia palmata ( gemma cup ) v.s , science equipment 223 marchantia palmate ( sporophyte ) l.s , science equipment 224 riccia frostii ( sporophyte l.s , science equipment 225 riccia fluitans v.s , science equipment 226 riccia himalayensi t.s , science equipment 227 polytrichum ( veg. ) t.s , science equipment 228 polytricham ( male ) , science equipment 229 polytrichum sp. ( female ) cone , science equipment 230 polytricham ( capsule ) t.s , science equipment 231 marsilea minuta ( sporocarps ) v.s , science equipment 232 marsilea minuta ( petiole ) t.s , science equipment 233 azolla .v.s , science equipment 234 azolla sp. ( sprocarps ) v.s , science equipment 235 equisetum l.s leaf , science equipment 236 equisetum defussum ( rhizome ) t.s , science equipment 237 equisetum defussum ( stem ) t.s , science equipment 238 selaginella ( steam ) v.s , science equipment 239 polystrichum squarcssum ( veg. ) , science equipment 240 lycopodium clavatum ( roots ) t.s , science equipment 241 lycopodium clavatum ( stem ) ) t.s , science equipment 242 lycopodium clavatum ( cones 8 ) v.s , science equipment 243 lycopodium cernum ( stem ) t.s , science equipment 244 lycopodium cernum ( cones35 ) v.s , science equipment 245 lycopodium cernum ( veg shoot ) t.s , science equipment 246 pinusl. s of male cone , science equipment 247 pinus l.s of female cone , science equipment 248 pinus slide of pollen grem , science equipment 249 pinus t . s ( ( needles ) , science equipment 250 pinus l.s of ovule , science equipment 251 cycas ( coralloid root ) , science equipment 252 cycas t.s of microsporophyll , science equipment 253 cycasv.s of ovule , science equipment 254 ephedraold l.s of ovule , science equipment 255 ephedra ( shoot ) , science equipment 256 pinus roxburghii ( male cones 60 ) , science equipment 257 pinus roxburghii ( female cone 2 year ) , science equipment 258 pinus roxburghii ( female cone 3 year ) , science equipment 259 asparagus.sp ( root ) t.s , science equipment 260 asparagus .sp ( stem ) t.s , science equipment 261 bigonia sp ( stem, leaves , each ) t.s , science equipment 262 bigonia sp ( stem, leaves root each ) v.s , science equipment 263 borerhavia ( steam, leaves each ) t.s , science equipment 264 boerhavia ( roots ) t.s , science equipment 265 ceratophyllum sp t.s , science equipment 266 cucurbita ( root , stem, leaves each ) t.s , science equipment 267 dracaena sp. ( stem ) t.s , science equipment 268 eichhornia sp. ( stem ) t.s , science equipment 269 eichhornia sp. ( petiole ) v.s , science equipment 270 hydrila sp t.s , science equipment 271 helianathus sp ( root ) t.s , science equipment 272 leptidinia sp. ( stem ) t.s , science equipment 273 nyctanthus sp. ( old stem ) t.s , science equipment 274 salvadora sp. ( leaves each ) v.s , science equipment 275 trapa sp. ( leaves ) v.s , science equipment 276 trapa sp. ( stem ) t.s , science equipment 277 zea mays ( roots, young, stem, ( t.s ) , science equipment 278 sunflower sp. ( roots, young, stemt.s , science equipment 279 t.s of mature anther , science equipment 280 v.s of hydrilla leaf , science equipment 281 t.s of potamogeton stem , science equipment 282 free central placentaton , science equipment 283 superficial placentation , science equipment 284 v.s of potamogeton leaf , science equipment 285 t.s of ceratophyllum stem , science equipment 286 v.s of ceratophyllum leaf , science equipment 287 v.s of trapa leaf , science equipment 288 v.s of eichhornia leaf , science equipment 289 marginal placentation , science equipment 290 axile placentatu , science equipment 291 axile placentation v.s , science equipment 292 v.s of amophilla leaf , science equipment 293 t.s of casurina , science equipment 294 v.s of casurina stem , science equipment 295 t.s of casurina root , science equipment 296 orthotropous , science equipment 297 anatropous , science equipment 298 hemianatropous , science equipment 299 camphlotropous , science equipment 300 amphitropous , science equipment 301 circinotropous , science equipment 302 l.s of ovule , science equipment 303 t.s of aunther , science equipment 304 pollinia , science equipment 305 chrysamoeba sld , science equipment 306 euglena sld , science equipment 307 volvox sld , science equipment 308 notiluca sld , science equipment 309 ceratium sld , science equipment 310 leishmania sld , science equipment 311 trypanosome sld , science equipment 312 amoea sld , science equipment 313 opalina , science equipment 314 sycon spec , science equipment 315 leucosolenia spc , science equipment 316 spongilla , science equipment 317 euspongia , science equipment 318 hydra , science equipment 319 obelia , science equipment 320 echinococcus granulossus , science equipment 321 acaris , science equipment 322 waucheria brancrofti , science equipment 323 trichinelia spirails , science equipment 324 dracnculus mendinensis , science equipment 325 aphrodite , science equipment 326 nereis , science equipment 327 pheretima , science equipment 328 hirudinaria granulosa , science equipment 329 peripatus replica , science equipment 330 limulus , science equipment 331 palamnaeus , science equipment 332 scacculina , science equipment 333 palaemon , science equipment 334 scolopendra , science equipment 335 bombyx mori , science equipment 336 pila , science equipment 337 mytilus , science equipment 338 sepia , science equipment 339 loligo , science equipment 340 octopus , science equipment 341 echinus , science equipment 342 asterias , science equipment 343 medusa of obeila , science equipment 344 nereis trochophore larva , science equipment 345 prawn t.s. of statocyst , science equipment 346 radula of pila , science equipment 347 chromatography paper , science equipment 348 nereis parapodia , science equipment 349 heterohereis parapodia , science equipment 350 trochophore larva w.m. , science equipment 351 megalopa larva , science equipment 352 zoea larva w.m. , science equipment 353 metazoea larva w.m. , science equipment 354 formalien solution liquid , science equipment 355 eosin powder , science equipment 356 benedict solution , science equipment 357 sodium citrate , science equipment 358 potassium iodide , science equipment 359 copper sulphate , science equipment 360 sodium hydroxide flakes , science equipment 361 nesslers reagent , science equipment 362 mercuric iodide , science equipment 363 mercuric chloride , science equipment 364 hydrochloric acid , science equipment 365 sulpuric acid , science equipment 366 nitric acid , science equipment 367 oleic acid , science equipment 368 starch powder , science equipment 369 urea powder , science equipment 370 urease powder , science equipment 371 phenopthalin , science equipment 372 sodium carbonate , science equipment 373 sodium thiosulphate , science equipment 374 sodium sulphate , science equipment 375 leishman stain , science equipment 376 methyl alcohol , science equipment 377 buffer solution , science equipment 378 potassium chromate , science equipment 379 silver nitrate , science equipment 380 lead nitrate , science equipment 381 edta solution , science equipment 382 erichrome black t indicator , science equipment 383 glycerine , science equipment 384 buffer tablet , science equipment 385 aceto carmine , science equipment 386 barium salphate , science equipment 387 cupric sulphate , science equipment 388 ninehydrine solution , science equipment 389 sudan iii , science equipment 390 amonia solution , science equipment 391 iodine solution , science equipment 392 bromine water , science equipment 393 d.p.x. mountant , science equipment 394 glacial acetic acid , science equipment 395 aceto arosine , science equipment 396 basic fuchasine , science equipment 397 mthyl orange , science equipment 398 acetone , science equipment 399 ph stips , science equipment 400 molish reagent , science equipment 401 alpha nephtol , science equipment 402 picric acid , science equipment 403 urea , science equipment 404 magnesium chloride , science equipment 405 r.b.c. diluting fluid. ( hayems soln. ) , science equipment 406 acetic acid glacial , science equipment 407 aceto orcein soln. , science equipment 408 hydrogen peroxide 6 % ( 20 volumes ) , science equipment 409 pila , science equipment 410 earthworm , science equipment 411 heteropnustes fossilies , science equipment 412 anabus , science equipment 413 calrius , science equipment 414 sepia , science equipment 415 prawn 4 5 , science equipment 416 mystus , science equipment 417 cytological : a ) mitosis cell div. set of 5 slides. , science equipment 418 cytological : a ) mitosis cell div. set of 5 slides. , science equipment 419 embryological : chick embryo w.m. 13 hrs. , science equipment 420 embryological : chick embryo w.m. 18 hrs. , science equipment 421 embryological : chick embryo w.m. 21 hrs. , science equipment 422 embryological : chick embryo w.m. 24 hrs. , science equipment 423 embryological : chick embryo w.m. 30 hrs. , science equipment 424 embryological : chick embryo w.m. 33 hrs. , science equipment 425 embryological : chick embryo w.m. 36 hrs. , science equipment 426 embryological : chick embryo w.m. 38 hrs. , science equipment 427 embryological : chick embryo w.m. 42 hrs. , science equipment 428 embryological : chick embryo w.m. 48 hrs. , science equipment 429 embryological : chick embryo w.m. 58 hrs. , science equipment 430 embryological : chick embryo w.m. 66 hrs. , science equipment 431 embryological : chick embryo w.m. 72 hrs. , science equipment 432 embryological : chick embryo w.m. 84 hrs. , science equipment 433 embryological : chick embryo w.m. 96 hrs. , science equipment 434 amphibian embryology : a ) v.s. / w.m. blastula , science equipment 435 amphibian embryology : b ) v.s. / w.m. blastula , science equipment 436 amphibian embryology : c ) tadpole w.m. , science equipment 437 dompilevel complete set , science equipment 438 thydo complete set , science equipment 439 prismatric compass , science equipment 440 enginering zareeb , science equipment 441 binocoular , science equipment 442 thermometer , science equipment 443 rain meter manual , science equipment 444 sprit level , science equipment 445 globe ( earth ) , science equipment 446 mineral ( 20 set in partion box ) , science equipment 447 crystal ( crystal set of 15 in wooden shwcase ) , science equipment 448 rocks ( rocks set of 20 in card box ) , science equipment 449 geographical model , science equipment 450 bhogolik naksha total quantity : 1...

Government Medical College - Madhya Pradesh

30306150 supply of lab reagents and consumables supply of lab reagents and consumables , glass slide ( microscope glass slides ( pack of 50 slides ) 75 x 25 x 1.4 mm in one carton ) , cover silp for haemocytometet 20mm×26mm×0.4mm ( 10 gm pkt in one box ) , gloves 6 .5 inch ( 100 pieces in one box ) , gloves 6 inch and 7 inch ( 100 pieces in one box ) , gloves 7 inch ( 100 pieces in one box ) , gloves7.5 inch ( 100 pieces in one box ) , syringe 5ml ( 1packet ×100 ) , syringe 10ml ( 1 packet ×100 ) , syringe 20ml ( 1 packet ×100 ) , aluminum tray for holding atleast 20 slides of25 x 75mm ( 1 x 3 ) microscope slides ( 1 ) , coplin jars allow for complete submersion of slides when staining with grooves || each staining jar features 4 grooves to separate each slide each groove allows for 2 slides to be placed back to back of size slides ( 75 x 26 x 1.3mm ) ( 1 ) , plastic test tube stand, capacity: 12 tubes ( 1 ) , plastic test tube stand, capacity: 18 tubes ( 1 ) , wooden, t est tube holder, ( 1 ) , stainless steel alcohol burner spirit lamp lab tubler ( 1 ) , tourniquet belt 20 inch 1 inch ( 1 ) , litmus paper litmus paper ph test strips, full range 0 14, red, blue, acid / base indicators ( 1 pack 8.6 x 6.4 x 0.8 cm; 40 grams ) , slide storage cabinets with lock ( capacity for 50000slides ) ?specifications for keeping 75x25mm slides made of crc steel. ( 50, 000 / 160 drawers ) capacity . keeps slide in vertical position with easily removable racks price appx 1.6 lacs ) ( 1 ) , block storage cabinets with lock ( capacity for 50000 blocks ) sp for keeping embedded blocks . cantains duly powder coated trays designed to keep blocks one after other in rows . each tray accommodating the block will be easily removable . ( ysi 165 by yorko price 4.0 lacs ) ( 1 ) , staining troughsof glass toholdsminimum 20 x slides ( 1 ) , bone saw with 16 inch stainless steel blade ( 1 ) , premium quality stainless steel dissection kit set with tools ( 1 ) , low density polyethylene made wash bottles ( 500 ml ) ( 1 ) , stainless steel biopsy sternal puncture needle with guardno 16 ( nos ) , stainless steel biopsy sternal puncture needle with guardno 14 ( nos ) , museum jarsmallleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 5x5x5 inches ( 1 ) , museum jar mediumleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 6x6x4 inches ( 1 ) , museum jar largeleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 9x9x5 inches ( 1 ) , esrwintrobe tube ( 1 pack of 10 tubes ) , esrwintrobe tube stand holding 6 tubes ( 1 ) , waestergren tube esr pipette westergren graduated ( 1 ) , esr westergren stand steel holding 6 tubes ( 1 ) , disposable plastic dropper 5 ml ( 1 pkt 1000 dropper ) , brain knife ( 1 ) , edta vacutainers ( i pkt 100 containers ) , edta solution ( 500 ml ) , pt vacutainer ( i pkt 100 containers ) , 3.8% sodium citrate solution ( 500 ml ) , anti abd kit blood grouping kit 5 ml , urine strip protein / sugar ( 1 bottle 100 strips ) , urine strip 10 prameters ( 1 bottle 100 strips ) , whatman filer paper ( cicular ) grade ( 100 circles per box ) , capillary tube for clotting time 0.5x75 mm ( non heparinised ) ( 1 pack ) , tissue blotting paper 46 x 58 centimeters ( 1 rim ) , tissue paper , cotton roll ( 1 roll500gm ) , white absorbent gauze than, bandage size: 100cm, 120cm1m to 36m ( 1 than ) , urine container ( 1 pkt 50 ) , afb staining kit ( 1 kit 3x100 ml ) , chlorhexidine 0.5% hand rub ( 500 ml ×25 ) , afb staining kit 3x100 ml ( r 1 125 ml ) , afb staining kit 3x100 ml ( r 2 125 ml ) , afb staining kit 3x100 ml ( r 3 125 ml ) , india ink ( 100 ml bottle ) , methanol ( 1 ltr. ar ) , formaldehyde 40% ( 5 lit ) , thymol crystal ( 100 gm / pack ) , xylene ( 2.5 litre bottle ) , paraffin wax ( meelting point 58 60degree ) pellets ( 500 gm / pack ) , harris hematoxylene stain ready to use ( 125 ml / bottle ) , hematoxylene stain powder ( 250 gm / pack ) , eosin stain ( 125 ml / pack ) , ready to use retic stain ( 25 ml / pack ) , leishman stain ( 500 ml / pack ) , ethyl alcohol ( 500 ml / pack ) , glacial acetic acid ( 500 ml / bottle ) , dpx ( 250ml / bottle ) , potassium iodate ( 100 gm / pack ) , sodiumiodate ( 100 gm / pack ) , potassium alum ( 100 gm / pack ) , chloral hydrate ( 100 gm / pack ) , n / 10 hydrochloric acid ( 500 ml / bottle ) , lugol’s iodine ( 100 ml bottle ) , liquid hand wash solution ( 5 litre ) , semen diluting fluid ( 100 ml / bottle ) , fouchets reagent ( 500 ml / bottle ) , liquidammonia ( 500 ml / bottle ) , methyleneblue ( 100 ml / bottle ) , rbc dilution fluid ( 500 ml / bottle ) , rectified spirit ( 5 litre / can ) , 3% acetic acid ( 500 ml / bottle ) , 3 5% sulfosalicylic acid ( 500 ml / bottle ) , benedicts reagents ready tu use ( 500 ml / bottle ) , ammonium sulphate ( 500 gm / pack ) , sodium nitroprusside ( 100 gm / pack ) , conc nitric acid ( 500 ml ) , 10% barium chloride solution ( 500 ml / pack ) , sulphur granules ( 500 gm / pack ) , wbc diluting fluid ( 500 ml / pack ) , rapid giemsastain ( 250 test / pack ) , rapid pap stain kits ( 250 test / kit ) , sulphuric acid ( 500 ml / kit ) , potassium ferricyanide ( 500gm / pack ) , potassium frerrocyanide ( 500gm / pack ) , sodium dihydrogen orthophosphate ( monohydrate ) ( 1kg / pack ) , disodium hydrogen orthophosphate ( anhydrous ) ( 1kg / pack ) , csf diluting fluid 100 ml ( 100 125 ml / bottle ) , disposable tipsblue tips 1000 ul ( 1000 / pack ) , disposable tipsyellowtips 10 100 ul ( 1000 / pack ) , picric acid500 gm ( 500 gm / pack ) , toludine blue 100 gm ( 100gm / pack ) , blood collection needles vacuum with safety shield and pre attached holder 22g , 1.25” inches ( 32 mm ) needle, pack of 100 ( 1 pack of 100 ) , disposable neddles23 g ( 1 pack of 100 needles ) , disposable needles 21 g ( 1 pack of 100 nedles ) , urine pregnancy strips ( 1 packof 10 strips ) , sterile sample containers plastic container ( 30ml capacity ) wide open mouth, individually packed. ( 1 pack 50 ) , cotton ( 1 roll500gm ) , gram stain kit ( crystal violet ) ( r 1 125 ml ) , gram stain kit ( grams iodine ) ( r 2 125 ml ) , gram stain kit decolgar zar ( acetone / alchol ) ( r 3 125 ml ) , gram stain kit ( safranin ) ( r 4 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 1 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 2 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 3 125 ml ) , india ink ( 100 ml bottle ) , albert stain kit ( stain a ) ( r 1 500 ml ) , albert stain kit ( stain b ) ( r 2 500 ml ) , lectophenol cotton blue ( 1ltr. ) , lugols iodine ( 1ltr. ) , nacl crystal ( 1 kg ) , methanol ( 1 ltr. ) , surgical spirit ( 1 ltr. ) , melachite green ( 1 ltr. ) , nigrosine ( 1 ltr. ) , h2so4 ( 1 ltr. ) , kmno4 crystal ( 1 kg ) , iodine ( 1 ltr. ) , hydrogen peroxide ( 1 ltr. ) , oxidase reagent ( tetramethyl p phenylenediaminedihydochloride ) / oxidase disk ( himedia ) ( 100 disk / vial ) , rabbit plasma ( 0.1 gm / vial ) , kovac’s reagent or ehrlich reagent ( para dimethyl amino benzaldehyde ) ( 100 ml / bottle ) , potassium nitrate ( kno3 ) ( 100 ml / bottle ) , sodium deoxycholate ( 10 ml / bottle ) , bacitracin disk ( 100 disk / vial ) , potassium iodide ( 500 gm ) , potassium hydroxide ( 100 gm / bottle ) , antisera salmonella , antisera shigella dysenteriae ( 1 kit ) , antisera shigella flexneri ( 1 kit ) , antisera shigella sonnei ( 1 kit ) , antisera shigella boydii ( 1 kit ) , antisera vibrio cholera ( 1 kit ) , atcc strain e. faecalis 29213 ( 1 kit ) , atcc strain e. coli 25922 ( 1 kit ) , atcc strain e. coli 35218 ( 1 kit ) , atcc strain p. aeruginosa 27853 ( 1 kit ) , atcc strain s. aureus 25923 ( 1 kit ) , atcc strain s. aureus 29213 ( 1 kit ) , wide mouth sterile / universal container , disposable syringe ( 5 ml ) ( nos ) , disposable syringe ( 10 ml ) ( nos ) , disposable syringe ( 3 ml ) ( nos ) , wooden applicator standard size ( nos ) , spatula ( standaed ) ( nos ) , inoculation loop and wire 2 mm ( nos ) , inoculation loop and wire4 mm ( nos ) , conical flask ( 100 ml ) ( nos ) , conical flask ( 250 ml ) ( nos ) , conical flask ( 500 ml ) ( nos ) , conical flask ( 1000 ml ) ( nos ) , measuring cylinder ( 50 ml ) ( nos ) , measuring cylinder ( 100 ml ) ( nos ) , measuring cylinder ( 1000 ml ) ( nos ) , beaker ( 50 ml ) ( nos ) , beaker ( 100 ml ) ( nos ) , beaker ( 250 ml ) ( nos ) , beaker ( 500 ml ) ( nos ) , test tube ( 5ml ) ( nos ) , test tube ( 10ml ) ( nos ) , test tube ( 20ml ) ( nos ) , test tube holder standard size ( nos ) , test tube rack ( 5ml ) ( nos ) , test tube rack ( 10 ml ) ( nos ) , test tube rack ( 20 ml ) ( nos ) , staining stand ( nos ) , slide box ( nos ) , petri dish ( 90 mm ) size 90 x 15 mm ( nos ) , petri dish ( 120 mm ) size 90 x 15 mm ( nos ) , cavity slide ( 100 slide / box ) , cover slip ( 100 per / box ) , wash bottles ( 500 ml ) ( 500 ml volume ) , tissue paper roll ( nos ) , staining rack ( nos ) , cotton thread for spirit lamp ( nos ) , blood culture bottles ( 100 ml ) bio merieux closed system ( aerobobic paediatric anaerobic ) ( 100 ml / bottle ) , spirit lamp , bacteriological peptone ( 100 gm / bottle ) , beef extract ( 100 gm / pack ) , yeast extract ( 100 gm / pack ) , malt extract ( 500 gm / bottle ) , nutrient agar ( 500 gm / bottle ) , blood agar base ( 500 gm / bottle ) , cled agar ( 500 gm / bottle ) , macconkey agar ( 500 gm / bottle ) , agar agar ( 500 gm / bottle ) , robertson cooked meat broth ( 500 gm / bottle ) , bile salt agar ( 500 gm / bottle ) , tcbs ( 500 gm / bottle ) , bile aesculin agar ( 500 gm / bottle ) , brain heart infusion broth ( 500 gm / bottle ) , mueller hinton agar ( 500 gm / bottle ) , pikes media ( h. inf. ) ( 500 gm / bottle ) , plet media ( b. anthracis ) ( 500 gm / bottle ) , pnf medium ( s. pyogenes ) ( 500 gm / bottle ) , l j medium ( 10 pcs / bottle ) , l j medium ( 50 pcs / bottle ) , l j medium ( 100 pcs / bottle ) , sda ( 500 gm / bottle ) , bile salt agar ( 500 gm / bottle ) , ss agar ( 500 gm / bottle ) , sorbotolmacconkey agar ( ehec ) ( 500 gm / bottle ) , tetrathionate broth ( 100 gm / bottle ) , selenite f broth ( 100 gm / bottle ) , stuart transport medium ( 100 gm / bottle ) , thayer martin medium ( 100 gm / bottle ) , triple sugar iron agar ( 50 gm / bottle ) , sim medium ( 100 gm / bottle ) , simmon’s citrate agar ( 100 gm / bottle ) , christensen urea agar ( 100 gm / bottle ) , dca ( 100 gm / bottle ) , pre reduced anaerobically sterilized media ( 100 gm / bottle ) , mannitol salt agar ( 100 gm / bottle ) , xld agar ( 100 gm / bottle ) , wilson blair brilliant green bismuth sulphite agar ( 100 gm / bottle ) , hoyle’s tellurite lysed blood agar ( 100 gm / bottle ) , mrvp broth ( 100 gm / bottle ) , glucose ( 100 gm / bottle ) , sucrose ( 100 gm / bottle ) , lactose` ( 100 gm / bottle ) , maltose ( 100 gm / bottle ) , mannitol ( 100 gm / bottle ) , inulin ( 100 gm / bottle ) , amikacin 30?g ( 50 disk / vial ) , amikacin 30?g ( 100 disk / vial ) , amoxicillin 25 ?g ( 50 disk / vial ) , amoxicillin 25 ?g ( 100 disk / vial ) , ampicillin / cloxacillin10 ?g ( 50 disk / vial ) , ampicillin / cloxacillin10 ?g ( 100 disk / vial ) , amoxicillin + clavulanic acid20+10 ?g ( 50 disk / vial ) , amoxicillin + clavulanic acid20+10 ?g ( 100 disk / vial ) , ampicillin +salbactam 10+10 ?g ( 50 disk / vial ) , ampicillin +salbactam 10+10 ?g ( 100 disk / vial ) , azithromycin 15 ?g ( 50 disk / vial ) , azithromycin 15 ?g ( 100 disk / vial ) , aztreonam 30 ?g ( 50 disk / vial ) , aztreonam 30 ?g ( 100 disk / vial ) , bacitracin 130 ?g / ?l ( 50 disk / vial ) , bacitracin 130 ?g / ?l ( 100 disk / vial ) , carbenicillin100 ?g ( 50 disk / vial ) , carbenicillin100 ?g ( 100 disk / vial ) , cefaclor30 ?g ( 50 disk / vial ) , cefaclor30 ?g ( 100 disk / vial ) , cefalexin30 ?g ( 50 disk / vial ) , cefalexin30 ?g ( 100 disk / vial ) , cefazolin30 ?g ( 50 disk / vial ) , cefazolin30 ?g ( 100 disk / vial ) , cefepime30 ?g ( 50 disk / vial ) , cefepime30 ?g ( 100 disk / vial ) , cefixime 5 ?g ( 50 disk / vial ) , cefixime 5 ?g ( 100 disk / vial ) , cefoperazone 75 ?g ( 50 disk / vial ) , cefoperazone 75 ?g ( 100 disk / vial ) , cefoparazone+ salbactam75+30 ?g ( 50 disk / vial ) , cefoparazone+ salbactam75+30 ?g ( 100 disk / vial ) , cefotaxime30 ?g ( 50 disk / vial ) , cefotaxime30 ?g ( 100 disk / vial ) , cefotetan 30 ?g ( 50 disk / vial ) , cefotetan 30 ?g ( 100 disk / vial ) , cefoxitin30 ?g ( 50 disk / vial ) , cefoxitin30 ?g ( 100 disk / vial ) , cefpirome30 ?g ( 50 disk / vial ) , cefpirome30 ?g ( 100 disk / vial ) , cefpodoxime10 ?g ( 50 disk / vial ) , cefpodoxime10 ?g ( 100 disk / vial ) , ceftazidime30 ?g ( 50 disk / vial ) , ceftazidime30 ?g ( 100 disk / vial ) , ceftriaxone30 ?g ( 50 disk / vial ) , ceftriaxone30 ?g ( 100 disk / vial ) , cefuroxime30 ?g ( 50 disk / vial ) , cefuroxime30 ?g ( 100 disk / vial ) , cephalotin30 ?g ( 50 disk / vial ) , cephalotin30 ?g ( 100 disk / vial ) , chloramphenicol 30 ?g ( 50 disk / vial ) , chloramphenicol 30 ?g ( 100 disk / vial ) , ciprofloxacin5 ?g ( 50 disk / vial ) , ciprofloxacin5 ?g ( 100 disk / vial ) , clarithromycin15 ?g ( 50 disk / vial ) , clarithromycin15 ?g ( 100 disk / vial ) , clindamycin2 ?g ( 50 disk / vial ) , clindamycin2 ?g ( 100 disk / vial ) , colistin 10 ?g ( 50 disk / vial ) , colistin 10 ?g ( 100 disk / vial ) , doripenem10 ?g ( 50 disk / vial ) , doripenem10 ?g ( 100 disk / vial ) , doripenem30 ?g ( 50 disk / vial ) , doripenem30 ?g ( 100 disk / vial ) , ertapenem10 ?g ( 50 disk / vial ) , ertapenem10 ?g ( 100 disk / vial ) , erythromycine15 ?g ( 50 disk / vial ) , erythromycine15 ?g ( 100 disk / vial ) , fosfomycin 200 ?g ( 50 disk / vial ) , fosfomycin 200 ?g ( 100 disk / vial ) , gentamicin 10 ?g ( 50 disk / vial ) , gentamicin 10 ?g ( 100 disk / vial ) , gentamicin ( high load ) 120 ?g ( 50 disk / vial ) , gentamicin ( high load ) 120 ?g ( 100 disk / vial ) , imipenem10 ?g ( 50 disk / vial ) , imipenem10 ?g ( 100 disk / vial ) , kanamycin30 ?g ( 50 disk / vial ) , kanamycin30 ?g ( 100 disk / vial ) , levofloxacin5 ?g ( 50 disk / vial ) , levofloxacin5 ?g ( 100 disk / vial ) , lincomycin15 ?g ( 50 disk / vial ) , lincomycin15 ?g ( 100 disk / vial ) , linezolid30 ?g ( 50 disk / vial ) , linezolid30 ?g ( 100 disk / vial ) , meropenem10 ?g ( 50 disk / vial ) , meropenem10 ?g ( 100 disk / vial ) , moxifloxacin5 ?g ( 50 disk / vial ) , moxifloxacin5 ?g ( 100 disk / vial ) , nalidixic acid30 ?g ( 50 disk / vial ) , nalidixic acid30 ?g ( 100 disk / vial ) , netilmicin 30 ?g ( 50 disk / vial ) , netilmicin 30 ?g ( 100 disk / vial ) , nitrofurantoin300 ?g ( 50 disk / vial ) , nitrofurantoin300 ?g ( 100 disk / vial ) , norfloxacin 10 ?g ( 50 disk / vial ) , norfloxacin 10 ?g ( 100 disk / vial ) , ofloxacin 5 ?g ( 50 disk / vial ) , ofloxacin 5 ?g ( 100 disk / vial ) , oxacillin1 ?g ( 50 disk / vial ) , oxacillin1 ?g ( 100 disk / vial ) , penicillin6 ?g / 10iu ( 50 disk / vial ) , penicillin6 ?g / 10iu ( 100 disk / vial ) , piperacillin100 ?g ( 50 disk / vial ) , piperacillin100 ?g ( 100 disk / vial ) , piperacillin+tazobactam100+10 ?g ( 50 disk / vial ) , piperacillin+tazobactam100+10 ?g ( 100 disk / vial ) , polymixin50 ?g / 300 ui ( 50 disk / vial ) , polymixin50 ?g / 300 ui ( 100 disk / vial ) , quinupristin dalfopristin15 ?g ( 50 disk / vial ) , quinupristin dalfopristin15 ?g ( 100 disk / vial ) , rifampicin5 ?g ( 50 disk / vial ) , rifampicin5 ?g ( 100 disk / vial ) , spectinomycin 100 ?g ( 50 disk / vial ) , spectinomycin 100 ?g ( 100 disk / vial ) , streptomycin10 ?g ( 50 disk / vial ) , streptomycin10 ?g ( 100 disk / vial ) , streptomycin ( high load ) 300 ?g ( 50 disk / vial ) , streptomycin ( high load ) 300 ?g ( 100 disk / vial ) , teicoplanin 30 ?g ( 50 disk / vial ) , teicoplanin 30 ?g ( 100 disk / vial ) , tetracycline 30 ?g ( 50 disk / vial ) , tetracycline 30 ?g ( 100 disk / vial ) , ticarcillin75 ?g ( 50 disk / vial ) , ticarcillin75 ?g ( 100 disk / vial ) , ticarcillin+clavulanic acid 75+10 ?g ( 50 disk / vial ) , ticarcillin+clavulanic acid 75+10 ?g ( 100 disk / vial ) , tigecycline15 ?g ( 50 disk / vial ) , tigecycline15 ?g ( 100 disk / vial ) , tobramycin10 ?g ( 50 disk / vial ) , tobramycin10 ?g ( 100 disk / vial ) , trimethoprim+sulfamethoxazole1.25+23.75 ?g ( 50 disk / vial ) , trimethoprim+sulfamethoxazole1.25+23.75 ?g ( 100 disk / vial ) , trimethoprim5 ?g ( 50 disk / vial ) , trimethoprim5 ?g ( 100 disk / vial ) , vancomycin 30 ?g ( 50 disk / vial ) , vancomycin 30 ?g ( 100 disk / vial ) , polymyxin b ( 50 disk / vial ) , polymyxin b ( 100 disk / vial ) , optochine disc ( 50 disk / vial ) , optochine disc ( 100 disk / vial ) , cedar wood oil ( 100 ml / bottle ) , absolute spirit ( 500 ml / bottle ) , serum glucose ( god / pod enzymatic end point ) ( 1×500 ml ) , serum urea ( urease / gldh ) ( 10×50 ml ) , serum creatinine ( enzymatic pap method ) ( 1×100 ml ) , serum total protein ( biuret method ) ( 1×50 ml ) , serum albumin ( bcg ene point ) ( 3×50 ml ) , serum bilirubin ( diazo method ) ( 4×40 ml ) , sgot ( kinetic ) ( 5×50 ml ) , sgpt ( kinetic ) ( 5×50 ml ) , alp ( kinetic ) ( 5×50 ml ) , ggt ( glupa c kinetic ) , serum amylase ( direct substrate kinetic method ) ( 2×20 ml ) , serum lipase ( turbidometric uv method ( 2×20 ml ) , total cholesterol ( chod / pod method ) ( 2×20 ml ) , triglycerides ( gpo / pod method ) ( 2×20 ml ) , serum calcium ( ocpc method ) ( 2×20 ml ) , serum phosphorous ( uv molybdate methed ) ( 2×20 ml ) , crp ( quantitative ) ( 1×50 ml ) , serum uric acid ( uricase ) ( 2×10 ml ) , serum ldh ( kinetic ) ( 1×25 ml ) , ck mb ( kinetic ) ( 1×25 ml ) , plain vials ( 5000 nos ) , fluoride vials ( 5000 nos ) , lab detergent liquid ( lab detergent ) ( 5 ltr ) , sta lia test d dimer ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×6ml ) , sta lia test control ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 12×2×1 ) , sta desorb u ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 24×15ml ) , sta coagulation control ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 12×2×1 ) , sta neo optimal ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×5ml ) , sta cleaner solution ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×2500ml ) , sta owren koller ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 25×15ml ) , cuvette for alliquote ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) , sta compact cuvette ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) , aspen 68 ds diluentmodal : bc6800 ( for five part fully automated cell counter ) , aspen 68 ld lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fd dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen 68 lb lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 lh lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 dr diluentmodal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fr dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen 68 ln lys modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fn dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen bc 6 d control set modal : bc6800 ( for five part fully automated cell counter ) ( 6×4.5 ml ( 2l, 2n, 2h ) , aspen bc ret control set modal : bc6800 ( for five part fully automated cell counter ) ( 6×4.5 ml ( 2l, 2n, 2h ) , aspen sc cal plus calibratormodal : bc6800 ( for five part fully automated cell counter ) ( 2×3 ml ) , ldl ( direct ) ( 1×40ml ) , cba reagent ( dilute+lyse ) , hdl ( pvs / pegme direct ) ( 1×40ml ) , 40 % urea solution ( 5 ml / vial ) ...

Government Medical College - Madhya Pradesh

30268661 supply of medicine supply of medicine , injection, tablet, capsul, cream, oint, eye drop, syp, solution, ointment, iv fluid, power, gel, spary, inhaler, etc , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actinomycin 0.5 mg inj , acycloir 250 mg inj , acycloir 500 mg inj , acycloir 750 mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , vial , anti hemophillic factor viii 500 iu ( vial ) , vial , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 500mg / ml 50ml vial ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml amp , azithromycin 100mg / 5ml inj , azithromycin 200mg / 5ml inj , bendamustin 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulphan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10%10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , calcium leucovorin ( folinic acid ) 50 mg / vial 5 ml vial , carboplatin 150 mg inj vial , carboplatin 450 mg injvial , carboprost promithamin 250 mcg / ml 1ml amp , carmustin 100 mg inj vial , carmustine ( bcnu ) 100 mg vial , cefaparazone with salbactum , cefazoline 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +1000 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 100mg vial , cetuximab 200mg / 100ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection , clopixol acuphase 50 mg inj , clopixol deconate 200 mg inj , collistimate sod. 1iuvial , collistimate sod. 2iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dacarbazine 500 mginj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone 4mg vial , dexamethasone 4mg / 1mlinj , dexmedetomidine100 mg / ml amp ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diazepam 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lypholozed ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edavarane60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj amp , enoxaparin 60mg inj amp , ephedrine 30mg / ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4 k inj , erythropoietin 10000iu inj 1ml pfs , erythropoietin 40000iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , ethamsylate 125 mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fluanxol depot 25 mg inj , fludarabin 50 mg vial , fluorescein 20% 5 ml amp , flupenthioxl 20 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu ( reptilase ) botropose inj , haloperidol 5 mg / iv / im inj , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium , hydroxy progesterone caproate 250mg / ml vial , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosphamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , iohexol 350 mg i / ml ( non ionic contrast medium in sterile , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia , lignocaine hydrochloride + adrenaline , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lmwh low molecular weight heparin 40mg vial , lmwh low molecular weight heparin 60mg vial , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , metaclopromide 5mg / ml 2ml amp , methacarbamol 100 mg. / 10ml vial , methotrexate 15 ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2mlamp , micronized progesterone 200 ml vial , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 10mg / 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine supaphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nabpaclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , nekethamide amp , neostigmine 0.5 mg / ml, 1ml amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml 5 ml amp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olenzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , perinorm 2ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , prolution depot 250mg inj 1ml amp , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / 20ml vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , ropivacaine 10mg / ml 2.5ml vial , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , sargramostin 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium thiopentone inj 0.5gm powder / vial 20ml vial , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial , tecoplanin 400mg vial , terbutalime 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml, 10 ml , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+niacinamide 12 , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin100 mg / 50 ml 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% , dextrose saline ( dns ) , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) , fat emulsion 20% 0.2 ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv , levofloxacin 500 mg / 100 ml 100 ml ffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 ml 100 ml ffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 100 ml / 200mg bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose , total parenteral nutrition 1000 ml with 763 kcal , tpn ( total parenteral nutrition ) including carbohydrate + proteins , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumaro / nicoumalone 2 mg tab , acetazolamide 250 mg tab ( dimox ) , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipne 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atiomoxetin 10 mg tab , atiomoxetin 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen od 20 mg , baclofen od 30 mg , baclofen od 40 mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonameserire 2 mg , blonameserire 4 mg , buprinoprhin 4mg , buprinoprhin 8 mg , bupropion150 mg , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate tab , calcium d3 / 500mg , calithromycin 250 mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine tab. 5mg , ciprofloxacin500 mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , cloimipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine100 mcg , clonidine 100 mg tab , clopidogrel75 mg , clopidogrel aspirin , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , crizotinib 250mg , cyclophosphamide 50 mg tab , deferasirox dispersible 500 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratuioeotudase 10mg , diclofenac 50mg + paracitamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , dosatinib 100mg / 50 mg , doxophylline400 mg , dudrogesterone 10mg , duloxetine 20 mg tab , duloxetine 30 mg tab , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , famutaz 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , flebuxostat 40mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluoxetine 40 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 10mg / 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+10mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , mag. oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mcg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyephendate 10 mg , methyephendate 20 mg , methyephendate 5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 , methyldopa 250 mg tab , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil 100 mg tab , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , , mycophenolate mofetil, 500 mg , n acetylcysteline 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxnide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , pacitane 2mg tab , palbociclib 100 mg , palbociclib 125 mg , palbociclib 75 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , piogliatazone 15 mg tab , piogliatazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubtril plus valsartan , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valporate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin$dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine sodium 100mg , thyroxine sodium 25 mg , thyroxine sodium 50mg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenidyl 2 mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , verapamil40 mg , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.3 mg tab , voriconazole 200 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , doxycycline 100 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , temozolamide 100 mg , temozolamide 250 mg , sildenafil 20mg , vit. e400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , hypersol s ( 5% ) , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution , pilocarpine eye drops 2% , polyvinyle alcohol 1.4% 5 ml , prednisolon eye / drop. , proparacaine , sodium chloride 5% eye drop ( nacl 5% ) , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of , prostaglandin e2 , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethosome valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , mct oil 100ml bottle , lactobacillus, 150 million spores, , arginine sachet 10gm , hmf lactocex plus sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 , antiseptic hospital concentrate contdaining 20% chlorohexidine , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam , formaldehyde ( formalin ) 37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enima , hand wash.sol . ( sol.isoprapanol, propanol, mecetronium, skin care , hydrogen peroxide soln 20% 500 ml bottle , hypo solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant , aluminium hydro gel syp ( antacid ) 100ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondenstrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , nasoclear nasal mist spray 20 ml spray , nasoclear nasal gel 15 gm tube , nasoclear nasal wash 3gm kit , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , mouth paint clotrimazole 1%15 ml , absorable cotton roll, net 500gm , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine spangstron ip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , ag ion impregnated central venous double lumen , ag ion impregnated central venous triple lumen , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, , air bed matterses with complete set , airway size 3, 4, 5, 5.5 , airway size 6, 7.5 , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , antimicrobial incise drape 3 m , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps , biopsy gun , bipap mask , biploar forceps cable , bipolar cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set , bone marrow aspiration needles ( 14 ) ( medevolution ltd ) , bone marrow aspiration needles ( 15 ) ( medevolution ltd ) , bone marrow aspiration needles ( 16 ) ( medevolution ltd ) , bone marrow aspiration needles13 g ( medevolution ltd ) , bone marrow biopsy needle , bone wax , bp cuff adult & pead. , camera cover , cannula fixer set , carbolic acid 500 ml , c arm cover , catheter mount adult size , catheter mount peadiatric size , cautery pencil , cautery plate ( reusable ) , central line double luman 16g , central line singal luman , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine gauze dresssing b.p antiseptic tulle gas dressing , collagen patch 30x30 , colostomy kit , computer radiography x ray film ( fuji ) 10x12 pkt , computer radiography x ray film ( fuji ) 14x17 pkt , computer radiography x ray film ( fuji ) 8x10 pkt , condom catheter , card clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crape bandage 2 , crape bandage 4 , crape bandage 6 , cvc line double lumen polyurethane catheter ( flexon , cvc line triple lumen polyurethane catheter ( flexon material ) with , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dengue card test 100 test kit , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or , disp paper gloves , dispo cap , dispo face mask triple layer ( standard ) , dispo hivfull protecatin kit , dispo. n95 mask , disposable needle 18g ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx1 / 2 , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , distilled water 5 lit. , double lumen peripherally inserted central venous silicon , double lumen peripherally inserted central venous silicon , drap sheeth 120cm x 210cm sterile , ear buds , ecg disposabile electrode , ecg paper ( wax coated ) 50mmx30 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed4 , endotracheal tube cuffed5 , endotracheal tube cuffed 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffedsize 9.5 , endotracheal tubes plain without cuff size 2, , endotracheal tubes plain without cuff size2.5, , endotracheal tubes plain without cuff size3 , endotracheal tubes plain without cuff size3.5, , endotracheal tubes plain without cuff size 4 , endotracheal tubes plain without cuff size 4.5 , endotracheal tube with secondary lumen for , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination glovesmedium pair , examination glovessmall pair , examination gloves large pair , exchange transfusion catheter with four way adaptor size 4cm, l , extention line 10cm , extention line 50cm , extention line 100cm , extention line 150cm , extention line 200 cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluroscein strips pkt , fogharty cathetor 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley triway no 20 two way , foley urinary catheter size 8 10 pediatrics , gigli saw wire , glass slide , glass tube 125x150 , glucometer strips , gudel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hickman catheter double lumen7.7 no , hickman catheter single lumen4.7 no , hickman catheter single lumen6.6 no , hickman catheter single lumen7.7 no , hme filter , humbeysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain , insulin syringe , intravenous drip set adult size , intravenous drip set pediatric size , iv .regulator set ( control drop set ) , iv cannula size 16 g , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , juglarcatheter 12 fr ( adult ) , juglar catheter 8fr ( pediatric ) , k 90 catheter , kallis pad disposable , liga clip 200, 300, 400 , long length quincke spinal needle for pain management, size – g , lung excersizer , lysol ( cresol with soap solution ) 5ltr jar , mackintosh double colour water proof , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , mesure volume set soft chamber, with bulb latex 110ml , micro drip set with bulb latex , micropore 6” , monopolar coutry wire , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , nebulazation mask ( set ) adult & pediatric , neonatal urine collection and measurement bag , niv mask venti cpap ( large & medium ) , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural , non sterile surgical rubber gloves 7 no. ( pair ) made of natural , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural , o maya large / small , oxygen catheter , oxygen connection for central line , oxygen connection for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , paediatric double lumen polyurethan cvc line, 3 fr, l , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g , paediatric triple lumen polyurethan cvc line with nitinol j guide , paper adhesive plaster microporous surgical tape 2inch x 10mt , paper adhesive plaster microporous surgical tape 3inch x 10mt , paper adhesive plaster microporous surgical tape 4inch x 10mt , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm peadiatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , pt vial / tube ( prothrombin vial / tube ) , radial a catheter , rectified sprit 4.5 ltr. , ryles tube size 10, 12, 14, 16, 18 , schirmer strips , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes. , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , sterilant cold disinfectant for dialysis containing peraetic acid , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile gauze swab / pad packets , sterile hypodermic syringe with needle 03 ml , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 2ml , sterile hypodermic syringe with needle 50ml / 60ml , sterile hypodermic syringe with needle 5ml , sterile luerlock syringe 10 ml , sterile luerlock syringe 5 ml , sterile leurlock syringe 20ml , sterile leurlock syringe 50ml , sterlie gloves isi 6.5 made of natural latex, micro rough finish , sterlie gloves isi size7.5 made of natural latex, micro rough , sterlie gloves isi size8 made of natural latex, micro rough , sterlie gloves isi size 7 made of natural latex, micro rough , sterlie powder free glovessize6.5 made of natural latex, micro , sterlie powder free glovessize7 made of natural latex, micro , sterlie powder free glovessize7.5 made of natural latex, micro , sterlie powder free glovessize8 made of natural latex, micro , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tegaderm ( cvl dressing ) 10 cm*12 cm , tegaderm ( cvl dressing ) 7 cm* 8.5 cm , tegaderm ( samll ) i / v , thermometer , thomas splint , transducer set for invasive b.p. , three way stop cock , tmt paper , tounge depresser , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula paed. , urine collecting bag , urine collecting bag with urometer , urine sugar diagnostic stick , vaccum jar 1000 ml , vaccum jar 2000 ml , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt , x ray films size 12x15 50film per pkt , x ray films size 8x10 50film per pkt , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankar suction catheter ( complit set ) , pacing leads 6 fr , introducer sheath 6fr , pigtail catheter 6 fr ( 150 cm ) , j tip 0.035 mm guidewire , black braided silk eyeless needled suture usp, code 5036 size 2 , black braided silk eyeless needled suture usp, code 5082 size 4 , black braided silk eyeless needled suture usp, code 5333 size 2 , blackbraided silk eyeless needled suture usp, size 5 0 , blackbraided silk eyeless needled suture usp, size 6 0 , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 , braided synthetic absorbable eyeless needled suture usp code , braided synthetic absorbable eyeless needled suture uspbraided , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in , oxidized regenerated cellulose based topical absorbable hemostar , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , surgical silk braded ( sutupack ) sterile foilover wrappack code 213 , surgical silk braded ( sutupack ) sterile foilover wrappack code 214 , surgical silk braded ( sutupack ) sterile foilover wrappack code 215 , vicryl 2.0 round body needle , 20g round body cutting needle 1 / 2 circle , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , monofilament glycomer 631* 3 0 75cm, undyed24mm3 / 8 , monofilament glycomer 631* 3 0 75cm, violet22mm1 / 2 , monofilament glycomer 631* 1 , 90cm, violet40mm1 / 2 circle , monofilament glycomer 631* 2 0 , 75cm, violet27mm1 / 2 , monofilament glycomer 631* 0, 90cm, violet40mm1 / 2 circle , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , poliglecaprone 25 undyed with irgcare mp3 0, 3 / 8 circle reverse , polydioxanone lrgacare mp coated 150cm usp1 0 rb ctx, 1 / 2 , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle , 180 absorbablepolyglyconate knotless wound closure device with , 180 absorbablepolyglyconate knotless wound closure device with , 90 glycomer 631knotless wound closure device with , 90 glycomer 631knotless wound closure device with , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , synthetic absorbable surgical suture , polyglactin 910 with irgacare , synthetic absorbable surgical suture irgacare coated monofilament , absorbable unidirectional barbed device symmetric anchoring , absorbable adhesion barrier in the form of off white knitted fabric , polyster braided polybutylatecodated 1 / 2 circle tapercut double , triclosan antibacterial coated polyglactin 910 with 23 mm needle , protective disk with chg hydrophilic polyurethane absorptive foam , protective disk with chg hydrophilic polyurethane absorptive foam , self gripping polyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , absorbable intraperitoneal umbilical patch of polyester mesh with , absorbable intraperitoneal umbilical patch of polyester mesh with , ada kit , aluminium ammonium sulphate powder 500gm , ana 96 well , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera , anti ab sera , anti a lactin , anti b sera , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , diagnostic strip for urine ( sugar and albumin ) , diamond pencil , dpx mount 250ml ( urgent ) , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , glass slide iso mark no 12mm , haematoxylene 5gm ( urgent ) , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , m .p elisa , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , mp antigen test kit rapid , n / 10 hcl 500ml , nitrile gloves size small / medium / large , p t tubes 3.8% sodium citrate , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test strip , vdrl rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , surgical blade 22 no carbon steel , sugar albumin uristics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for pediatric ( bac t / alert pf , blood culture media anaerobic for pediatric ( bac t / alert , ki67 / mib 106 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close , disposable circular stapler 26mm diameter , disposable circular stapler 29mm diameter , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable linear stapler with fixed staple height 55mm 60mm , disposable linear stapler with fixed staple height 75mm , reload 55 60mm for thin / vascular tissue white compatible , reload 55 60mm for medium thick tissue blue compatible , reload 75 80mm for medium thick tissue blue compatible , reload 75 80mm for thick tissue green compatible with , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposble skin stapler with pins , disposable hemorrhoidal stapler with detachable anvil. , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 55mm 60mm , reload for linear stapler with fixed staple height 55mm 60mm , disposable curved cutter stapler , polycearbonte bladeless frocar with reducer seal 5mm , polycearbonte bladeless frocar with reducer seal 10mm , polycearbonte bladeless frocar with reducer seal 12mm , reload for linear cutter 55mm 60mm size blue , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload for linear cutter 90mm 100 mm size blue , reload forlinear cutter 90mm 100 mm size green , reusable laparoscopic clip applicator for medium large titanium , reusable laparoscopic clip applicator for large titanium clips with , mesh fixation device with non absorbable titatinum tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , mesh fixation device with 30 poly ( lactide co glycolide ) , mesh fixation device with 15 poly ( lactide co glycolide ) , partially absorbable mesh with absorable & semi , partially absorbable mesh with absorable & semi absorbable , polyprplene with polyglecaprone 25 partially absorbable mesh , polyprplene with polyglecaprone 25 partially absorbable mesh , skin staple remover with plastic handle , distal tip closure titanium ligation clip small size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip medium large size , distal tip closure titanium ligation clip large size , reusable laparoscopic clip applicator for large titanium , reusable laparoscopic clip applicator for medium large , reusable laparoscopic clip applicator for large titanium , dispoable trocar 05mm , dispoable trocar 10mm , dispoable trocar 12mm , dispoable trocar 15mm , disposable curved cutter stapler , reload compatible with curved cutter , endoscopic cutter & staplter60mmlong , endoscopic cutter & staplter60mm , reload endoscopic cutter & staplter60mm white / , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter45mm blue , endosuturing device 10mm with toggle lever , absorbable 2 0 endo suture cartridge 48 length , non absorbable 2 0 endo suture cartridge 48 length , disposable clip applier medium 5mm with 16 clips , disposable clipapplier medium 10mm with 20 clips , multifire clip applier small size 20 clip , multifire cliip applier long size 15 clips , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , suture locking , plastic locking clip applicator medium / large , locking clip cartridge medium / large , open clip appkicator 100 lt / 200 lt / 300 lt / 400 lt , titanium clip 100 lt / 200 lt / 300 lt / 400 , instrument tray 8×6 inch , instrument tray 9×6 inch , instrument tray 10×8 inch , instrument tray 11×7 inch , instrument tray 12×10 inch , instrument tray 14×10inch , instrument tray 15×12 inch , instrument tray 18×12 inch , instrument / dressing drum 9×5 inch , instrument / dressing drum 9×9 inch , instrument / dressing drum 10×8 inch , instrument / dressing drum 11×9 inch , instrument / dressing drum 14×9 inch , instrument / dressing drum 15×12 inch , formalin chamber 20 inch ( 20x8x8 ) 3 tray , formalin chamber 14inch 3 tray , formalin chamber 10 inch 2 tray , kidney tray set ( 150mmx200mmx250mmx300 mm ) , stainless steel cidex box with lid 10 lits ( 27x6x5 “ ) , ulv fogging machine , sanishieldsolution , ot slipper orthopedic soft , s.s sterilization autoclave , square box 20cmx20cm , s.s sterilization autoclave , square box 20cmx10cm , ent surgical micromotor drill system , micro ear burr tungsten carbide cutting 70mm , micro ear burr tungsten carbide cutting 0.5 mm , micro ear burr tungsten carbide cutting 0.60mm , micro ear burr tungsten carbide cutting 1 mm , micro ear burr tungsten carbide cutting 1.50 mm , micro ear burr tungsten carbide cutting 2.00 mm , micro ear burr tungsten carbide cutting 2.50 mm , micro ear burr tungsten carbide cutting 3.00 mm , micro ear burr tungsten carbide cutting 3.50 mm , micro ear burr tungsten carbide cutting 4.00 mm , micro ear burr tungsten carbide cutting 4.50 mm , micro ear burr tungsten carbide cutting 5.00 mm , micro ear burr tungsten carbide cutting 5.50 mm , micro ear burr tungsten carbide cutting 6.00 mm , micro ear burr tungsten carbide cutting 6.50 mm , micro ear burr tungsten carbide cutting 7.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.60 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 1 mm , micro ear burr tungsten carbide diamond / polishing 70mm length1.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 2.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length2.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length3.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 3.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 7.00 mm , bulls lampstand &100watt bulbs , head mirror , otoscope ( heine fibro optic ) , thudicum nasal speculum , lac’s tongue depressor ( metalic reuseable ) , in direct laryngoscopy mirrors , st clairs tompsons posterior rhinoscopy mirrors , hartmann aural speculum , shea aural speculum , tumarkin aural speculum , verhoeven micro ear suction tip , ear microsuction tip adapter , nasal suction tip , suction apparatus , siegles speculum , tuning fork ( 256hz, 512hz, 1024hz ) , bayonet forceps , jobson horne probe , steilizer ( boiler ) , bp apparatus , stethoscope , tilleys nasal dressing forcep , hartman nasal packing forcep , loop vectix wire , instrument tray 10inch x 15 inch , ent opd led head light , metalic washerless aural syringe ( simpson’s ) , tilley lichwitz s trocar&canula , tongue tie release butterfly forcep all size , sprit lamp , barany noise box , ear vectis with cerumen spud , hartmann aural forceps , trocltsch aural forceps , lucas curved aural forceps , eustachian tube catheter , mac ewen cell seeker and curette , alligator forceps , nasal foreign body hook , higginson syringe , tilleys antral harpoon , myle nasoantral perforator , st clair thompson quinys forceps , cidex box 45 cm and 35 cm and 24 cm , formalinchamber ( 35 cm & 45 cm ) , cheatle sterilizerforceps , cheatle forceps jar , bandage cutting scissors , x ray view box , opd sterlizing fogger machine , ultrasonic instrument cleaner , curved scissor 6 inch , formalin chamber 24 cm , savalon solution , bowl , romposon suction tube , nasal suction tip , tilleys forcep , lidocaine 4% solution 30 ml , gauze cloth 91 cm / 20 m , macintos 20×1 mtr , surgical mopping pad , adk drain 24 no , adk drain 28 no , chest tube with trocar 20 no , chest bag under waterseal 26 no , romovac suction drain 16 no , romovac suction drain 14 no , romsons corrugated drain , harnia mesh kit 3×6 inch , intraoclar lens ( 15 no to 27 no ) , viscoelastic substance , balanced salt solution , formalin solution , acetone solution , inj. hylase ( hyluronidase ) , lignocaine 2%+ adrenaline , inj.gentamicin , inj. phenylephrine 10 mg / 1 ml , cuticell10*10 cm , cuticell 10*30 cm , hand wash soln 500 ml , microgen d 125 , iv ns3 % 100 ml , iso p 500 ml , iv ns 0.45% 500 ml , guedal airway size 000, , guedal airway size 00, , silicon mask adult size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , ansthesia work station disposable circuit ( adult ) , laryngoscope ( paedeatric ) a machintosh size 00, , laryngoscope ( paedeatric ) b miller blade size , 0, , laryngoscope ( paedeatric ) a machintosh size , 1, , laryngoscope ( paedeatric ) b miller blade size size , 1, , laryngoscope ( paedeatric ) b miller blade size , 2 , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , maccoy laryngoscope with bladesize 5 , lma ( proseal ) size 1, , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , lma ( i gel ) size 1 , lma ( i gel ) size 1.5 , lma ( i gel ) size 2 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 6.5 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating bougie , ventilating bougie , ansathesia face mask silicone transparentsize 00 , ambu bag ( padeatric ) 150 ml , micropore 0.5inch , micropore 1 inch , magill forcep ( adult ) , magill forcep ( padeatric ) , video laryngoscope with blade 2 ( c mac ) , video laryngoscope with blade 3 ( c mac ) , video laryngoscope with blade 4 ( c mac ) , centralvenous catheterkit ( paedeatric ) , pressure bag 1000 ml , pressure bag 500 ml , nebulizer machine , head ring ( peadia ) , head ring ( adult ) , hot air warmer , 3 way extension 25 cm , needle cutter , 3 way extension 100 cm , electric surgical instrument boiler ( 24*8*8 ) inch , electric surgical instrument boiler ( 20*8*7.5 ) inch , tee oxygenator ( t piece ) , tub big50 litr , detergent powder 500 gm , rubber sheet macintos20m roll , capmask / cloth based , towels ( small ) , towels ( large ) ) , shoe cover / cloth based , disposablesurgical gown , combined epidural spinal set ( 18g ) , hernia mes ( polypropylene ) 3*6 inch , north & southpole indotracheal tube ( rate tube ) size 3.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 04 ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 4.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 05, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 5.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 06, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 6.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 07, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 7.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 08 ( ring adair elwiny ) , betadine scrub ( 500 ml ) , betadine solution ( 500 ml ) , nylon 2.0 ( cutting needle ) suture , ethilone 2.0 , condom , g bone , mirena 50 , bupevacine inj ( 20 ml ) , pregnancy kit , infrared thermometer gun , nebuliser mask ( paedia ) , needle cutter electrical , steam disinfectant system, ( fumigation machine ) , surgical poly wrap , tripple lumen central line adult , uroflometer , pulse oxymeter , nasopharyngealairway size 5.5 , nasopharyngealairway size 6 , nasopharyngealairway size 7 , nasopharyngealairway size6.5 , nasopharyngealairway size7.5 , steel scissor 10 no , steel tray ( small ) , steel tray ( large ) , steel tray ( medium ) , bb splint , disposable catheter mount , tooke corneal knife ( num ) , inj. adenosine 6 mg / 2 ml , inj. adrenaline 1 mg / ml , inj. adrenaline 1 mg , inj. alamine 200 ml , inj. albumin iv 20% 100 ml , inj. amikacin500 mg , inj. amikacin ( 250mg / 2ml ) , inj. amiodarone 150 mg , inj. amoxycillin + clav. acid1.2 g , inj. amoxycillin + clavulanic acid 1.2 gm , inj. amoxycillin 500 + clavulanic acid 100 mg , inj. amphotericin b 50 mg , inj. anti rabis immunoglobulin ( inj. arv ) , inj. antisnake venom 10 ml , inj. artemether 80 mg , inj. artesunate 60 mg , inj. artesunate 60mg , inj. arv / antirabies vaccine , inj. atracurium50 mg ( 5 ml ) , inj. atracurium 10 mg ( 2.5ml ) , inj. atropin 1 ml / 0.6 mg , inj. atropine 0.6 mg , inj. bupivacaine 0.5 % 20 ml , inj. bupivacaine 0.5 % 4 ml ( heavy ) spinal , inj. bupivacaine hydrochloride 0.25% 20 ml , inj. calcium gluconate 10% ( 10 mg ) , inj. calcium gluconate 10% 10ml , inj. carboprost 250 mg , inj. cefazolin1 gm , inj. cefoperazone 1000mg + sulbactam 1000mg , inj. cefotaxime sodium500 mg , inj. cefotaxime sodium500 mg / vial , inj. cefotaxime sodium 1 gm , inj. ceftriaxone500mg vial , inj. ceftriaxone ( 250mg vial ) , injection , inj. ceftriaxone+ sulbactam , inj. chlorpheniramine 25 mg , inj. ciprofloxacin 200 mg , inj. clindamycin 600 mg , inj. clindamycin 300 mg , inj. clindamycin 900 mg , inj. colistin3 miu , inj. colistin4.5miu , inj. colistin 2miu , inj. colistin 9miu , inj. deriphyline , inj. dexamethasone 8 mg , inj. dexmeditomidine 100 mcg / 1 ml , inj. diazepam 10mg , inj. diazepam 5mg , inj. diclofenac 25 mg , inj. dicyclomin 10 mg , inj. dicyclomine 10 mg , inj. digoxin 0.5 mg / 2 ml , inj. dilitiazemiv 25 mg , inj. dobutamine 250 mg , inj. dobutamine 250 mg ( 5ml ) , inj. dopamine 40 mg , inj. dopamine 5ml , inj. enoxaparine 40 mg , inj. enoxaparine 60 mg , inj. ephedrine30 mg / 1 ml , inj. esmolol 100 mg , inj. ethamsylate250mg , inj. etomidate 10 ml ( 2 mg / ml ) , inj. fentanyl 2 ml ( 50 mg / ml ) , inj. flumazenil 0.5 mg , inj. fortwin ( pentazocin ) 30mg , inj. frusemide 10 mg , inj. furosemide 40 mg , inj. gentamicin 80 mg , inj. gentamicin40 mg / ml , inj. gentamicin 40 mg , inj. gentamycin 80 mg / 2 ml , inj. glargin insulin 100 iu / ml , inj. glucagon 1 mg , inj. glycopyrrolate 1 ml / 0.2 mg , inj. haloperidol 2mg / ml , inj. hydralazine 10 mg , inj. hydrocortisone 100 mg , inj. hyoscine 20 mg / ml , inj. hyoscine butyl bromide 20 mg , inj. hyydrocortisone 100mg , inj. insulin nph , inj. insulin regular , inj. iron sucrose 100 mg iv 5 ml , inj. iron sucrose 50 mg / ml iv , inj. kcl 10 ml / 150 mg , inj. ketamine10 ml ( 50 mg / ml ) , inj. labetalol20 mg , inj. levetiracetam 500 mg , inj. levofloxcillin100 ml , inj. lignocaine 2 % ( 21.3 mg / ml 30 ml vial , inj. lignocaine 2%iv ( 30 ml ) , inj. linezolid 600 mg , inj. linezolid 600 mg 300 ml , inj. l orithine l asportate 5 gm , inj. loxicard 2% 20 ml iv , inj. mannitol 100 ml , inj. mannitol 100 ml , inj. mephentermine 30 mg / 1 ml , inj. meropenam + sulbactam1 gm , inj. methargine 0.5 mg , inj. methotrexate 100mg / ml , inj. methylcobalamin 500 mcg / 3ml , inj. methylprednisdone 500 mg , inj. methylprednisolone 1 gm , inj. metoclopramidehcl 5 mg / ml , inj. metoclopramide 5 mg / ml , inj. metoprolol 1 mg / ml ( 5 ml ) , inj. metoprolol 1mg / 5mliv , inj. metrogyl 100 ml , inj. mgso4 1 gm / ml ( 50% ) , inj. midazolam 1 mg / ml ( 5ml ) , inj. midazolam 1mg / 5ml , inj. mixtard insulin 100 iu / 10 ml , inj. morphine 1 ml / 10 mg , inj. moxiflox 400 mg iv , inj. multivitamin iv , inj. nalaxone 400 mg , inj. nefenamic acid 500 mg , inj. neostigmine +glycopyrrolate ( 2.5mg + 0.5mg ) 5 ml , inj. neostigmine 1 ml / 0.5 mg , inj. nitroglycerin25 mg / 5 ml , inj. noradrenaline 1ml , inj. noradrenaline 2 mg , inj. ondansetron2 mg / ml , inj. ondensetrone 8 mg / 2 ml , inj. oxytocine 10 iu , inj. pantaprazole 40 mg , inj. paracetamol 150 mg , inj. pheniramine 75mg ( 2ml ) , inj. phenylephrine 10 mg / 1 ml , inj. phenytoin 50mg , inj. phenytoin 50mg / ml , inj. pilocarpine nitrate ip 0.5 % w / v ( 1 ml ) , inj. piperacillin +tazobactam4.5 gm , inj. potassium chlorideiv 150 mg / 10 ml , inj. promethazine25 mg / 7.84 ml , inj. promethazine 25mg , inj. propofol 20 ml ( 10 mg / ml ) , inj. protamine sulfate 10 mg , inj. quinine 600 mg , inj. regular insulin 100 iu , inj. ropivacaine 0.7 % / 20 ml , inj. sodabicarbonate 10 ml , inj. streptokinase 1.2 mu , inj. succynyl choline 10 ml ( 50 mg / ml ) , inj. tecoplanin 200 mg , inj. tecoplanin 400 mg , inj. terlipressiniv 1 mg / 10 ml , inj. tetanns toxcid 5 ml , inj. thiopentanil sodium 500 mg , inj. tramadol 50 mg , inj. tranexamic acid 500 mg , inj. tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , inj. triamcinolone acetate 40mg / ml , inj. triamcinolone acetate 40mg / ml , inj. valethamate 10 mg , inj. vancomycin 1 gm , inj. vecuronium 10 mg , inj.botropase ( ( haemocoagulase 1cu ) 1ml ) , inj. verapamil 5 mg , inj. vit d33 l , inj. vit d3 6l , inj. vitamin k 10 mg , inj. xylocaine 2% intravenous , inj.adrenaline 1 ml , inj.dmpa 150 mg , tabmethyl prednisolone 16 mg , tab deriphylline ( etophylino 77mg + theophyline 23mg ) , tab fluconazole150 mg , tab fluconazole 100 mg , tab fluconazole 200 mg , tab fluconazole 300 mg , tab fluconazole400 mg , tab fluconazole 50 mg , tab hydroxyzine25mg , tab hydroxyzine 10 mg , tab.acebrophyllin + n acetyl cystine , tab.aceclofanc + paracetamol , tab.aceclofenac 100 mg , tab.amlodipine2.5 mg , tab.amlodipine5 mg , tab.amoxycillin + clavulanic acid625 mg , tab.amoxycillin 500mg , tab.aspirin 75 mg , tab.atorvastatin20 mg , tab.azithromycin 500 mg , tab.azithromycin 500mg , tab.buscopan 10 mg , tab.carvedilol 3.125 mg , tab.cefixime 200mg , tab.cepodoxime 200mg , tab.cepodoxime+clavulanic acid 325 mg , tab.cinnarizine + dimehydrate , tab.cinnarizine 25 mg , tab.clopidogrel 75 mg , tab.diclofanac+ paracetamol , tab.diclofenac 50 mg , tab.digoxin0.25 mg , tab.ethamsylate 250 mg , tab.fluconazole 150 mg , tab.furazolidone100mg , tab.glimeperide2mg , tab.glimeperide 1mg , tab.iron folic acid 400 mg , tab.lefulonamide10mg , tab.lefulonamide20 mg , tab.levocetrizine + montelukast , tab.levofloxacin 500 mg , tab.metformin 500 mg , tab.metoprolol 50 mg , tab.metronidazole 400mg , tab.nifedipine 10 mg , tab.nitrofurantoin 100 mg , tab.ofloxacine + ornidazole , tab.ofloxacine 200mg , tab.paracetamol 500mg , tab.paracetamol 650mg , tab.pheniramine maleate4 mg , tab.rabeprazole 20 mg , tab.telmisartan 40 mg , tab.thyroxine 25mg , tab.thyroxine 50mg , tab.thyroxine 75mg , tab.vildagliptin 50 mg , tab. acebrophyllin 100 , tab. acetazolamide 250mg , tab. acetylcysteine ( mucinac ) 600 mg , tab. acyclovir 800mg , tab. alprazolam0.5mg , tab. alprazolam 0.25 mg , tab. alprzolam 0.25mg , tab. amiodarone 100 mg , tab. amitriptyline 10 mg , tab. amitriptyline 25 mg , tab. amlodipin 5 mg , tab. amoxycillin + clavulanic acid625 mg , tab. arltemrthev+ lumefantrine , tab. ascorbic acid ( vitamin c ) 500mg , tab. asprin 150 mg , tab. asprin 75 mg , tab. atorvastatin 40mg , tab. azathioprine 100 mg , tab. azithromycin 500mg , tab. betahistine 8mg , tab. cabergoline 0.5 mg , tab. calcium + vit d3 500 mg , tab. carbamazepine 400mg , tab. carbimazole 10 , tab. cefelexin 500 mg , tab. cefixime 200 mg , tab. cefpodoxime200 mg , tab. cetrizine5mg , tab. cetrizine 10 mg , tab. chlordiazepoxide 10 mg , tab. chloroquine 500 mg , tab. cinnarizine ( 25 mg ) , tab. ciprofloxacin500 mg , tab. ciprofloxacin 250 mg , tab. clonazepam 0.5 mg , tab. clonazepam 0.25 mg , tab. cyclophosphamide 50 mg , tab. dapsone 100 mg , tab. dexamethasone 2 mg , tab. dexamethasone 4 mg , tab. dexamethasone 8 mg , tab. diclofenac + serratiopeptidase 10 mg , tab. dicyclomine 10 mg , tab. dicylomine 20 mg , tab. diltiazem 30 mg , tab. divalprox sodium 250 , tab. domperidone 10 mg , tab. drotaverine 40 mg , tab. escitalopram 10 mg , tab. etiophyllin + theophyllin 50 mg , tab. etizolam0.5mg , tab. etizolam 0.25 mg , tab. fexofenadine 120 mg , tab. fexofenadine 180 mg , tab. fluconazole 150mg , tab. furosemide 10 mg , tab. haloperidol 0.5mg , tab. hydrocortisone 100 mg , tab. hyoscine butyl bromide 10 mg , tab. ibuprofen 400 mg , tab. iron folic acid ( 100 mg +5 mg ) , tab. ivabradin 5mg , tab. labetalol 100 mg , tab. labetalol 200 mg , tab. levetriacetam 500 , tab. levocetrizine 10 mg , tab. levocetrizine 5 mg , tab. levocetrizine 5mg , tab. levofloxacin 250 mg , tab. levofloxacin 500 mg , tab. linezolid 600 mg , tab. mala n , tab. metformin 500mg , tab. methargine 0.2mg , tab. methotrexate 10mg , tab. methotrexate5mg , tab. methotrexate7.5 mg , tab. methotrexate 2.5 mg , tab. methyl prednisolone 32mg , tab. methylcobalamin / mecobalamin 500 mcg , tab. metoclopramide 10 mg , tab. metoprolol 25 mg , tab. metoprolol 50 mg , tab. metorolol 25mg , tab. metronidazole 200 mg , tab. misoprostol200 mg , tab. misoprostol 25 mg , tab. mv / b complex , tab. nefenamic acid&diclocylomine ( 500mg+ 20 mg ) , tab. nifidipin10 mg , tab. nintedanib 100 mg , tab. nintedanib 150 mg , tab. nitrofurantion 100 mg , tab. norethisterone 5mg , tab. norfloxacin 400 mg , tab. ofloxacin 200 mg , tab. olanzapine10 mg , tab. olanzapine 10mg , tab. olanzapine 5 mg , tab. ondensetron 4 mg , tab. oremeloxifene ( chhaya ) 30 mg , tab. oseltamivir 30mg , tab. oseltamivir75mg , tab. oseltamivir 45 mg , tab. pantaprazole+ domperidone , tab. pantaprazole 40 mg , tab. pheniramine 25mg , tab. phenytoin 100 mg , tab. pirfenidone200 mg , tab. pirfenidone400 mg , tab. prednisolone20 mg , tab. prednisolone 10mg , tab. prednisolone 10 mg , tab. prednisolone 5 mg , tab. prednisolone 5mg , tab. pregabatin + methylcobalamin 75 / 1500 , tab. pregasterone susline 200 mg , tab. propanolol 40 mg , tab. pyoridoxine sr 100 mg , tab. pyroxicame 10 / 20 mg , tab. pyroxicame 20 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. roflumilast 250 mg , tab. roflumilast 500 mg , tab. sodium valproate 500 , tab. thyrox12.5mg , tab. thyrox 100 mg , tab. thyrox 25 mg , tab. thyrox 75mg , l arginine + proanthocinidin ( argipreg ) sachet granules , tab. tramadol 100 mg , tab. toclizumab5 mg , tab. torsemide 10 mg , tab. tramadol50mg , tab. trypsin / chymotrypsine colloidal / sessatiopeptidase 100000 au , tab. ursodeoxycholic acid 300 mg , tab. verapamil 40 mg , tab. vitd3 60 k , tab. vitamin. b complex ( nfi ( prophylactic ) ) , tab. zinc oxide 20 mg , tab.doxyllamine+pyridoxine , tab.dydrogesterone 10 mg , tab.misoprostol 600 mcg , tab.ofloxacin+ornidazole , tab.thyrox 50mg , betadine pessary 200mg , tab. mtp kit ( mifepristone 200 mg+misoprostol 200 mg ) , tab.trenexa+ethamsylate , ors sachet , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , glucose powder , hiv kit / hbs ag ( surgical ppe kit ) , ketopatch , diclofenac patch , cholecalciferol granules 60000 iu , cap. ampicillin ( 250 mg ) , cap. b complex minerals with zinc , cap. doxycycllin 100 mg , cap. itraconazole200 mg , cap. methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg , cap. itraconazole 100 mg , cap. vit e 200 , cap. vit e 400 , cap. vitamin a 1 lakh iu , creamliquidparaffin , cream clotrimazole 1% 30 gm tube , cream soframycin , creambeclomethasone 30 gm tube , creambetamethasone20 gm tube , creamfusidic acid 15 gm tube , creamketoconazole 15 gm tube , cream clobetasol propionate0.5 % , cream acyclovir 5% ( 5gm ) , cream estriol 1% ( 1.5 gm ) , diclofenacgel 30 gm tube , dinoprostron gel 0.5 mg , neomycin sulphate+bacitracin zinc5mg+500 iu / gm ointment15gm tube , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment 15gm tube , oint. choline salicylate + benzalkonium chloride9% + 0.02% ( 10 gm ) , oint acyclovir. 5g , oint soframycin 10 gm , oint. chloramphenicol +dexamethasone ( 1%+0.1% ) , oint. choline salicylate + lidocaine , oint. clobectasol + salycylic acid 3 % , oint. mupirocin 2% , oint. neosporin5 gm tube , oint. povidone15 gm tube , oint. silver nitrate 15g , oint.mupirocin ( 2% w / w ( 5 gm tube ) , oint. mupirocin ( 2% w / w ( 5 gm tube ) , oint. lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) , ointment betadine 2% 5gm , placenta extract gel 20g , eye ointment ciprofloxacin0.3% ( 3gm tube ) , oint. clindamycin gel 5 gm , oint. gentamycin sulphate 0.1% ( 15gm tube ) , , ointment metrogyll p 2% , xylocaine spray 10 % , eye drop cyclopentolate 1% w / v ( 5 ml ) , , eye drop dexamethasone + gentamycin 0.1%+0.3% , eye drop carboxymethylcellulose sodium 0.5% ( 10ml ) , eye drop sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop timolol maleate0.5 %w / v ( 5 ml vial ) , eye drop gatifloxacin 0.3% 5ml , eye drop. phenylepherine hcl & tropicamide 5% + 1% 5 ml , eye drop tobramycin ( 0.3% 5ml ) , eye drop proparacaine 0.50% 5 ml / vial , eye drop. carboxymethylcellulose ip 1% w / v 10ml vial , hydroxypropyl methylcellulose ophthalmic solution 2% , hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop , eye drop olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , , eye drop providone iodine 1% ( 5 ml ) , eye drop fluconazole 3 mg ( 10 ml vial ) , eye drops pilocarpine 4% , eye drops pilocarpine hydrochloridebp 2% , eye drop ciprofloxacin+ dexamethosone ( 0.3%+0.1% ) , eye drop ofloxacin 0.3% w / v ( 5 ml vial ) , eye drop. lignocaine hydrochloride ( 4% ( 5 ml vial ) , eye dropmoxifloxacin + prednisolone 5 mg + 3 mg / 5 ml , eye dropmoxifloxacin 0.5% w / v ( 5 ml ) , , ear wax cerumenolyticeach 10 ml , nasal drop xylometazoline ( 0.1%w / v 10 ml vial , nasal spray calcitonin30 mcg , bss solution for opthalmic use ( 500ml ) , solution , eye drop atropine sulphate 1% ( 5 ml vial , ear drops gentamycin + hydrocortisone 0.3% + 1% , eye drophomatropine 2 % ( 5 ml ) , , eye drop ciprofloxacin 0.3% ( 5ml vial ) , ciprofloxacin eye ointment 0.3% ( 3gm tube ) , syp.b complex 100 ml , syp. alkacitral ( disodium hydrogen citrate ) 1.4g / ml , syp. cyproheptadine 100 ml , syp. dextrometharphin 100 ml , syp. lactulose 150 ml , syp. liv 52250 ml , syp. prednisolone 10 mg , syp. prednisolone 20 mg , syp. prednisolone 5 mg , syp. vitamin a ( 10000o iu ) 100 ml , syrp. paracetamol 125 mg ( 60ml bottle ) , syringe 50 ml , syrp. alkalizer100 ml , syrp. anti oxidant lycopen 200 ml , syrp. dextromethorphan + chlorpheniramine , syrp. dextromethorphan 10mg / 5ml ( 100ml bottle , syrp. lactulose 60 ml , syrp. potassium chloride 100mg / ml , syrp. potassium chloride 200 ml , syrp. sucralfate + oxetacaine , syrp. ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 100ml , syrp. amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) , syrup antacid , clotrimazole pessary 100 mg , clotrimazole pessary 500 mg , budecort inhaler200 mcg , budesonide inhaler ( foracort ) 0.5 mg , budesonide respules 0.5 mg , buprenorphine patch , tiotropium 18ugmdi / dpi , tiotropium 9ugmdi / dpi , xylocaine viscoussolution 4% , total parentral nutrition ( tpn ) 1 litr. , total parentral nutrition ( tpn ) 500mlperiferal , sporolac sachet ( 5 millions lactobacillus ) , soda lime granule5 kg , sodium phosphateenema 100 ml , hydrogen peroxide 3% ( 500 ml ) , surgical spirit500 ml , sevoflurane inhalation , salbutamol respules 5ml ( asthalin ) , sanitizer 500 ml , savlon solution500 ml , povidonelotion10 % 500 ml , povidonelotion5 %500 ml , povidonelotion7.5% 500 ml , peglec sachet , nebul.levosalbutamol+ipratopium bromide , liquid paraffin500 ml, bottle ) , solution , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial , lignocaine 2% jelly , iv d10% 500 ml , iv d25% 100 ml , iv ns3 % 100 ml , iv ns 0.45% 500 ml , iv. fluiddns 500ml , iv. fluidringer lactate500ml , iv fluid normal saline 500 ml , iv infusion volulyte 6 % ( hestarch ) 500 ml , iv. normal saline 0.9 % 100 ml , iv isolyte m 500 ml , iv isolyte p 500 ml , iv intralipid 20 % 100 ml , iv. intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs , isoflurane refiller 250 ml , insulin syring 40 iu 1 ml , hydrogen peroxide soln 100 ml , iv. hexa starch / voluvin 500 ml , hand sanitizer 1 ltr. , glutraldehyde 2.45 % , iv glycerine ip ( 100ml bottle ) , iv. glycerine / acriflaxin 100 ml , formetrol6 mcg + budesonide400 mcgmdi / dpi , formetrol6 mcg + budesonide 200 mcgmdi / dpi , formalin soln37 to 41 % ( 5 litr ) , enterogermina , disposable syringe 10 ml , disposable syringe 20 ml , disposable syringe 5 ml , disposablesyringe2 ml , disposable syringe50 ml , disposable needles26g , disposable needles24g , disposable needles22g , disposable needles20g , disposable needles18g , disposable needles16g , double arm nylon monofilament with 8 0 ( 3 / 8circle taper point needle ) , , disposable surgicalgloves6 no , disposable surgicalgloves6.5 no , disposable surgicalgloves 7no , disposable surgicalgloves 7.5no , disposable surgicalgloves 8no , latex examination gloves large , latex examination gloves medium , dynaplast 2 inch adhesive bandage , dynaplast 3 inchadhesive bandage , dynaplast bandage 10 cm * 4 m , disposable surgical mask , dustbin big 60 litr ( red / blue / black ) , dustbin small 30 litr ( red / blue / black ) , cotton cloth guaze than , cotton crape bandage 10cm x 4m , cotton crape bandage 15cm x 4m , cotton khadi curtain, 1.75 mt, , cotton khadi matress, 3x6 feet, 10.0kg, , cotton roll 500 gm , chadar check rangeen 84 inch x 48 inch , chadar rangeen 60 inch x 90 inch , blanket jammu woolen plane, 54x90 inch, , endotracheal cuff pressure manometer , endotracheal tube introducer ( stylet ) adult , endotrachial tube ( protex ) size 6, ( cuffed ) , endotrachial tube ( protex ) size 6, ( uncuffed ) , endotrachial tube ( protex ) adult size , 7 ( cuffed ) , endotrachial tube ( protex ) adult size , 6.5 ( cuffed ) , endotrachial tube ( protex ) adult size 7.5 ( cuffed ) , endotrachial tube ( protex ) adult size 8, ( cuffed ) , endotrachial tube ( protex ) adult size 8.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size 5.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size , 3 ( uncuffed ) , endotrachial tube ( protex ) padeatric size 2.5, ( uncuffed ) , endotrachial tube ( protex ) padeatric size 5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 3.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4, ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 5, ( cuffed ) , epidural needle with catheter ( mini pack ) size 18 g , et tube ( cuffed ) 7no , et tube ( cuffed ) 6.5 no , et tube ( cuffed ) 7.5 no , et tube ( cuffed ) 8no , et tube ( cuffed ) 8.5 no , et tube 6 no. uncuffed , et tube 7 no. uncuffed , ethibond ( polyster suture ) 1 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 2 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 3 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 5 0 round body 1 / 2 circle 75 cm , nylon clear monofilament 1 024 mm reverse cutting 75 cm , nylon clear monofilament 2 0 24 mm reverse cutting 75 cm , nylon clear monofilament 3 0 24 mm reverse cutting 75 cm , nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , poly propylene monofilament 0, 30mm 1 / 2 circle75 cm , poly propylene monofilament 1, 30mm 1 / 2 circle75 cm , polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , polyglactin 0, 31mm 1 / 2 circle 70 cmreverse cutting , polyglactin 1 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 2 0, 31mm1 / 2 circle 90 cm round bodied , polyglactin 2 0, 31mm 1 / 2 circle 70 cm reverse cutting , polyglactin 3 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 4 0, 31mm 1 / 2 circle 70 cm round bodied , polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , catgut 1 0 round bodied 1 / 2 circle 76 cm , catgut 2 0 round bodied 1 / 2 circle 76 cm , polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm length 75 cm, 12 foils per packet , b.b. silk 6 reels x 25 mts length 25 braided silk without needle in reels non absorbable surgical suture , synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) , silk suture 1 01 / 2 round circle black braided 24 mm 76 cm , silk suture 2 01 / 2 round circle black braided 24 mm 76 cm , silk suture 3 01 / 2 round circle black braided 24 mm 76 cm , absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 , silk suture 4 01 / 2 round circle black braided 24 mm 76 cm , roll bandage 05 cm x 05 m , roll bandage 10 cm x 05 m , roll bandage 15 cm x 05 m , roll bandage 7.5 cm x 05 m , ryles tube10 no. , ryles tube 12 no. , ryles tube size 14 , ryles tube size 16 , ryles tube size 18 , schantz pin 4 mm , schantz pin 4.5 mm , schantz pin 5mm , romo vac set 14 , romo vac set 16 , rubber sheet ( small ) , rubber sheet ( large ) , silicon mask adult size 0 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 01 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 02 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 03with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 04with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 05 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask paediatric size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask size 0 paediatric with connection tube, reservoir bag and valvepaediatric ( jackson rees circuit ) , silicon mask size 1 paediatric with connection tube, reservoir bag and valve, paediatric ( jackson rees circuit ) , , oxygen mask adult , non rebreathing mask , sics blade cresent ( 15 degree ) , simcoe i / a cannula, direct , skeletal traction kit , skin grafting blade ( downys blade ) , skin traction kit , spinal needle size 25 g , spinal needle size 26 g , spinal needle size 27 g , ss wire20g , ss wire 18 g , ss wire 22g , st pin 4 mm , st pin5 mm , st pin 4.5 mm , suction catheter 10 no , suction catheter 12 no , suction catheter 14 no , suction catheter 16 no , suction catheter 18 , suction tube10no , suction tube12no , suction tube14no , suction tube 8no , surgical steel drum 11*9inch , surgical steel drum 12*10inch , surgical steel drum 15*12 inch , surgical steel drum 6*6inch , surgical steel drum 6*9inch , surgical steel drum 9*9inch , surgical bladesize 15 , surgical blade , size 22 , surgical bladesize 23 , surgical blade , size 24 , surgical blade, size 11 , surgical cap disposable , ultrasoundjelly 250 gm , ecg jelly 250 gm , echo cardiography250 gm , view box size 14x17 , view box size 8x17 , weighingmachine mechenical , white ( sharp container ) 10 litr , whole sheet 35 inch x 35 inch , wound suction catheter ( no 18 ) , each , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , laryngoscope ( adult ) with bladesize 2, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 1, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 0, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 2 , laryngoscope ( paedeatric ) a machintoshb miller blade size 00, , laryngoscope ( paedeatric ) a machintosh blade size 0, , laryngoscope ( paedeatric ) a machintosh blade size , 1, , lma ( i gel ) size 1.5 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , lma ( i gel ) size 1 , lma ( i gel ) size 2 , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size 1, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , ( c mac ) video laryngoscope with complete blade set , maccoy laryngoscope with bladesize 5 , magill forcep ( adult ) , magill forcep ( padeatric ) , iv cannula ( two way ) size 24 , iv cannula 16 no. , iv cannula 18 no. , iv cannula 20 no. , iv cannula 22 no. , k wire1.6mm , k wire2mm , k wire2.5 mm , k wire 1 mm , k wire 3mm , kit 1 , kit 2 , kit 6 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating lma ( i lma ) fastrac 6.5 , intubating bougie , hernia mesh 15x15 , hernia mesh 3x6 , head ring ( adult ) , head ring ( peadia ) , guedalsairway size , 0, , guedalsairway size , 2, , guedalsairway size , 5 , guedalsairway size 00, , guedalsairway size 000, , guedalsairway size 1, , guedals airway size , 4, , guedals airway size 3, , glucometer , glucometer strips , hmef, filter, heat and moisture exchanger with viral filter ( hmef ) , formalin chamberthree tray ( 24*8*8 ) inch , formalin chamber three tray ( 20*8*8 ) inch. , formalin chamber two tray ( 16*8*8 ) inch. , foley catheter 20 no. 3 way , foley catheter 22 no. 3 way , foley’s catheter 16 no. , foley’s catheter12 no. , foley’s catheter14 no. , foleys catheter size10 , foleys catheter size18 , foldable iol sterile lens + 19.5d , foldable iol sterile lens + 19d , foldable iol sterile lens + 20.5d , foldable iol sterile lens + 20d , flexometallictube ( armored tube ) , 6.5 , flexometallictube ( armored tube ) , 7 , flexometallictube ( armored tube ) , 7.5 , flexometallictube ( armored tube ) , 8 , flexometallictube ( armored tube ) 6, , flexometallictube ( armored tube ) 8.5 , electric surgical instrument boiler ( 20*8*7.5 ) inch , electric surgical instrument boiler ( 24*8*8 ) inch , ecg paper a4 size , echo cardiography rollpaper , 3 way cannula ( triway ) , 3 way extension 100 cm , 3 way extension 25 cm , abdominaldrain adk drain no. 28 , abdominaldrain adk drain no. 30 , ansathesia face mask silicone transparentsize , 4 , ansathesia face mask silicone transparentsize , 5 , ansathesia face mask silicone transparentsize 0 , ansathesia face mask silicone transparentsize 00 , ansathesia face mask silicone transparentsize 1 , ansathesia face mask silicone transparentsize 2 , ansathesia face mask silicone transparentsize 3 , ansthesia work station disposable circuit ( adult ) , ansthesia work station disposable circuit ( paedeatric ) , centralvenous catheterkit ( adult ) , centralvenous catheterkit ( paedeatric ) , ambu bag ( padeatric ) 150 ml , ambu bag ( padeatric ) 250 ml , stethograph , analytical digital balance , perimeter ( priestley smith ) s / lp.984 b & t , long knee brace , knee cap , finger splint , wrist hand stabillizer , cock up splint , thumb spica splint , arm pouch , universal shoulder immobillzer , clavicular brace , neck collar soft , nack collar hard , l s belt , forearm brace , anklet , crepe bandage 4 inch , crepe bandage 6inch , dynaplast , stockinette / soft roll , walker , sodium borate 1 kg , sodium citrate 1 kg , pipracelline+tezobactum inj ( 4.5 gm ) , inj. tranexamic acid 500 mg , inj. lebetalol 5 ml , inj. magnesium sulfate , kelleys pad , povidone solution 5% 500 ml , inj methergine 0.2 mg , inj mgso4 50% , catgut 1 no suture , vicryl 1 no ( round bodied needle ) suture , inj epidosin , inj drotaverine , urine for albumin strip , cerviprime gel 0.5 mg , inj anti d ( 300 microgram ) , edta vial , b.p. instumanet with all size cuf , anterior vaginal wall retractor , ovum forceps ( medium size 05 ) ( small size 05 ) , blakes uterine curette , karmans cannula set ( 05 no ) , karmans cannula set ( 06 no ) , karmans cannula set ( 08 no ) , karmans cannula set ( 12 no ) , hegars cervical dilator set , mva syringe along with cannula , uterine sound , vullselum , tab. tranexa , tab. misopristol , cotton guaze pad , nylon suture 3 0 , nylon suture 4 0 , suction catheter 06 no , suction catheter 07 no , suction catheter 08 no , iv metronidazole 100 ml , iv ringer lactate 500 ml , iv normal saline 100 ml , mackintosh sheet , laryngo scope neonate blade size 0 / 1 , cidex solution 5 ltr , surgical drum 12×15 , surgical drum 11×13 , surgical drum 9×11 , surgical tray medium , surgical tray large , povidone onitment 250 gm , digital fuji x ray film 8*10 ( 1×150 ) , posterior chamber intra ocular lens ( pciol ) ( pmma, single piece, size 6mm optics total 13mm ) 10 d , pciol / / 12 d , pciol / / 14 d , pciol / / 16 d , pciol / / 17 d , pciol / / 17.5 d , pciol / / 18 d , pciol / / 18.5 d , pciol / / 19 d , pciol / / 19.5 d , pciol / / 20 d , pciol / / 20.5 d , pciol / / 21 d , pciol / / 21.5 d , pciol / / 22 d , pciol / / 22.5 d , pciol / / 23 d , pciol / / 23.5 d , pciol / / 24 d , pciol / / 25 d , pciol / / 26 d , pciol / / 27 d , pciol / / 28 d , pciol / / 29 d , pciol / / 30 d , anterior chamber intra ocular lens ( aciol ) , kelman multiflex model ( pmma, single piece, size 6mm optics total 13mm ) 16 d , aciol / / 17 d , aciol / / 18 d , aciol / / 19 d , aciol / / 20 d , viscoelastic substance ( pre filled syringe ) , trypan blue dye , hylase injection , lignocaine 4% drops , pilocarpine injection , epitrate injection , virgin silk suture6 0 , monofillanent nylon suture ( double ended ) , surgical blade 15 number , vicryl suture 6 0 , keratome blade , crescent blade , side port , tab. diamox , spirit lamp , r.o. machine for washing and scrubings , formiline chamber , white and green cloth , uv sterilizer , color vision chart – original ishihara , near vision chart with different languages , torch with yellow light , maddoxrod , maddox wing , diplopia goggles , bipolar wetfield cautry , placido disc , prism bar , cryo unit , non contact tonometer , multi media projector with screen , hess screen chart , usg –a scan , corneal loupe , indirect ophthalmoscope with +20 and +30 volk lenses , direct ophthalmoscope , snellen’s chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , streak retinoscope , keratometer , synaptophore , chalazion set , autoclave , drum ( large, medium, small ) , kidney tray ( large , medium , small ) , bowl , infrared thermometer , chittle forceps , boiler ( small and large ) , stainless steel traywith cover ( small and large ) , schiotz tonometer , intraocular lens 15 no to 27 no , intraocular lens 27 no , methylene blue dye , balancde salt solution , dextrose 5 % , dextrose 10 % , inj. epitate , inj.derriphyline , inj.botroclot , xylocaine jelly , inj.mitomycin c , thread ( 100 no ) , ethilon suture ( 4 0 ) , ethilon suture ( 6 0 ) , i / v set , needle ( 26.5 ) , syringes ( 5 ml ) , syringes ( 10 ml ) , syringes ( 20 ml ) , syringes ( 5 ml ) , n 95 mask , disposable eye drape , eye towel , intracatheter , inj mannitol , inj avil , chlorine solution 500 ml , betadene solution , ppe kit , betadene scrub , hydrogen peroxide solution , inj. betamethasone 4 mg , inj oxytocin 10 iu , drotaverine 40 mg / 2ml , inj. vit k , inj. dizepam , inj iron sucrose , tab. misoprostol 200 mg ( 4 tab. pack ) , baby tag , tab. tranexamic acid 500 mg , umblical cord clamp large size , rubber catheter plain , yankurs suction tube , weight machine neonatal , weight machine adult , dressing steel tray 12×15 , dressing steel tray medium , dressing steel tray small , dressing drum 12×15 , dressing drum 13×11 , electric sterlizer 20×8×6 , dettol shop 20 gm , polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm length 90 cm size 1 ) vicryl , prolene 1 rb 1 / 2 circle 30 mm l 70 cm ( 12 foils / pkt ) needle , ethicon 2 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , ethicon 3 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , b.b silk ( 12 foils / pkt ) ( 1 / 2 rcut needle 45 mm length 76 cm size 2 / 0 ) , stylet ( adult ) , stylet ( paedia ) , enema port , phosphate enema , methanol ( 50 ltr. per container packing ) , glycerin ( 50 ltr. per container packing ) , phenol , thymol crystals , 1 % eosin , winter green perfume ( oil of winter green ) , gasket , microbiological filter , printer paper , heater , hepa filter , printer ink ribbon , bowie & dick test strip , biological indicator , documentation label ( 1 roll of 750 ) , packaging indicator , cleaning indicator , ink roll labelling gun , chemical indicator ltsf , biological indicator ltsf , sterilization reel 50×200 mtrs ltsf , sterilization reel 75×200 mtrs ltsf , sterilization reel 100×200 mtrs ltsf , sterilization reel 200×200 mtrs ltsf , sterilization reel 250×200 mtrs ltsf , sterilization reel 300×200 mtrs ltsf , cartridge filter , antiscalant chemical ( cane of 40 ltr ) , calcitonin nasal spray 30 mcg , tab. lefulonamide 10 / 20 mg , tab. pyroxicame 10 / 20 mg , tab.toclizumab 5 mg , k wire 1 mm , k wire 1 .5 mm , k wire 1 .5 mm , k wire 2 mm , k wire 2.5 mm , k wire 3 mm , st pin 4 mm , st pin 4.5 mm , st pin 5 mm , ss wire 18 g , ss wire 20 g , ss wire22 g , stirrup , vicryl 2.0 rc , vicryl 3.0 rc , vicryl os 8 , vicryl os 6 , ethibond 2 no , ethibond 5 no , ethilone 1.0 , ethilone 2.0 , ethilone 3.0 , nylon 1.0 , nylon 2.0 , nasal prong , infant feeding tube 5 , infant feeding tube 6 , infant feeding tube 7 , infant feeding tube 8 , infant feeding tube 9 , diaper , identification band , disposable sheets , umblical catheter , centralline 3 fr , centralline 4 fr , centralline 5 fr , peadia set , alcohol based hand rub , formalin ( 50 ml bottel ) , phenyl ( 500ml ) , liquid handwash ( 500ml ) , disposable mark , disposable cap , sleeper , oxygen connecting tube , steel spoon , steel bowl , inj. normal saline ( 500 ml ) , inj. normal saline ( 200 ml ) , inj. isolyte p ( 500 ml ) , inj. ringer lactate ( 500 ml ) , inj. adreraline , inj. sodium valproate , inj. levepril ( levetirautam ) , inj. cefotaxim ( 250 mg ) , inj. cefepine , inj. pantop , inj. aciloc , ivig , inj. methyprednisolone , inj. mepropencm ( 235 mg ) , inj. sodabicarb ( 10ml ) , inj. capnea , inj. metronidazol ( 100 ml ) , inj. fluconzole , inj.botropose , inj. ampicilin , inj. teicoplanin , inj. 3% normal saline , inj. aminoveir , levosalbutamol respule , budecort respule , inj. amphotericin , syp paracitamol ( 5ml=125 mg ) , syp. ibuprofen , syp. dextromethorphen , syp. bromohexine , syp. calcium , drop multivitamin , syp. phenobarbitone , syp. cefixim ( 5ml=50 mg ) , drop domperidone , drop paracetamol , saline nasal drops , tobramnycin eye drop , hmf sachet ( lactodex ) , tab paracetamol , tab. amoxyclav , syp. amoxycalv , syp cetrizine , syrup zinc ( 20 mg ) , syrup phenytoin , syrup multivitamin , formalin ( 5 ltr packing ) , formalin ( 1 ltr packing ) , formalin ( 50 ltr per container packing ) , color vision chart —original ishihara , near vision chart with different languages , torchwith yellow light , maddox wing , diplopia goggles , placido disc , corneal loupe , snellens chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , chalazion set , stainless steel tray with cover ( small and large ) , schiotztonometer , cotton absorbent ( 1 / 2 kg ) , blood group antisera ( abd ) , potassium nitrate , potassium acetate , sodium acetate , inj. acyclovir , inj. surfactant ( serventa ) ...

Madhya Pradesh Public Health Services Corporation Limited - Madhya Pradesh

29715298 general consumable/rc/2021 online rate contract tender for supply of general consumable to various hospitals of government of madhya pradesh for a period of 18 months , general consumables , abdominal belt(32 inch each) , abdominal belt(34 inch each),consumable , abdominal belt(36 inch each),consumable , abdominal belt(38 inch each) , blood transfusion set (pediatric) , blood transfusion set(each),consumable , capillary tube, rate should be quoted forpack containing 100 piece of capillary tube , cervical collar/each soft, medium sized , corrugated drainage sheet, sterile, multichannel, single use(2 inch x 6 inch (pvc) piece),consumable , cotton crape bandage 10cm x 4m , cotton crape bandage 15cm x 4m , disposable apron consumable , disposable cap , disposable dreppings , disposable eye dressing with adhesive pad(each  unit),consumable , disposable kelly pad 1. fabric: non woven, layered; spunbound meltblown spunbound (sms). 2. dimensions: drape: l 76 cm; w 77 cm. drain pouch: l 38 cm; w 38 cm. drain tube: l 25 cm; w 3 cm. 3. fenestration area: reinforcement of polycoated fabric, adsorbent on one side and impervious to fluids on another side. 4. with drain pouch and drainage tube. 5. packing: sterile pack; double packed with outer pouch must be peel off made of medical grade paper. , disposable needles is 10654:2002 26 g (1 1/2 inch) , disposable needles is 10654:2002 26 g (1 inch) , disposable plastic appron (full size) , disposable shoes cover , disposable spinalneedle 23 no with syringe , disposable surgeon cap , disposable syringe with needle 10ml , disposable syringe with needle 20ml syringes , disposable syringe with needle(1ml each),syrings , disposable syringe with needle(2ml each),syrings , disposable syringe with needle(3ml each),syrings , disposable under pad dimention of sheet 60*90 cm(inside)(weight 80 gm unit),consumable , endotracheal tube no 2.5 (uncuffed) , endotracheal tube no 3 (uncuffed) , endotracheal tube no 3.5 (uncuffed) , endotracheal tube no 4.0 (uncuffed) , endotracheal tube no 4.5 (uncuffed) , endotracheal tube no 5.0 (uncuffed) , epidural set 18 n0. , epidural set 20 n0. , fixer powder ( fixer with hardner),( 22.5 ltr/pkt) , follyscathator (pediatrics) , folys catheter size 16 plain , formaldehyde 40% (conc. formalin) (1 x 30 lit), consumable , gauze clothes 90cmx20m, (total requirement 150000 meters) , gauze sponge/each(size 3 x 3 inches),consumable , infant feeding tube (catheter) size: 3g , infant feeding tube size: 5g , lead letter 0 9 sets, (100 clips/pkt) , lead letter a to z set , nasal prong(each),consumable (neonatal size 00) , paediatric drip set(set),digonstic , prolene mesh(7.5 x 15 cm) , quincke pediatric spinal needles, g 25, length 2.0 inch , reuse prevention syringe sterile single use reuse prevention syringe with fixed needle scompliance to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized.(10 ml) , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles compliance to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(2ml),syrings , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles compliance to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(3ml),syrings , reuse prevention syringe sterile single use reuse prevention syringe with fixed needles complianceto iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(5ml),syrings , spinal (l.p.) needle disposable 24 g with syringe , spinal needle 26 g(each) needle with syringe , suction catheter assorted 9 no/each , urine container 5ml disposable , white translucent puncture proof container size 2 litre , umbical cord clamps plastic material , insulin syringe {auto disabled (ad)/reuse prevantion (rup) syringe} with 31g needle (single unit pack) is marked, 40 iu(each),consumable , insulin syringe {auto disabled (ad)/reuse prevantion (rup) syringe}/ each (graduation upto 100 units) 30g needle, 40 units/ml (30 g needle, 40units/ml) syringe(each),consumable , insulin syringe with 31g needle (single unit pack) is marked, 100iu, {auto disabled (ad)/re use prevantion (rup) syringe(each),consumable , collagen sheets 10 x 10 cm sheet , cvp line complete set , icd bag 1000 ml , latex based baloon capacity (30 50ml) foleys catheter(size 14 3 way),consumable , paediatric epidural set(19g needle, metal stylet,22g catheter,0.22micron epidural catheter lor syringe) , spinal needle with metal stylet,(g 23),needle , spinal needle(g 22 l 120 mm),consumable , steralised and autoclavable culture tube flat bottom, 5ml (plastic)(each),consumable , blood bag triple sagam 450ml (as per attached specification),each , collection tube polystrene(100 per pack),consumable , sputum container (100 per box) consumable , electric cautery lead/each disposable electro surgical pencil 4cm (each),each , screw cap vial with o ring (2ml),screw cap,leak proof self standing/flat bottom with o ring, un graduated, polypropylene/ polyethylene, 2ml capacity each (each),consumable , artificial immersion oil refractive index of 1.48 it should be colorless, odorless, transparent and free from fluorescence in day light eith relative density of 0.827 to 0.890, viscosity of 110 to 230 m pa s; specific gravity of 0.76 0.78 at 15.5 c(50 ml bottle),consumable , barium sulphate, hd 300 grm , basic fuchsin chemical name:pararosaniline hydrochloride,chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green(25 gms glass bottle),consumable , disinfectant renaclean cold sterilant (5 ltr can) , envipur fogger solution 5 lit cane , glacial acetic acid (liquid) 100 ml bottles , glutaraldehyde solution 2% in 5liter can (2 strips/vials per each can) (5 liter can), consumable , lugol iodine 100 ml bottles , n/10 hcl 100 ml , phenolic compound/phenol crystal chemical name: phenol, chemical structure: c6h5oh, molecular wt: 94.11, melting point:40 c+2 purity: 99.5%(500 gm glass bottle),consumable , liquid paraffin 50ml(bottle ),consumable , sulphuric acid(500ml glass bottle),consumable , micro blades crescent, 100/pkt , micro blades keratome 5.2,100/pkt...

Police Department - Madhya Pradesh

29596076 supply of chemicals 1 δ9 tetrahydrocannabinol 2 1 chlorobutane 3 2,1 dichoro quininone 4 chloro imide (dqc) 4 4(4 nitrobenzyl)pyridine 5 5,5 diethyl barbituric acid 7 7 amino 4 hydroxy 2 napthalenesulphonic acid ( j acid) 8 absolute alcohol 11 acephate 12 acetaldehyde 13 acetamiprid n desmethyl 14 acetic acid 15 acetic acid glacial 17 acetone 21 acetone hplc 22 acidic alumina powder 23 acifloufen 24 agarose 25 agarose low eeo 26 alizarin red 27 alizarin s 28 allethrin 29 alpha napthlyl phosphate 30 alpha napthyl amine 32 aluminon (tri ammonium aurine tricarboxylate) 33 aluminone 34 ammonia 37 ammonium acetate 38 ammonium carbonate 39 ammonium hepta molybdate 40 ammonium nitrate 41 ammonium sulphate 42 ammonium vanadate 43 amonia trihydric 44 aniline 45 aniline sulphate 46 anthracene 47 antimony sulphide 48 arsenic sulphide 49 atrazine 50 barbitone 52 barium chloride 53 barium nitrate 54 basic alumina powder 55 basic fuchsin 57 bentaminephas blue salt 58 benzene 59 benzidine 60 benzidinediamino dip 61 beta cyfluthrin 62 bifenthrin 63 bismuth subnitrate 51 bis(trimethylsilyl) acetamide bsa 10 ml 64 bleaching powder 66 bromoform 67 brucine sulphate 68 brucine 69 buffer solution ph 9 (borate) 70 buffer tablet ph 4 (1 tablet to be dissolved to 100 solution) 71 buffer tablet ph 7 (1 tablet to be dissolved to 100 solution) 72 buffer tablet ph 9 (1 tablet to be dissolved to 100 solution) 73 cadmium chloride 74 caesium nitrate 75 calcium hydroxide 76 calcium lactate 77 calcium oxide 78 calcium sulphate 80 carbamate pesticide mixture (common carbamate pesticide) 81 carbofuran 82 carbon disulphide 83 carbon tetrachloride 84 chlormequat chloride 85 chlorobenzene 86 chloroform 87 chloroplatinic acid 88 chlorpyrifos 89 chromotropic acid disodium salt 98% extra pure 90 chromotropic acid or , sodium salt of chromotropic acid 91 clodinafap propargyl 92 cobalt nitrate 93 cobalt thiocynate 94 cobaltous acetate 95 codeine hydrochloride 96 conc, hcl 97 conc.sulphuric acid 98 copper strips 99 copper sulphate 100 cresol red indicator 101 cupric cloride 102 cupron grade 103 cyclohexane 104 cypermethrin 105 deltamethrin 106 diacetylmorphine 107 diafenthiuron 108 dichloromethane 109 diethyl amine 110 diethyl ether 111 di hidrad alcohol 112 dimethoate 113 dimethyl formamide dmf 114 dimethyl sulphoxide dmso 115 dimethyl yellow 116 dioxane 117 diphenyl carbazide 118 diphenyl carbazone 119 diphenylamine 121 dithiazone 123 dpx 124 emamectin benzoate 125 eosin (water solution for microscopy) 126 eosine (spirit soluble) 127 ethanol (methanol free) 128 ethanol absolute 129 ethephon 130 ethion 131 ethyl acetate 132 ethylene diamine hydrochloride 133 ethylenediamine tetraacetic acid edta 134 fast blue b salt 135 fenvalerate 136 ferric sulphate 137 ferric chloride 138 ferrous sulphate 139 fipronil 140 flubendiamide 141 formaldehyde 142 glacial acetic acid 143 glycerin 144 glycerol 145 glyphosate 146 hand disinfectant 147 handwash 148 heamotoxyline 149 hexaconazole 150 hexamine 151 hydrochloric acid 154 hydrogen peroxide 156 hydroxyl amine hydrochloride 157 imazethapyr 158 imidacloprid 159 indole 160 indoxacarb 161 iodine 162 iodoplatinate 164 iso octane 165 iso propyl alcohol 166 iso amyl alcohol 167 lambda cyhalothrin 168 lead acetate 169 liquid soap 170 magnesium sulphate 171 malathion 172 mangnous sulphate 173 mercuric sulphate 174 metadinitrobenzene 175 methanol hplc 176 methanol,2.5 litre 177 methonol 178 methyl red indicator 179 methylene blue indicator 180 molybdic acid 181 molybdic acid 85% ar/acs 182 morphine hydrochloride 183 morrin reagent 184 n/10 h2so4 185 n/10 h2so4 ampoule 186 n/10 naoh ampoule 187 nesslers reagent 188 n heptane 189 n hexane 190 ninhydrin 191 nitric acid 194 nitrobenzene 49 n heptane 5 ml ga 50 n decane 5 ml ga 195 n octane 196 n pentanol 198 organochlorine pesticide mixture (common oc pesticide) 199 organophosphorus pesticide mixture (common op pesticide) 201 oxalic acid 202 p aminophenol 203 para dimethyl amino benzaldehyde 204 paraquat dichloride 205 parifin wax 206 perchloric acid 207 petroleum ether ( 60 800c) 209 ph indicator paper range 1 14 210 phenol 211 phenolphthalein 212 phenolphthelin 213 phorate 214 phosphoric acid 215 p nitrobenzene azo resorcinol or megneson i 216 potassium dichromate 217 potassium iodide 218 potassium iodide grade 219 pottasium hydroxide 220 pottasium iodide 221 pottasium iodoplatinate 222 pottassium ferricyanide 224 pottassium chlorate 225 pottassium chromate 226 pottassium dichromate 227 pottassium nitrate 229 pretilachlor 230 profenophos 231 pyrethroid standard mixture (common pu pesticide) 232 pyridine 233 quinalizarin 234 quinalphos 235 resorcinol 236 rhodamine b 237 salicyclic acid 238 schiff’s reagent 239 scorpion venom antiserum (antivenin) 240 selenous acid 241 silica gel g 60 f254 precoated tlc plate aluminium sheets (20 x 20 cm) 242 silica gel g for tlc ( merk) 243 silica gel g powder 244 silver chloride 245 silver nitrate 246 snake venom antiserum (antivenin) 247 sodium acetate 248 sodium barbitone 249 sodium bicarbonate 250 sodium bicarbonate 251 sodium bisulphate 252 sodium carbonate 253 sodium chloride 254 sodium chloride 255 sodium cobaltinitrite 256 sodium dihydrogen phosphate 257 sodium hydrogen sulphite 258 sodium hydroxide 259 sodium hydroxide pellets 260 sodium molybdate 261 sodium nitrite 262 sodium phosphate dibasic heptahydrate 263 sodium phosphate monobasic monohydrate 264 sodium rhodizonate 265 sodium sulphate 267 sodium tungstate 269 soluble starch 273 stannous chloride 275 starch soluble 276 strontium nitrate 277 sulfanilic acid 278 sulphamic acid 279 sulphanilic acid 280 sulphur pure 281 sulphuric acid 282 surface dis infectane 283 surface sanitizer 284 tartric acid 285 tetramethylammonium hydroxide 286 thiamethoxam 287 toulene 288 trichloro ethylene 289 tris buffer 290 universal ph indicator solution, ph 4 to 11 291 vanadyl trioxychloride 292 vanilin 293 xylene 294 zinc acetate 295 zinc dust 297 zinc sulphate heptahydrate 298 zinc uranyl acetate 299 zincon 300 antisera a polyclonal...

Netaji Subhash Chandra Bose Medical College - Madhya Pradesh

29527347 supply of reagent, chemical glass ware, stationary and general items 2 manual kits 3 acid phosphates kit ( 100test ) 4 albuminkit ( 100 gms ) 5 alkaline phosphates kit ( 500 gms ) 6 amylase ( 500 ml ) 7 aptt ( 500 ml ) 8 aso titre test ( 96 tes ) 9 billirubin direct ( 100 tset ) 10 billirubin total ( 100 test ) 11 mercuric sulphate ( 500 gms ) 12 sodium nitroprusside ( 500 gms ) 13 chicken gunia rapid kit igm ( 100 test ) 14 cholesterol kit ( 100 test ) 15 ck mb ( 100 test ) 16 cpk mb ( 100 test ) 17 c reactive protein ( 100 test ) 18 sodium n+ ( 100 test ) 19 crp kit ( 100 test ) 20 csf protein ( 100 test ) 21 dengue rapid kit for igg & igm ( 100 test ) 22 robertson cooked media ( 500 gms ) 23 drinking water testing ( 12 parameters ) 24 potasium k+ ( 100 test ) 25 g6pd kit ( 100 test ) 26 glucose kit god method ( 100 test ) 27 glycosylate hb% ( 100 test ) 28 hbsag card test ( each ) 29 mountax test 5 tu / ppd ( 100 test ) 30 pragnancy test hcg card test ( 100 test ) 31 pregnancy test, latex agglutination inhibition test ( 100 test ) 32 prothombin time kit ( 100 test ) 33 ra factor test ( 100 test ) 34 rapid test kit for anti hcv ab ( 100 test ) 35 s.acid phosphtac ( 100 test ) 36 s.alkaline phosphate ( 100 test ) 37 s.analyese ( 100 test ) 38 s.cholestrol kit ( 100 test ) 39 s.glucose kit ( 100 test ) 40 s.h.d.l. ( 100 test ) 41 s.triglyceride ( 100 test ) 42 s.uric kit ( 100 test ) 43 serum bilirubin kit ( 100 test ) 44 serum calcium kit ( 100 test ) 45 serum creatinine kit ( 100 test ) 46 serum protein kit ( 100 test ) 47 serum uric acid kit ( 100 test ) 48 sgot ( 100 test ) 49 sgpt ( 100 test ) 50 t3 elisa test kit ( 100 test ) 51 t4 elisa test kit ( 100 test ) 52 total protein ( 100 test ) 53 triglyceride kit ( 100 test ) 54 tsh elisa test kit ( 100 test ) 55 urea enzymatic ( 100 test ) 56 sabourauds dextrose agar with chloramphenicol medium ( 500gms ) 57 sabourauds dextrose agar with brain heart infusion agar ( 500gms ) 58 lactophenol cotton blue ( 10gms ) 59 glycerol ( laboratory grade ) ( 500 ml ) 60 mccartney bottle ( 500 gms ) 61 edta disodium salt ( 500 gms ) 62 barium chloride powder ( 500 gms ) 63 urea kit ( 100 test ) 64 vdrl card test tpha ( 100 test ) 65 vdrl latex test / rpr ( 100 test ) 66 widal kit ( 100 test ) 67 widal test ( 100 test ) 68 isoamyl alchohol ( 500 ml ) 69 hcl ( 500 ml ) 70 phenol red powder ( 500 gms ) 71 bakout ( 20 ltr ) 72 finit ( 10 ltr ) 73 k.telurite blood agar ( himedia ) ( 100 gms ) 74 hi.viral tranport medium ( himedia ) ( 100 tubes ) 75 cetrimide agar ( himedia ) ( 100 gms ) 76 caryblair transport medium ( himedia ) ( 100 gms ) 77 wilson blair agar ( himedia ) ( 100gms ) 78 agar powder ( himedia ) ( 500 gms ) 79 sabouraud dextrose agar ( himedia ) ( 500gms ) 80 urea agar base ( himedia ) ( 500 gms ) 81 tsi agar ( himedia ) ( 500 gms ) 82 muller hinton medium powder ( himedia ) ( 100gms ) 83 ma conkey agar powder veg ( himedia ) ( 500 gms ) 84 nutrient agar powder veg. ( himedia ) ( 500 gms ) 85 t.c.b.s.agar powder veg ( himedia ) ( 500 gms ) 86 geletin agar ( himedia ) ( 500 gms ) 87 deoxycholate citrate agar ( himedia ) ( 500 gms ) 88 simmons citrate agar ( himedia ) ( 500 gms ) 89 bordet gengoue media ( himedia ) ( 500 gms ) 90 xld agar ( himedia ) ( 500 gms ) 91 hektoen enteric agar ( himedia ) ( 500 gms ) 92 lj media slants ( himedia ) ( 500 gms ) 93 lj media with first line antitubercrular drugs ( himedia ) ( 500 gms ) 94 cled medium ( himedia ) ( 500 gms ) 95 triptycase tellurite agar ( himedia ) ( 500 gms ) 96 brin heart infusion broth ( himedia ) ( 500 gms ) 97 brain heart infusion agar ( himedia ) ( 500 gms ) 98 columbia blood agar base ( himedia ) ( 500 gms ) 99 thioglycolate broth ( himedia ) ( 500 gms ) 100 lofflers medium base ( himedia ) ( 100 gms ) 101 moellers decarboxylase broth with arginine ( himedia ) ( 100 gms ) 102 moellers decarboxylase broth with lysine ( himedia ) ( 100 gms ) 103 moellers decarboxylase broth with ornithine ( himedia ) ( 100 gms ) 104 corn meal agar ( himedia ) ( 100 gms ) 105 tretrazolium reduction media ( himedia ) ( 100 gms ) 106 hichrome candida differential media ( himedia ) ( 100 gms ) 107 bile esculin agar ( himedia ) ( 100 gms ) 108 pvr broth ( himedia ) ( 100 gms ) 109 pvr reagent ( himedia ) ( 100 gms ) 110 kits, chemicals, strains & antibiotic sensitivity discs 111 iso propyl alchohol ( 1 liters ) ( merck / qualigen / fisher ) 112 benzene ( 1 liters ) ( merck / qualigen / fisher ) 113 formaline ( 1 liters ) ( merck / qualigen / fisher ) 114 hematoxyline powder ( fisher / loba ) ( 500 ml ) 115 dpx ( 500ml ) ( merck / qualigen / fisher ) 116 microtome blade ( leica / chile ) ( 500 ml ) 117 alluminium potassium sulphate ( 1kg ) ( merck / qualigen / fisher ) 118 mercuric oxide ( 100 gm ) ( merck / qualigen / fisher ) 119 carbolic soap ( 500 ml ) 120 ammonium potassium sulphate ( 500 gm ) 121 nitric acid ( 500 ml ) 122 hiv kit elisa ( 96 test ) 123 hiv kit rapid ( 96 test ) 124 hcv kit elisa ( 96 test ) 125 hcv kit rapid ( 96 test ) 126 hbsag kit elisa ( 96 test ) 127 hbsag kit rapid ( 96 test ) 128 rpr ( vdrl ) kit ( 500 test ) 129 rpr kit strip ( 100 test ) 130 rapid malaria antigen detection test card for pv& pf antigen ( pack ) ( 30 test ) 131 neomycin ( 500 discs ) 132 norfloxacin ( 500 discs ) 133 ofloxacin ( 500 discs ) 134 pencillin ( 500 discs ) 135 pipracillin + tazobactum ( 500 discs ) 136 tobramycin ( 500 discs ) 137 sterptomycin ( 500 discs ) 138 ticarcillin ( 500 discs ) 139 optochin ( 100 discs ) 140 bacitracin ( 500 discs ) 141 cefoperazone sulbactum ( 500 discs ) 142 clindamycin ( 500 discs ) 143 doxcyline ( 500 discs ) 144 erythromycin ( 500 discs ) 145 cefuroxime sodium 30mcg ( 500 discs ) 146 pipracillin ( 500 discs ) 147 netillin ( 500 discs ) 148 gentmycin ( 500 discs ) 149 levofloxacin ( 500 discs ) 150 cloxacillin ( 500 discs ) 151 imipenem10mcg ( 500 discs ) 152 ertapenem10mcg ( 500 discs ) 153 meropenem10mcg ( 500 discs ) 154 doripenem10mcg ( 500 discs ) 155 ceftazidime / clavulanic acid caz / ca 30 / 10mcg ( 500 discs ) 156 cefotaxime / clavulanic acid ctx / ca 30 / 10mcg ( 500 discs ) 157 aztreonam30mcg ( 500 discs ) 158 ceftazidime30mcg ( 500 discs ) 159 cefotaxime30mcg ( 500 discs ) 160 ceftriaxone 30mcg ( 500 discs ) 161 cefoxitin 30mcg ( 500 discs ) 162 cefepime30mcg ( 500 discs ) 163 sparfloxacin 5mcg ( 500 discs ) 164 novobiocin30mcg ( 200 discs ) 165 amoxycillin clavulanic acid 20 / 10mcg ( 500 discs ) 166 cephotoxime ( 500 discs ) 167 clarithromycin 15mcg ( 500 discs ) 168 co trimoxazole1.25 / 23.75mcg ( 500 discs ) 169 piperacillin100mcg ( 500 discs ) 170 vancomycin30mcg ( 500 discs ) 171 netilmicin30mcg ( 500 discs ) 172 kanamycin 30mcg ( 500 discs ) 173 ampicillin 10mcg ( 500 discs ) 174 azithromycin 15mcg ( 500 discs ) 175 carbenicillin100mcg ( 500 discs ) 176 ceacals30mcg ( 500 discs ) 177 cefoperazone 75mcg ( 500 discs ) 178 ceftizoxime30mcg ( 500 discs ) 179 nalidixic acid 30mcg ( 500 discs ) 180 ceftazidime avibactam 30 / 20mcg ( 500 discs ) 181 ceftolozane tazobactam 30 / 10mcg ( 500 discs ) 182 ceftaroline 30mcg ( 500 discs ) 183 amikacin30mcg ( 500 discs ) 184 fosfomycin 200mcg ( 500 discs ) 185 nitrofurantoin 30mcg ( 500 discs ) 186 sulfisoxazole 250mcg / 300mcg ( 500 discs ) 187 linezolid 30mcg ( 500 discs ) 188 caspofungin 5mcg ( 500 discs ) 189 fluconazole 25mcg ( 500 discs ) 190 voriconazole 1 mcg ( 500 discs ) 191 ltraconzaole 10mcg ( 500 discs ) 192 amphotericin b 100mcg ( 500 discs ) 193 ketoconazole 50mcg ( 500 discs ) 194 nystatin i00iu ( 500 discs ) 195 anti abd monoclonal ( igm ) 10ml 196 staphylococcus aureusatcc 25923 ( himedia ) 197 escherichia coli atcc 25922 ( himedai ) 198 psuedomonas aeruginosa atcc 27853 ( himeda ) 199 enterococcus faecalisatcc 29212 ( susceptlble ) , atcc51299 ( reslstant ) 200 salmonela shigella agar ( 500 gms ) 201 bear extract powder ( 500 gms ) 202 petri dish ( 100 mm glass ) 203 petridish big size ( glass ) ( 150 mm* 20 mm ) 204 petridish medium size ( glass ) ( 100 mm* 17 mm ) 205 toluidine blue ( 100 gm ) 206 ethyl alcogol ( 500 ml ) 207 glycerol ( reagent grade ) ( 500 ml ) 208 magnesium citrate ( 500 gm ) 209 asparagine ( 100 gm ) 210 boric acid ( 500 ml ) 211 amyl alcohol ( 500 ml ) 212 mono potassium phosphate ( 500 gm ) 213 disodium phosphate ( 500 gm ) 214 xylose ( 100 gm ) 215 iodine ( 100 gm ) 216 potassium tellurite ( 100 gm ) 217 potassium chloride ( 500 gm ) 218 india ink ( 100 ml ) 219 l.j. ( lowenstein jensen ) media ( ready to use ) ( 50 bottles ) 220 lacto phenol cotton blue stain ( ready to use ) ( 100 ml ) 221 dermatophyte test media ( 500 gm ) 222 bird seed agar / niger seed agar ( 500 gm ) 223 potato dextrose agar ( 500 gm ) 224 hichrome agar for candida ( 500 gm ) 225 cornmeal agar ( 500 gm ) 226 tetrazolium reduction medium ( 500 gm ) 227 vdrl glass slide ( 10 pieces ) 228 teasing / dissecting needles10 pieces 229 anti d blend, monoclonal ( igm + igg ) anti sera 230 anti a1 lectin 231 anti ab monoclanal 232 anti h 233 activated papain enzyme stablized solution 234 anti c 235 anti e 236 anti e 237 coombs anti sera 238 id gel cross match card ( ahg ) ( cooms ) test card 239 gel diluent liss 240 blood bag double 350ml ( hll / jmitra ) ( each ) 241 blood bag double 450 ml ( hll / jmitra ) ( each ) 242 blood bag triple 350ml ( hll / jmitra ) ( each ) 243 single donor platelet / plasma kit, with acd a bag 500ml ( for apheresis ) 244 usg jelly ( 500 ml ) 245 mannitol ( 100 gms ) 246 absolute alcohol ( 500 ml ) 247 acetone ( 500 ml ) 248 albumin flakes ( 500 gms ) 249 alpha naphthol ( 100 gms ) 250 alpha naphthylamine ( 25gms ) 251 ammonium di hydrogen phosphate ( 500 gms ) 252 ammonium molybdat ( 500 gms ) 253 ammonium oxalate ( 100gms ) 254 ammonium sulphate ( 500 gms ) 255 barium chroride 256 basic fuschin ( 100 gms ) 257 benzidine powder ( 500 gms ) 258 betadin solution ( 500 gms ) 259 bile salt agar ( 500 gms ) 260 bismuth ammonium citrate ( 100 gms ) 261 bleaching powder ( 1 kg ) 262 blood group anti sera abd set monoclonal ( igm & igg ) ( 10 ml ) ( tulip ) 263 blood group anti sera a set monoclonal ( igm ) ( 10 ml ) ( tulip ) 264 blood group anti sera b set monoclonal ( igm ) ( 10 ml ) ( tulip ) 265 blood group anti sera d set monoclonal ( igm ) ( 10 ml ) ( tulip ) 266 bole billiverdin ( 500 ml ) 267 bromine liquid ( 25 ml ) 268 bromothymol blue ( 5 gms ) 269 calcium pure ( 500 gms ) 270 casein ( 500 gms ) 271 conc. h2so4 ( 500 ml ) 272 conc. hno3 ( 500 ml ) 273 concentrated hcl ( 500 ml ) 274 copper acetate ( 500 gms ) 275 cotton roll ( each roll ) 276 creatinine powder ( 500 gms ) 277 crystal voilet ( 500gms ) 278 cuso4 crystal ( 500 gms ) 279 d.p.x. mount 280 dextrose ( 500 gms ) 281 di methyl amino benzaldehyde ( 100 gms ) 282 di pot. hydrogen phosphate ( 100 gms ) 283 di sodium ortho phosphate ( 500 gms ) 284 dibasic sod. phosphate ( 100 gms ) 285 disodium hydrogen phosphate ( 100 gms ) 286 distill water 5 ltr 287 e.d.t.a. powder 288 ecg jelly 250 gm 289 eosin ( cdh / merck ) ( 100 gms ) 290 eosin stain ( for histology staining ) 291 ferric chloride ( fecl3 ) 292 field stain a&b 293 l moulds ( each ) 294 fontana stain ( 100 gms ) 295 formaldehyde ( formalin ) 37% 296 eosin spirit soluble ( himedia / qualigens / loba ) ( 1 gms ) 297 tissue capsule with cover ( 20*20*10 ) ( each ) 298 formaldehyde 40% 200 kg pack 299 formaldehyde 40% 500 ml pack 300 fructose ( 500 gms ) 301 gelatin ( 500 gms ) 302 giemsa powder ( 500 gms ) 303 giemsa stain ( 500 gms ) 304 glacial acetic acid ( 1000ml ) 305 glucose ( 500 gms ) 306 glycerine ( 500 gms ) 307 gms stain ( each kit ) 308 cefezolin ( 500 discs ) 309 hand lotion 250ml antiseptic washing 310 hand sanitizers 311 hydrogen peroxide ( 500gms ) 312 cefaparazone ( 500 discs ) 313 hydrogen peroxide soln 20% 314 india ink ( 5 ml ) 315 ciproflaxcin ( 500 discs ) 316 kovacs indole reagent ( 100 ml ) 317 l.asparagine ( 100 gms ) 318 lactic acid ( 1 ltr ) 319 lactophenol cotton blue 320 lactose ( 500 gms ) 321 lead acetate strips ( 500 gms ) 322 leishman stain solution 323 lens cleaner 2000ml 324 liquid paraffin heavy ( 500 gms ) 325 liquid praffin ( 500ml ) 326 liquid ammonia ( 500 ml ) 327 lysozyme ( 1 gms ) 328 malachite green ( 25gms ) 329 maltose ( 500 gms ) 330 naladixix acid ( 500 discs ) 331 methanol 332 methyl red ( ph indicator ) ( 25gms ) 333 methyl violet ( 100 gms ) 334 methylene blue ( 100 gms ) 335 na natroprusside 336 nalc powder ( 25 gms ) 337 neutral red indicator ( 25 gms ) 338 paraffin wax ( 500 gms ) 339 paraffin wax roll for test tube sealing 340 peptone ( 500 gms ) 341 ph strips ( ph 1 10 ) ( 25 packets ) 342 phenol crystal ( 500 gms ) 343 phenolphthalein ( 100 gms ) 344 phenyl hydrazine hydrochloride ( 100 gms ) 345 phosphate pure 346 picric acid ( 500 gms ) 347 pot. dichromate ( 500 gms ) 348 pot. hydroxide ( 500 gms ) 349 potasium alum 350 potassium iodide ( 100gms ) 351 rectified spirit 352 ressorcinol ( 500 gms ) 353 saffranine ( 100 gms ) 354 salphate pure 355 silver nitrate ( 500 gms ) 356 sodium acetate ( 500 gms ) 357 sodium carbonate ( 100 gms ) 358 sodium chloride ( 1 kg pack ) 359 sodium dihydrogen phosphate ( 100 gms ) 360 sodium hydroxide ( 5 ltr ) 361 sodium hydroxide ( flakes ) 362 sodium hydroxide pellets ( 500gms ) 363 sodium hypochloride ( 500 gms ) 364 sodium sulphate ( 500 gms ) 365 sodium taurocholate ( bile salt ) ( 500 gms ) 366 spirit ( 400 ltr ) 367 starch ( 500 gms ) 368 sterile container ( each ) 369 sucrose ( 500 gms ) 370 sulphur powder ( 500 gms ) 371 sulphuric acid ( 500 ml ) 372 tetra methylparaphenyl diaminodihydro chloride ( oxidase reagent ) ( 25gms ) 373 thallus acetate ( 1 gms ) 374 thymol crystals ( 1 gms ) 375 tincture benzoin co 376 tri sodium citrate ( 100 gms ) 377 trichloro acetic acid ( 1000 ml ) 378 urea ( 100 gms ) 379 urea powder 380 whatmas filter paper no. ( standard size ) 381 xyline ( 1liters ) ( merck / qualigen / fisher ) 382 yeast extract powder ( 100 gms ) 383 molecular water ( nucleous free / rnsa dnsa free ) ( 500 ml pack ) 384 kh2po4 ( 500 gms ) 385 beaf exract powder ( 500 gms ) 386 magnisium sulphate ( 500 gm ) 387 glass ware 388 amplifire for neurograph 389 anaerobic gas pack for 3.5 lit capacity, disposable oxygen absorbing, carbon dioxide generating agent used in anaerobic system no need to use catalysts or pressure gauge 390 anaerobic indicator tables for anaerobic system ( for anaerobic system ) 391 anaerobic system rubber rings ( for anaerobic system ) 392 arnold sterilizer 393 needle disposal 22 gauge 1 ( each ) 394 b.p. blade 24 no. 395 beaker ( 1000cc ) 396 beaker ( 100cc ) 397 beaker ( 500cc ) 398 beaker ( 50cc ) 399 beaker 100ml 400 beaker 200ml 401 blood bag tube stripper mannual 402 bone marrow aspiration needle ( 16, 18, 20 no. ) 403 bone marrow trephine biopsy needle 404 bottle with clear transparent glass 50ml 405 capillary tube 1 mm ( long ) 406 capillary tube 1mm or all size 407 centrifuge tube 15ml 408 centrifuge tube 2ml ( p.p ) 409 seftazidime avibactum ( 500 discs ) 410 charging droppers 411 collection vail 2ml 412 collection vail 5ml 413 colony counter digital for bacteriology, digital display to cout 9999 414 colorimeter cuvetts 415 conical flask flat bottom ( 1000cc ) 416 conical flask flat bottom ( 250cc ) 417 conical flask flat bottom ( 500cc ) 418 conical flask flat bottom ( 50cc ) 419 coplins jar50ml 420 coppling jars ( horizontal ) 421 demonstration stethoscope with multiple earpiece 422 distilled water plant ( all glass ) 423 dropping bottel 424 dropping bottles for stains ( plastic ) 425 durhams tube 426 e.s.r. tube 427 ecg roll 428 eeg electrodes for neurograph 429 esr tube ( wwstergren ) 430 flask bottom flask 2 ltr capaciy 431 flat bottom flask 5 liter capacity 432 flat bottom ph electrode for ph determination for use on soft moist surface like agar gel plate and both on solid and semisolid surface 433 funnel 434 glass pipetts each of each size 435 glass slide ( sunbeam / bluestar ) 436 glass slide ( size 76x26 mm ) thickness 1.35mm 437 glass slide ( size 76x22mm ) thickness :1.45mm ) 438 glass trough pneumatic 439 seftaroline ( 500 discs ) 440 haemocytometer ( each ) 441 haemoglobinometer ( sahils ) 442 hammer ( reflex ) ( each ) 443 hb tube ( each ) 444 ink well for neurograph 445 jar glass ( 2ltr ) 446 lovibond comparators 447 lp bone marrow needle 448 lp needle ( top spinal ) 22x89mm 449 mackartaneys bottle 450 maker pen for digital colony counter 451 measuring cylinder 1000ml 452 measuring cylinder 100ml 453 measuring cylinder 500ml 454 micro coverslips ( 18mmx18mm ) square 455 micro coverslips ( 19mmx19mm ) square 456 micro coverslips ( 22mmx22mm ) square 457 micro coverslips ( 22mmx25mm ) rectangular 458 micro coverslips ( 22mmx30mm ) rectangular 459 micro coverslips ( 22mmx40mm ) rectangular 460 micro coverslips ( 22mmx500mm ) rectangular ( special ) 461 micro coverslips ( 22mmx50mm ) rectangular 462 micro coverslips ( 22mmx60mm ) rectangular ( special ) 463 micro coverslips ( 24mmx24mm ) square ( special ) 464 micro coverslips ( 24mmx40mm ) rectangular ( special ) 465 micro coverslips ( 24mmx60mm ) rectangular ( special ) 466 micro coverslips ( 25mmx50mm ) rectangular ( special ) 467 micro coverslips ( 25mmx60mm ) rectangular ( special ) 468 micro coverslips 18mm circular 469 micro coverslips 19mm circular 470 micro coverslips 22 mm circular 471 micro coverslips 24mm circular 472 micro pippete 10 ul 473 micro pippete 20 ul 474 micro pippette 1000 ul 475 micro pippette 100ul 476 micro pippette 200 ul 477 micro pippette 50 ul 478 micro pippette 500ul 479 micro pippette tips ( 200 1000ul ) 480 micro pippette tips ( 2 200ul ) 481 micro tips yellow size small 482 micrometer stage 483 micropipate ( 00 to 210 micro litter ) 484 micropipate ( 00 to 1500 microlitter ) 485 micropipette tips 0 200 μl 486 micropipette tips 1000 μl 487 micropipette tips 200 μl 488 microscope oil immersion moveable stage abbe condenser etc 489 multichannel micropipette 10μl ( fixed volume, 8 channel with built in tip ejector 490 multichannel micropipette 100μl ( fixed volume, 8 channel with built in tip ejector 491 multichannel micropipette 200μl ( fixed volume, 8 channel with built in tip ejector 492 multichannel micropipette 50μl ( fixed volume, 8 channel with built in tip ejector 493 museum jar ( rectangular with lid ) 494 anti sera e coli ( 5 amplues ) 495 anti sera shigella ( 5 amplues ) 496 anti sera vibrio ( 5 amplues ) 497 anti sera salmonella ( 5 amplues ) 498 patri dish 9cm glass 499 shigella ( lyophilized culture ( 173204 ) ( pack 2 stick ) 500 vibrio ( lyophilized culture ( 173204 ) ( pack 2 stick ) 501 klebsella ( lyophilized culture ( 173204 ) ( pack 2 stick ) 502 proteus ( lyophilized culture ( 173204 ) ( pack 2 stick ) 503 salmonella ( lyophilized culture ( 173204 ) ( pack 2 stick ) 504 alkaline bile salt agar ( himeda ) ( 500 gms ) 505 monsurs gelatin tourochalate ( himedia ) ( 100 gms ) 506 pcv tube ( wintrobe ) 507 petri plate carrier for 10 paltes anerobic system 508 ph meter digital 509 pippete 1ml 510 pippete 5ml 511 plastic container for collection of stool, pus, sputum, with sepcimens 20ml capacity, sterile 512 plastic container for collection of stool, pus, sputum, with sepcimens 50ml capacity, sterile 513 platinum wire loop 514 postmortem glvoes size 8 ½ 515 pricking needles 516 priestley smith perimeter 517 rack for patridish 518 reagent bottle ( 1000cc ) 519 reagent bottle ( 100cc ) 520 reagent bottle ( 2000cc ) 521 reagent bottle ( 250cc ) 522 reagent bottle ( 500cc ) 523 reagent bottle ( 50cc ) 524 reagent bottle 100ml 525 reagent bottle 50ml 526 regent bottle 250ml 527 rubber bulb for pipettes big 528 rubber bulb for pipettes small 529 rubber teats varium volume 530 scissors big size 531 single channel fixed volume micropipette 10μl 532 single channel fixed volume micropipette 100μl 533 single channel fixed volume micropipette 25μl 534 single channel fixed volume micropipette 50μl 535 single channel micropipette variable volume 100 1000μl 536 slide 76mmx25mm 537 spatula 538 spirit lamp 539 staining trough 540 stature needles ( half dozen stainless stell ) cat no. round bodied half circle size 1 541 surgical gloves 7 542 surgical glvoes 6 ½ 543 test tube borocilicated ( 100x12mm ) 544 test tube borocilicated ( 150x18mm ) 545 test tube borocilicated ( 75x12mm ) 546 test tube basket 547 test tube glass 5ml 548 test tube holder 549 test tube plastic with cap 5ml 550 test tube stand ( big ) 551 test tube washing brush 552 test tube with rim 05 cm 553 test tube with rim 10cm 554 thermometer 555 urinometer 556 vdrl shaker 557 water both ( serological ) 56c 558 writing pen for neurograph 559 stationary 560 attendance register student ( custom print ) 561 attendance register staff ( custom print ) 562 calculator ( basic large display ) 563 carbon paper ( 8x13 blue ) 564 chalk color ( 1x100 per pkt, non dust type ) 565 chalk white ( 1x100 per pkt, non dust type ) 566 correcting pen ( white fluid ) 567 cotton tag ( 6 long ) 100 pcs per bunch ) 568 dak book 2qr 569 envelope ( 11x5, laminated 100gsm ) 570 envelope ( 11x5, white 57gsm ) 571 envelope ( 12x16, brown paper100gsm ) 572 envelope ( 8x10, laminated100gsm ) 573 examination copy24 pages ( size 32x20cm ) 60 gsm with numbering neolith paper 574 examination supplementary copy12 pages ( size 32x20cm ) 60 gsm with numbering neolith paper 575 favicol 50 gms 576 file cover ( number j 55 ) ( each ) 577 index file ( each ) 578 file folder ( each ) 579 file lace ( 18 cloth green / white 924 ) ( 100 pcs ) 580 file pad ( each ) 581 glue stick ( 18gms ) 582 glue stick ( 8gms ) 583 gum bottle ( 150ml ) 584 gum bottle ( 700ml ) 585 ink pad ( medium size ) ( each ) 586 paper clip ( 15mm ) 587 paper clip ( 41mm ) 588 paper pin 400gm 589 paper punching machine big size ( each ) 590 paper weight 591 photocopy pape a3 size ( 75gsm 500sheets ) 592 photocopy pape a4 size ( 75gsm 500sheets ) 593 photocopy pape fssize ( 75gsm 500sheets ) 594 pin cushion ( magnet type, standard size plastic body ) 595 sealing wax ( per kg ) 596 stamp pad ( big size ) ( 7cm x 14cm metal case ) 597 stamp pad ( small size ) 598 stamp pad ( small size ) ( 5cmx9cm ) metal case 599 stapler big size no. 24 / 6 600 stapler hp 45 601 stapler pin no.10 602 stapler pin no.24 / 6 603 tag ( big green ) 604 a4 size printing single side 605 a4 size printing double side 606 a5 size printing single side 607 a5 size printing double side 608 a3 size printing single side 609 a3 size printing double side 610 a4 size book printing with binding ( 100 pages ) ( multiple color pages ) 611 register 100 page 612 register200 page 613 register 300 page 614 register 400 page 615 register600 page 616 register 800 page 617 stock register ( 100 page ) ( custom print ) 618 stock register ( 200 page ) ( custom print ) 619 stock register ( 300 page ) ( custom print ) 620 marker pen ( each ) 621 highlighter ( each ) 622 dak book ( custom print ) 623 led bulb ( 09 watt ) 624 led bulb ( 12 watt ) 625 led bulb ( 15 watt ) 626 tag 6’’ 627 flag ( 76mm×15mm×5 ) 628 locker 629 basta cloth 630 led tube light complete set 631 punching machine big size 632 pin cushion plastic box 633 duster 634 paper pin ( steel ) 635 pad ink 636 scissor ( big size ) 637 sealing wax 638 dusting cloth 639 pen ( red, blue & black ) 640 poker 641 detergent powder ( 1 kg ) 642 soap 643 phenyl 644 acid cleaner 645 naphthaline balls 646 dustbin small 647 dustbin big ( 50 ltr ) 648 dustbin big ( 10 ltr ) 649 plastic bucket ( 20 ltr ) 650 toilet brush 651 wiper with handel ( big size ) 652 bomboo stick ( 5 feet ) 653 bomboo stick ( 12 feet ) 654 bomboo basket 655 floor cleaning moper 656 plastic mugs 657 gala hardy 658 water pipe ( flexible ) ( per meter ) 659 date broom 660 coconut broom...

Directorate Of Health Services - Madhya Pradesh

29236671 supply of medicine and pathology material , 5% sodium hypochlorite solution , acetazolamide 250 mg , a vit. 1 lac iu / ml , absolute alcohol100 ml , acarbos 50 mg , aceclofane 100mg+ paracetamol 500mg + chlorzoxazone 500mg tab. , aceclofenac100mg , aceclofenac100mg+paracetamol 500mg+serretopeptidase15mg tab , acenocoumarol 4 mg , acyclovir 200 mg , acyclovir400 mg , acyclovir800mg , acyclovir ointment 3% 5 gram tube , acyclovir suspension 400mg / per 5ml , adrenaline bitartate 1 ml , adrenochrome monosemicarbazone 1 mg / ml 2 ml amp , albendazole 400 mg , albendazole syrup susp 200mg / 5ml bottle 10 ml , alkaline citratedisodium hydrogen citrate 1.25 gm / 5 ml , alkaline po4 , allopurinol 100mg tab , allopurinol 300mg tab 10x10 tab. , alprazolam 0.25mg , aluminium hydroxide suspenson 200 mg / 5 ml170ml , ambroxol 30mg + salbutamole 2mg + theophylline 100mg tab. , ambroxol30mg, salbutamol2mg, guaiphenesin50mg / 5ml , 100ml syrup , amikacin inj100 mg / 2 ml , amikacin inj 250 mg / 2 ml , amikacin inj 500 mg / 2 ml vial , amino acid glass bottle contain amino acid 6 gm, nitrogen 0.929, essential amino acid 51%, non essential amino acid 49%, bcca 22.6%, carbohydrate 5%.200 ml , aminophyllineinj 25 mg / ml , aminophylline tab 100 mg 10x10 tab. , amiodaroneinj 50 mg / ml , amiodarone 200 mg , amiodarone tab 100 mg , amitriptyline 12.5mg + chlordizepoxide 5mg tab. , amitriptyline 25 mg tab , amitriptyline 75 mg tab , amitriptyline inj 10mg / ml vial , amitriptyline sugar coated tab. ip 10 mg 10x10 tab. , amlodipinetab 10 mg , amlodipinetab 5 mg , amlodipine 5 mg + atenolol 50 mg , amoxicillin +cloxacillin ( 250+250 ) , amoxicillin 250 mg + clavulanic acid 125 mg , amoxicillin dispersible 125 mg , amoxycillin +clavulanic acidtab ( amoxycillin 500 + clavulanic acid 125mg ) tab , amoxycillin +clavulanic acid inj ( amoxycillin 500 + clavulanic acid 100 mg ) / vial , amoxycillin +clavulanic acid syp ( amoxicillin 200mg + clavulanic acid 28.5mg ) / 5ml , amoxycillin 125mg+clavulanate pot.31.25mg dry syrup ( 30ml ) , amoxycillin cap 250 mg , amoxycillin cap 500 mg , amoxycillin oral suspension 125 mg / 5 ml , amoxycillinecloxacilline 250 +250mg ( 500mg ) , amoxycillinecloxacilline 500 +500mg ( 1 gm ) , amoxycilline + clavulanic acid 1.2 gm , amoxycilline + clavulanic acid 250gm , ampicillincap 500 mg , ampicillininj 500 mg / vial , ampicillin 1 gm / vial , ampicillin 500 mg + cloxacillin500 mg / vial , ampicillin 250mg+cloxacillin 250mg , anaesthetc eather 600 ml , analgon ip 500 mg. , anti d immunoglobulin for iv / im use ( monoclonal ) inj 150mcg , anti d immunoglobulin for iv / im use ( monoclonal ) inj 300mcg , anti rabies vaccine 300 iu / ml 5ml vial , anti scorpion venom 10 ml ( lyophilized ) vial , anti snake venominj polyvalent 10 ml ( lyophilized ) , antiseptic solution contains chloroheidine gluconate ip 1.5% v / v strong certrimide bp soln, equivalent to cetrimide ip 3% w / v , antitetanus immunoglobulinsinj 250 iu / vial , arteether 150 mg2 mlvial , arteether 75 mg amp. , arteether a b , artemether 80 mg / ml 2ml vial , artemether+lumefantrine tab 20 mg+120 mg , artesunate + sulphadoxine + pyrimethamine ( age group 15 or above ) tab artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg ( 2tablets ) + pyrimethamine 37.5 mg ( 2 tab ) tablets ip , artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) tab artesunate 150mg ( 3tab ) + sulphadoxine 500mg ( 2 tab ) +pyrimethamine 25mg tab ip ( 2tab ) , artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 years ) tab artesunate 50 mg ( 3 tab ) + sulphadoxine 500mg ( 1 tab ) + pyrimethamine 25 mg ( 1 tab ) tablets ip , artesunate + sulphadoxine + pyrimethamine ( age group of less than 1year ) tab artesunate 25mg ( 3tab ) + sulphadoxine 250mg ( 1tab ) +pyrimetha mine 12.5mg tablets ip ( 1tab ) , artesunate + sulphadoxine + pyrimethamine ( age group between 5 to 8 years ) tab artesunate 100 mg ( 3tab ) + sulphadoxine750mg ( 1 tab ) +pyrimethamine 37.5mgip tab ( 1tab ) , artesunate 50mg tab 10x10 tab. , artesunate inj 60 mg / vial , aso titre test kit , aspirin325 mg , aspirin tab 75 mg , atenololtab 100 mg , atenololtab 50 mg , atorvastatin20 mg , atorvastatintab 10 mg , atracurium besylate usp250mg / 2.5ml , atracurium inj 10 mg / ml , azithromycintab 250 mg , azithromycintab 500 mg , azithromycin 250 mg 5 ml vial , azithromycin 500 mg / 10mlvial , azithromycin suspension 100 mg / 5 ml 15ml , azithromycin suspension 200 mg / 5 ml 15ml , b complex ( nfi formula ) vit.b1 2mg, vit.b2 2mg, vit. b6 0.5mg, niacinamide 25mg, calcium pantothenate 1mg 100 ml , b1, b6, b12 10mg+3 mg+15mg , baclofen 10 mg , bendict solution 500 ml , benzdiene powder , benzoic acid+salicylic acid oint 6%+3% ( 15gm ) , benzoyl peroxide 5% gel, 20 gm. tube , benzyl benzoate emulsion25%100 ml , benzyl penicillin 10 lac units / vial , benzyl penicllin 5 lac / iv , benzyl penicllin power for 2.4 mu / vial , betahistinetab 8 mg , betamethason dipropionate 0.05% w / w + gentamycine 0.10% w / w tube ( 15gm ) , betamethasone cream 0.25% 15gm , betamethasone valerate 0.025% + gentamicin sulphatetolnaftate 0.1% + iodochlorhydroxyquinoline 1% oint. 5 gm , betamethasone valerate cream0.05% 10 gm , betamethasone valerate cream0.1% 10 gm , betamethasone valerate drop 1% ( 5ml ) , betamethasone valerate inj. 0.5mg / 1ml , betamethasone valerate tab. 1mg 10x10 tab. , bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable [ 987758 ] , biperiden 2 mg tab ( hydrochloride ) 10x10 tab. , bisacodyl suppositories 5 mg , blood grouping antisera a , blood grouping antisera b , blood grouping antisera d , bromhaxine hcl 8mg + terbutaline 2.5mg / 5ml syrup ( 50ml ) , bromhexinesyp 4mg / 5ml , bt / ct , budesonideinhalation 200 mcg per dose , budesonide nebulising suspension containing budesonide 0.5 mg / 2 ml , budesonide respules 1 mg / 2 ml , bupivacaine 0.5% 4ml amp , bupivacaine hcl for spinal anaesthesia inj 0.5%+8.25% dextrose , bupivacaine hcl inj 0.5% , busullphan tab 2mg 10x10 tab. , caffeine citrateinj 20 mg / ml , calaminelotion , calcium carbonate .tab 500 mg , calcium carbonate 1.25 mg / 5 ml 100ml , calcium carbonate tab. 1gm , calcium carbonate tab. 250mg , calcium chloride injection . , calcium citrate 1000mg ( elemental ca equivalent to 250 mg and vitamin d3 400 iu ) 10 x 10 tab , calcium dobesilate , calcium gluconate tab 500mg 10x10 tab. , carbamazepin 400 mg tab , carbamazepina 100 mg , carbamazepina 100 ml / 5 ml , carbidopa + levodopa 10mg+ 100mg tab. , carbimazole 5 mg , carboprost ( 15 methyl pgf2a ) inj 250mcg , carboprost tromethamine ( 15 methyl pgf2a ) inj 250mcg / 1ml vial , carboxymethylcelluose eye drops 0.5% 10ml , carvedilol6.25 mg. , cefalexin250 mg dt , cefaperazone +salbactum 500 mg , cefaperazone +tazobactum 1.125 , cefazolininj 500 mg / vial , cefazoline 1 gm / vial , cefepime 1 gm / vial , cefepime 1 gm + tazobactam 125 mg / vial , cefepime 1000mg + sulbactam 500mg vial , cefepime 2000mg + sulbactam 1000mg vial , cefepime 250 mg / vial , cefepime 500 gm + tazobactam 62.5 mg / vial , cefepime 500 mg / vial , cefepime 500mg + sulbactam 250mg vial , cefiximeoral suspension 100mg / 5ml , cefiximetab 200 mg , cefiximetab 50 mg , cefixime 100mg 10x10 tab , cefoperazone + sulbactaminj ( 1000 mg +1000 mg ) / vial , cefoperazone 1 gm / vial , cefoperazone 500mg+ sulbactam 500mg vial , cefotaximeinj 1gm / vial , cefotaximeinj 250 mg / vial , cefotaximeinj 500 mg / vial , cefotaxime 250 mg + sulbactam 125 mg / vial , cefotaxime 500 mg + sulbactam 250 mg / vial , cefpirome 1 gm / vial , cefpirome 1000mg + sulbactam 500mg vial , cefpirome 250 mg / vial , cefpirome 500 mg / vial , cefpodoxime tab 200 mg , ceftazdime* 1 gm , ceftazdime* 250 mg vial , ceftazdime* 500 mg vial , ceftazidime 1000mg + sulbactam 500 mg vial , ceftazidime 500mg + sulbactam 250 mg vial , ceftriaxoneinj 1 gm / vial , ceftriaxoneinj 250 mg / vial , ceftriaxoneinj 500 mg / vial , ceftriaxone 1 gm + sulbactam 500 mg / vial , ceftriaxone 1 gm + tazobactam 125mg / vial , ceftriaxone 250 mg + sulbactam 125 mg / vial , ceftriaxone 250 mg + tazobactam 31.25 mg / vial , ceftriaxone 500 mg + tazobactam 62.5 mg / vial , cefuroxime 125 mg / 5 ml 30 ml , cefuroxime 500 mg , cephalexin500 mg , cephalexincap 250 mg , cephalexinsyp 125mg / 5ml , cetirizine syp 5mg / 5ml , cetirizine tab 10 mg , cetrimide + chlohexidine conc. ( 15% + 7.5% ) , cetrimide cream bp 0.1 %w / w500gm jar , cetrizine 5 mg + ambroxol 60 mg , cetrizine hcl 5mg , ambroxol hcl 30mg / 5ml , 60ml syrup , chloramphenicol 1%+hydrocortisone 0.5%3 gm , chloramphenicol eye drops 0.5% ( 5ml ) , chloramphenicol syp 125mg / 5ml ( 50ml ) , chloramthenicol 250 mg , chlordiazepoxide 10 mg. tab , chlordiazepoxide 25 mg tab 10x10 tab. , chlorhexidine gluconate 0.25% + metronidazole 1%10 gm gel , chlorhexidine gluconate mouthwash0.2 % w / v solution , chlorine isi marked 0.5 pack of 1000 tab , chloroquinetab 250 mg , chloroquine inj 40 mg / ml , chloroquine phosphate 64.5 mg / ml ( 30ml ) vial , chloroquine syp 160mg / 10ml ( 50mg / 5ml base ) , chlorpheniramine inj 10 mg / ml , chlorpheniramine tab 4 mg , chlorpromazine25mg / ml 2 ml amp inj , chlorpromazinetab 100 mg , chlorpromazine 10 mg , chlorpromazine 25 mg , chlorpromazine 50 mg tab , cholesterol kit end point enzymatic kit 5x20ml 200 test / kit [ 987759 ] , chondrotin sulphate +glucosamine , chymotrypsin & trypsin , cinnarizine75 mg , cinnarizinetab 25 mg , ciprofloxacineye / ear drop 0.3% , ciprofloxacininj 200 mg / 100 ml , ciprofloxacintab 250 mg , ciprofloxacintab 500 mg , ciprofloxacin 0.3 % + dexamethasone 0.1% eye / ear drops 10ml , ciprofloxacin 250 mg +tinidazole 300 mg , ciprofloxacin 500 mg +tinidazole600 mg , clarithromycin 250 mg , clarithromycin 500 mg , clindamycininj 150 mg / ml , clindamycin 150 mg , clindamycin 300 mg , clindamycin gel 20mg 1% ( 20gm ) , clobazam 10 mg tab , clobazam 5 mg tab , clobetasol 0.05% + gentamicin 0.1% 10 gm cream , clobetasol butyrate 0.05% 10 gm cream , clofazimine 100 mg , clofazimine 50 mg , clomiphene citrate50 mg tab , clomiphene citrate 25mg tab , clonazepam 2 mg. tab , clonidine 100 mg , clopidogreltab 75 mg , clopidogrel 75 mg + aspirin 150 mg , clopidogrel 75 mg + aspirin 75 mg , clotrimazole1% ear drops 15ml , clotrimazole ( vaginal tab ) pessary 500 mg ( with applicator ) , clotrimazole 1% + beclomethasone 0.025%+chloramphenicol 5% and + lignocaine 2% ear drops 10ml , clotrimazole 1% + lignocaine 2% ear drops 10ml , clotrimazole cream 2%w / w , cloxacillin500 mg / vial , cloxacillin 500 mg , colistin sulphate syp 12.5mg / 5ml antidiarrhoeals / gi anti infectives 100ml , complete blood picture ( t&d ) , cpk mb , cpk mb card , c reachlue protein kit , crp , csf analysis , cyclopentolate1% eye drops 5ml , cyclosporine 100mg / ml 50 ml , cyproheptadine 4 mg , cyproheptidine hcl 2mg , l lysine hcl150mg / 5ml , tonic 150ml , d 10 ( dextrose 10% ) iv fluid ( dextrose 10% ) , dapsone tab 100mg 10x10 tab. , deferasiroxtab 500 mg , deferasirox 100 mg , deferasirox 400 mg , dengue, chikengunia, , dental x ray film , desferrioxamineinj 500 mg / vial , desmopressine amp. , dexamethasone + gentamycin eye drop 0.1%+0.3% 5ml vial , dexamethasone 0.1 % + neomycin 0.5% eye drops 3ml , dexamethasone inj 8 mg / 2 ml , dexamethasone sodium 4mg tab10x10 tab. , dexamethasone tab 0.5 mg , dextran 40i / v 10% , dextran 70 injection , dextromethorphan hydrobromidesyp 10 mg / 5ml , dextrose 50% ( injection ) 50ml , dextrose with saline i / v fluid ( dextrose 5% + saline 0.9% ) , diacerin 50 mg , diagonostic stripfor sugar / albumin 100 no pack bottle , diazepaminj 5 mg / ml , diazepamtab 5 mg , diazepam 10 mg. tab , diclofanac 50mg + tizanidine 2mg tab. , diclofanec + paracetamol ( 50 mg +500mg ) , diclofenac 50 mg + serrtiopeptidase 15 mg , diclofenac gel 1% 20 gm tube , diclofenac inj 25 mg / ml , diclofenac tab 50 mg , dicyclominehcl+paracetamal 10 mg +500mg , dicyclomine hydrochlorideinj 10 mg / ml , dicyclomine hydrochlorideoral solution 10 mg / ml , dicyclomine hydrochloridetab 10 mg , dicyclomine hydrochloridetab 20 mg , diethylcarbamazinetab 100 mg , diethylcarbamazine tab 50 mg 10x10 tab. , digoxininj 250 mcg / ml , digoxintab 0.25 mg , dihydroergotamine sulphonate 1 mg , diltizemtab 30 mg , diltizem 5 mg / 1 ml , dinoprostone 0.5 mg , diphenhydramine 12.5 mg / 100 ml , diphenhydramine 25 mg , diphenhydramine inj 50mg / ml vial , diphtheria antitoxin 10000 iu , disodium hydrogen citrate 1.4gm / 5ml 100ml , disulfiram 250 mgtab , ditizem 60 mg , dobutamineinj 50 mg / ml , domperidone1mg per 10ml suspension , domperidonetab 10 mg , domperidone 5 mg , dopamineinj 40 mg / ml , dorzolamide 2% eye drops 5ml , doxofylline 400 mg , doxycyclinecap 100mg , doxylamine succinatetab 10 mg , doxylamine succinate 10mg+pyridoxine10mg tab 10x10 tab. , drop multi vitamin ( appro. 22 drops ) each ml contains vitamin a ip 3000 iu 1mg, riboflavine phosphate sodium ip 2 mg, dpanthenol ip . 2.5 mg miacinamide ip 10 mg pyridoxine ip 1 mg cyanocoblamine ip . 1 mg lagine hcl usp 10 mg , drotaverineinj 40 mg / 2 ml , drotaverinetab 40 mg , dydrogesterone10 mg tab , ecg gel 250 ml bottle , ecg roll , electolyte e dextrose 5 g, sodium aetate 0.64g, sodium chloride 5g, potassium chloride 75 mg, sodium citreate 75mg, calcium chloride 52 mg sulphate 20 mg , 500 mlffs / bfs bottle , electolyte m iv 500 mlffs / bfs bottle , electolyte p iv 500 mlffs / bfs bottle , enalapril maleatetab 2.5 mg , enalapril maleatetab 5mg 10x10 tab. , enoxaparininj 40 mg equivalent to 4000 iu , epirubicininj 100 mg / vial , equine rabies immunoglobulin 1000 iu 5ml vial , erba wash for biochemistry analyser , erythromycinpowder for susp . 125 mg / 5 ml 40 ml bottle. , erythromycin 250 mg , erythromycin 500 mg , erythropoetin2000 i.u. , escitalopram 10 mg tab , escitalopram 20mg 10x10 tab. , escitalopram 5mg 10x10 tab. , esmolol 10 mg / ml 10ml vial , esr , ethacridine lactate inj 0.2 mg / ml 50 ml vials ( 3 vials 1 case ) , ethamsylatetab 250 mg , ethamsylate 125mg / ml 2ml amp , ethamsylate 500 mg , ethanol solution 70% ( denatured ) , 500ml , ethinyl oestriadiol+levonorgestrel tab 30mcg+150mcg 21tab strip , ethinyl oestriadiol+levonorgestrel tab 30mcg+300mcg tab 21tab strip , ethinylestradiol +norethisteronetab 35 mcg +1mg , ethionamide tab 125mg 10x10 tab. , ethionamide tab 250mg 10x10 tab. , etiophylline theophylline sr tab. 300mg , etophylline +theophyllinesyp ( 46.5 + 40 ) mg / 5 ml , etophylline +theophylline inj 220 mg / 2 ml ( 169.4+50.6 mg ) , etophylline +theophylline tab 100 mg ( etophylline 77 + theophylline 23 ) mg , etoposideinj 100 mg / 5 ml , eusol disinfactant & antiseptic, 500ml , fentanyl 50 microgram / ml , ferous sulphate dessicated 333 335mg equivalent to 100mg of elemental iron + folic acid0.5mg , ferrous salt + folic acid equilvent to 60mg iron +400mcg folic acid ( iron & folic acid capsules ( ifa ) – large , dried ferrous sulphate ip eq. to ferrous iron 100 mg & folic acid ip 0.5 mg as enteric coated granules ) , iron & folic acid tablets ( ifa ) – small dried ferrous sulphate ip eq. to ferrous iron30mg & folic acid ip 0.1 mg / 250 μg , ferrous sulphate 200 mg ( equivalent to 65 mg elemental iron ) , ferrous sulphate exsiccated ip 67 mg ( equivalent to 20 mg of elemental iron ) + folic acid ip 0.5 mgsmall , fexofenadine 120 mg , fexofenadine 180 mg , field stain a ( mfg precious ) ( 500 ml bottle ) , consumable [ 700728 ] , field stain b ( mfg precious ( 500 ml bottle ) , consumable [ 700728 ] , fluconazoleeye / ear drops 3mg / ml , fluconazole tab 150 mg , flumazenilinj 0.1 mg / ml ` , flunarizinetab 5 mg , flunarizine tab 10 mg 10x10 tab. , fluoxetinecap 10 mg , fluoxetine cap 20 mg , fluphenazineinj depot 25 mg / ml , flurbiprofen 0.03% eye drops 5ml , fluticasone 0.05% 10gm ointment , formaldehyde ( formalin ) 34% acq , formaline tab. , framycetin sulphate1% cream , fresh frozen plasma injection , furazoladone 25 mg / 5 ml 60 ml , furazolidone + metronidazoletab , furazolidone tab 100 mg , furazolidone25mg+ metronidazole benzoate 100mg / 5ml 60ml syrup , furusemideinj 10 mg / ml , furusemidetab 40 mg , fusidic acidcream / ointment 2% , g 6pd deficiency , gabapintine , gamma benzene hexachloride1% solution , gemcitabine inj 1.4 gram / vial , genseng 250mg cap. , gentamicinear / ear drop ( 0.3% ) , gentamicininj 40 mg / ml , gentamicin cream 0.1% 15 gm , gentamycin 0.3% + betamethasone 0.1% eye / ear drops 5ml , gention violet point 50 ml , glacial acetic acid , glibenclamide tab 2.5 mg 10x10 tab. , glibenclamide tab 5 mg 10x10 tab. , glibenclamide1.25mg+metforminhcl500mg ( tab ) , gliclazidetab 80 mg , glimeperidetab 1 mg , glimeperidetab 2 mg , glipizide 2.5mg + metformin 250 mg , glipizide 5 mg + metformin 500 mg , glucometer strips ( 1 should be able to use capillary blood samples, 2 should have a minimum 4 months shelf life after opening the strip vial, ) ( 3.all strips should have at least one year expiry date from the date of supply, ( 1 glucometer free with each 1 thousand strips ) ) , consumable [ 700610 ] , glucosamine500 mg , glucosamine hcl 500 mg+chondratin sulphate 650 mg , glucose kit ( god pod ) , glucose powder 100 gm , glucose with sodium chloride injection , gluteraldehyde solution b.p ( 5 ltr cans ) , glycerine ip solution , glycerol trinitrate 2.5mg tab , glyceryl trinitrate ( sublingual ) tab 0.5mg 25 tab , glyceryl trinitrate 5 mg / ml injection , glycopyrrolate inj 0.2 mg / ml , griseofulvin tablet 250 mg , haemoglobin2.09g, ferric ammo cit125mg, vitb1, 17.5mcg, folic acid0.5mg, alchol0.87ml ( 5.5%v / v ) per 15ml, 200ml ( syrup ) , , haloperidolinj 5 mg / ml , haloperiodoltab 5 mg , haloperiodol tab 1.5 mg , halothane inhalation , hbs antigen kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic [ 5400004 ] , hcg ( human chorionic gonadotrophin ) 10000 iu vial , hcg ( human chorionic gonadotrophin ) 2000 iu vial , hcg ( human chorionic gonadotrophin ) 5000 iu vial , hcv 50 test , hdl cholestrol kit , hdl kit 50 test [ 987882 ] , hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit [ 6120003 ] , heparininj 1000 iu , heparin sodium 5000 iu / ml injection , hepatitis b immunoglobulin100 iu / vial , hivag , homatropine 2% eye drops5ml , human albumin solution ipi / v 20% w / v , human anti d immunoglobin ( polyclonal ) inj. 300 mcg , human anti d immunoglobuli 150mcg / ml vial , hyaluronidase 1500 iu 1ml vial , hydrochlorothiazidetab 25 mg , hydrochlorothiazide 50 mg , hydrochlorthiazide 12.5 mg , hydrocortisone sodium succinate inj 200 mg / ml vial , hydrocortisone sodium succinate inj 400 mg / ml vial , hydrogen peroxide solution6% v / v , hydroxy ethylstarch solution ( hydroethylstarch 6% solution ) iffs / bfs , hydroxy progesterone catroate 25 mg , hydroxy propylmethyl cellulose 2% prefilled syringe 3ml , hydroxyprogesterone caproate inj 250mg / ml1ml amp , hydroxypropyl methyl cellulose0.3% w / v eye drops 10ml , hyoscine butylbromideinj 20 mg / ml , hyoscine butylbromide 10 mg , ibuprofen + paracetamol , ibuprofen + paracetamol ( 100+125mg ) tab. , ibuprofen + paracetamol ( 400+325 mg ) , ibuprofen oral suspension 100mg / 5ml , ibuprofen tab 200mg 10x10 tab , ibuprofen tab 400 mg , ifa syrup: 100 ml bottle , imipramine hcl 25 mg tab , inj.meropenam 1 gm , inj.meropenam 125mg , inj.meropenam 250mg , inj.meropenam 500mg , intra cameral lignocain amp.1ml , intra cameral moxyfloxacine amp. 1ml , intracameral adrenaline tartarate 1:1000 1mlamp , intracameral pilocarpine 0.5% 1ml amp , intracameral trypan blue 0.06 % 1mlvial , ipratropium20 mcg / puff inhaler , ironferrous fumarate equivalent toelemental iron 30mg / 5ml200ml , iron & folic acid enteric coated tablet strength: ferrous sulphate dessicated ip 67 mg equilent to 20 mg of elemental iron & folic acid ip 0.1 mg for children , iron folic acid ferrous sulphate exsiccated ip 333 mg , ( equivalent to 100 mg of elemental iron. ) ferrous sulphate of elemantal iron + folic acid ip 0.5 mg large , iron hydroxide polymaltose complex equivalente to elemental iron 500mg, folic acid i.p. 0.5mg200ml syp , iron polymaltose 50 mg elemental iron / ml 2mlamp , iron sucroseinj 100 mg / 5 ml , isoflurane inhalation , isolyte g 500 ml bott. , isosorbide 5 mononitrate tab 20 mg , isosorbide dinitrate tab 5 mg , isotonac 3, 18l , isoxsuprine hydrochloride inj 5 mg / ml , isoxsuprine tab 10mg 10x10 tab. , isoxsuprinme 20 mg , ivermectin3 mg dispersible , ivermectin6 mg , ivermectin 12 mg , k3 edta collection tube / vaccutainer with cap , ketamine 50 mg / ml10ml amp , ketamine inj 10 mg / ml , ketoconazole 2% 10 gm ointment , ketoconazole tab 200mg 10x10 tab. , ketorolac 10 mg , labetalolinj 20 mg / 4 ml , labetaloltab 100 mg , labetalol 200mg tab. 10x10 tab. , lactobacillus 120million spores , lactobacillus 60 million spores , lactobacillus combinations ( lactobacillus tab.60 million spores tab.10 x 10 ) , lactulosesolution 10 gm / 15 ml , lamivudine and zidovudine 150+300mg , leishmen stain powder , letrozole 2.5 mg , levetiracetam 250 gm tab , levetiracetam 500 gm tab , levocetirizine tab 5mg 10x10 tab. , levocetrazin 60 ml , levocetrizine 10 mg , levocetrizine 5 mg + ambroxol 60 mg , levodopa 100 mg + carbidopa 10 mg , levodopa 250 mg + carbidopa 25 mg , levodopa+ carbidopa tab levodopa 200 mg + carbidopa 50 mg cr , levodopa+carbidota 50 mg +250 mg , levofloxacininj 500 mg / 100 ml , levofloxacintab 250 mg , levofloxacin tab 500 mg , levonorgeastrel 0.75 mg emergency contraceptives tab. 2 tab. pack , levothroxine 25 mcg 10x10 tab. , levothyroxinetab 100 mcg , levothyroxinetab 50 mcg , lignocain hydrochloride 2 % ( with dextrose 75 mg / ml ) 30 ml vial , lignocain hydrochloride 5 % ( with dextrose 75 mg / ml ) 30 ml vial , lignocain hydrochloride topical solution usp 4% 30 ml , lignocainefor spinal anaesthesia inj 5% + 7.5% destrose , lignocaine +adrenaline inj 2% + 0.005 mg / ml , lignocaine 2 % ( 21.3 mg / ml ) 30 ml vial , lignocaine gel 2% , lignocaine hcl inj. 2% w / v 30ml in each vial for local anaesthesia , lignocaine inj 2% , lignocaine inj. 4% 30ml vial , lignocaine with preservative inj 2% ( 30ml vial ) , lincomycin 300 mg , lincomycin 600 mg , liquid paraffin / oil for oil immersion lens100 ml , liquous ammonia100 ml , lmwh low molecular weight haparin 0.4 inj vial , lmwh low molecular weight haparin 0.6 inj vial , lnsulin 30:70 mixtrate 10 ml vial , lnsulinsoluble 40 iu / 10 ml vial , lorazepam 1 mg tab , lorazepam 1 mg / ml 2 ml amp inj , lorazepam inj 2 mg / ml , lorazepam tab 2 mg , losartan 25 mg , losartan 50 mg , magnesium hydroxide + aluminium hydroxide ( 500 mg + 250mg ) , magnesium sulphateinj 50% , mannitolinj 20% , mannitol 10 % 350 ml bottle , mathylergometrine maleate 0.125 mg , mebendazole 100 mg tab 10x10 tab. , mebendazole each 5 ml / 100mg 30ml , medroxy progesterone 10 mg , medroxy progesterone acetate 2.5mg , mefipristone 200 mg tab. , mefloquinetab 250 mg , mephentermine 30 mg / ml , mesalamine ( 5 aminosalicylic acid ) usp tab 400mg , metformintab 500 mg , metformin 1gmtab 10x10 tab , metformin 850 mg , metformine 500 mg + glibenclamide 5 mg , methanol , methocarbamol 100mg / 10ml 10ml amp , methotrexate2.5 mg , methycobalamine , methylprednisolone 16 mg , methylprednisolone 8 mg , methyl ergometrine maleateinj 0.2 mg / ml , methyl ergometrine maleatetab 0.125 mg , methyl prednisolone 4 mg , methyl prednisolone sod.succinate inj 40 mg / ml , methyl prednisolone sodium succinate inj. 1000mg vial , methyl prednisolone sodium succinate inj. 125mg vial , methyl prednisolone sodium succinate usp 500mgvial , methyldopatab 250 mg , metoclopramideinj 5 mg / ml , metoclopramidetab 10 mg , metoclopramide syrup 2ml amp , metoprololinj 1 mg / ml , metoprololtab 50 mg , metronidazole1% ointment , metronidazole 1% 20 gm gel , metronidazole 200mg / 5ml 30ml , metronidazole inj 500 mg / 100 ml , metronidazole tab 200 mg , metronidazole tab 400 mg , miconazolecream 2% w / w , miconazole 1% + betamethasone dipropionate 0.05% 10 gm , micro pipette ( 100ul 1000ul ) variable size , micro pipette ( 5ul 50ul ) variable size , micro tips ( 100ul 1000ul ) 100 pack , micro tips ( 2ul 100ul ) 100 pack , microbiology ( blood / urine culture sensitivity ) , micronized progesterone 200 mg 4ml amp , midazolam 1mg / ml, 10ml vial , midazolam inj 1 mg / ml , mifepristonetab 200 mg , mifepristone 200mg tab, ( mifepristone 200 mg ) drug acting on uterus , milk of magnesia 11.25ml + liquid paraffin 1.25ml / 5ml 170 ml , mirtazapine 15 mg tab , mirtazapine 30 mg tab , misoprostaltab 200 mcg , misoprostal tab. 100mcg 10x10 tab , mmr vaccine ( vial ) , mometasone furoate 0.1% 5 gm cream , monteleukast +lebocetrizine , montelukast 5 mg , moxifloxacin0.5% eye drops 5ml , moxifloxacine + prednisolon eye drop 10ml , multivitamin drops ( approx 22 drops ) 15ml vial , multivitamin tab. ( nfi formula ) sugar coated vita 2500 iu, vit b1 2mg , vit b 6 0.5mg, vit c 50mg, vit d3 200 iu, vit b2 2mg niacinamide 25mg, folic acid 0.2mg , mupirocincream / ointment 2% , n / 10 hcl 100 ml , n acetyl cysteineinj 200 mg / ml , nadifloxacin 1% 10 gm , naloxoneinj 0.4 mg / ml , naproxen 250mg nsaid tab 10x10 , neomycin0.5% ear / eye drops5ml , neostigmineinj 0.5 mg / ml , neostigmine+glyocopyrolate inj neuromuscular drug , nifedipinetab 10 mg , nifedipine cap 5 mg , nimesulide 100 mg , nitazoxamide syrup , nitrazoxamide , nitrofruantoin 100mg tab 10x10 , nitrofurazone cream 500 gm. iar , nitroglycerine , nitroglycerine ( glyceryl trinitrate ) sub lingual tab 0.5 mg , nitroglycerine ( glyceryl trinitrate ) inj 25 mg / 5 ml , noradrenalineinj 2 mg base / 2 ml amp. , norethisterone tab 5mg10x10 tab. , norfloxacin + metronidazole 100 mg / ml 30 ml , norfloxacin 0.3% ( eye drop ) , 5ml , norfloxacin 400 mg + tinidazole 600 mg , norfloxacin, tinidazole ( 400+600mg ) tab , ofloxacintab 200 mg , ofloxacin + tinidazole ( 50+100mg ) , 30ml syrup , ofloxacin 0.3%eye / ear drops5ml , ofloxacin 0.3%+dexamethosone+na phosphate0.1% ( eye drop ) 5ml , ofloxacin 400 mg , ofloxacin eye oint. 0.3% 10 gm , ofloxacin inj 2mg / 1ml 100ml bottal , ofloxacin suspension 50mg / 5ml 30ml , ofloxacine + ornidazole ( 200mg + 500mg ) tab. , olanzapine 10 mg / 5 ml amp inj , olanzapine 10 mg tab , olanzapine 20 mg tab , olanzapine 5 mg tab , olopatadine eye drops 0.2% 5ml , omeprazole20mg , omeprazole40mg , omeprazole +domperidon , omeprazole 40mg 10mlvial , ondansetroninj 2 mg / ml , ondansetronsyp 2mg / 5 ml , ondansetrontab 4 mg , ondansetron 8 mg , orindazole 500 mg , oseltamivir h1 n1 antiviral cap 30 mg oseltamivir should be used only in compliance with who treatment guideline i.e. 1. for treatment of patients with reverse or progressive clinical illness with confirmed or suspected influenza pandemic ( h1 n1 ) 2009. 2. for the treatment of patients wit confirmed or suspected but un complicated illness due to pandemic influenza virus infection who were in high risk groups most notably for pregnant women and children under 2 years of age. , oseltamivir h1 n1 antiviral cap 45 mg oseltamivir should be used only in compliance with who treatment guideline i.e. 1. for treatment of patients with reverse or progressive clinical illness with confirmed or suspected influenza pandemic ( h1 n1 ) 2009. 2. for the treatment of patients wit confirmed or suspected but un complicated illness due to pandemic influenza virus infection who were in high risk groups most notably for pregnant women and children under 2 years of age. , oseltamivir h1 n1 antiviral cap 75 mg oseltamivir should be used only in compliance with who treatment guideline i.e. 1. for treatment of patients with reverse or progressive clinical illness with confirmed or suspected influenza pandemic ( h1 n1 ) 2009. 2. for the treatment of patients wit confirmed or suspected but un complicated illness due to pandemic influenza virus infection who were in high risk groups most notably for pregnant women and children under 2 years of age. , oxy tetracycline 30 ml , oxygen inhelation ( oxygen ip medical oxygen in steel or aluminium, cylinder ( 10 litres water cap ) .with gas specific pin system ( 2cylinders ) uninterrupted supply to be ensured by the state ( not to be supplied by goi as part of the kit ) ) , oxytocininj 5 iu / ml , oxytocin inj 10iu / ml 1ml amp , pancuronium2mg / ml2mlamp , pandys reagent , pantoprazoleinj 40 mg / vial , pantoprazoletab 40 mg , pap smear for cytology , paracetamol100mg / ml oral drops15ml , paracetamol 150mg + prophenazona 150mg tab. , paracetamol 325mg + diclofenac k 50mg +streptopeptidase 120mgtab. , paracetamol chlorzoxane & diclofenacsodi pot 325 mg +250 mg +50 mg. , paracetamol drops 150mg / ml , paracetamol inj150 mg / ml , paracetamol syp 125mg / 5 ml , paracetamol tab 500mg , paracetamol170mg+dextromethorphanhbr5mg+chlorpheniraminemaleate1.5mg+phenylephrinehcl2.5mg tab. , paraffin liquid 500ml. bottle , pbf for malaria , pentaprazole 40 mg 1ml amp. , pentaprozole + domperdom ( 40+10mg ) , pentazocin lactate 30 mg .ml 1 ml amp. , peracain eye drop 5ml , permethrincream 5% w / v , permethrin lotion 1, 5%w / v 60 ml bottles , pheniramine maleate , pheniramine maleate 22.75 mg / ml 10ml vial , pheniramine maleate 22.75 mg / ml 2ml amp , phenobarbitoneinj 200 mg , phenobarbitonetab 30 mg , phenobarbitone 60 mg , phenobarbitone syp 200mg / 5ml , phenyl black strength:specification as per schedule 5 liter can o grade 1 , phenylephrineye drop 2.5 % , phenylephrine hcl 5%+ tropicamide 0.8%eye drops 5ml , phenytoininj 50 mg / ml , phenytoinoral suspension 25mg / ml , phenytointab 100mg , phenytoin sodium25 mg / ml , phenytoin sodium 50 mg , pilocarpineeye drops 2% , pilocarpineeye drops 4% , pilocarpine 0.5 % / 1ml amp , piperacillin +tazobactaminj 4.5 gm / vial , piperacilline+tezobactam 1 gm.+125 mg amp. , piracetam 800 mg , piroxicam 20 mg , platelet count , pleural / ascitic analysis , potassium chlorideinj 150 mg / 10 ml , potassium chloride oral solution 100mg / ml , povidone iodinegargle 1 % 50ml , povidone iodinesolution 5%, , povidone iodinesurgical scrub 7.5% , povidone iodine 1% ( septidine ) eye drops 10ml , povidone iodine ointment 5% 250 gm , povidone iodine ointment 5% 500 gm , povidone iodine powder 5% 10 gm , povidone iodine powder 5% 20gm , pralidoxime ( pam ) inj 25 mg / ml , prazosin 5 mg , prednisolone tab 20 mg , prednisolone tab. 10mg 10x10 tab. , prednisolone tab. 5 mg 10x10 tab. , pregabalin , pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable [ 700682 ] , primaquinetab 15 mg , primaquinetab 2.5 mg , primaquine tab 7.5mg , progynon depot , promethazine 20 mg / ml 2 ml amp. , promethazine syp 5mg / 5ml , propranolol 10 mgtab 10 mg , propranolol 40 mgtab 40 mg , propranolol 20 mg tab 10x10 tab betabloker , protamine sulphateinj 10 mg / ml , protamine sulphate 50mg 5ml vial , prothrombin time , pseudoephiderine 60 mg + chlorphenarime maleate 4 mg , ptt ( partial thromboplastin time ) , pus culture and sensitivity , pyrazinamide tab 500mg 10x10 tab. , pyrazinamide tab 750mg 10x10 tab. , pyridoxinetab 10 mg , pyrimethamine+sulphamethopyrazine 25mg+500mg tab 10x10 tab. , quinineinj 300 mg / ml , quininetab 300 mg , quinine sulphate 100mg / 5ml60 ml , quinine sulphate 150 mg , ra factor rapid kit 1 ) should be based on latex agglutination slide test 2 ) qualitative and semi quantative testing facility possible 3 ) test speed must be < 2 minutes ( 25 test / kit ( mfg by beacon diagnostic ) ) , consumable [ 700756 ] , rabeprazoletab 20 mg , rabeprazole 10mg tab 10x10 tab. , rabeprazole 20 mg / ml vial , rabies immunoglobulin300 iu / 2 ml , rabies vaccine ( cell culture ) id / iminj 2.5 iu / ml , ramiprilhydrochloride 1.25 mg , ramiprilhydrochloride 5 mg , ramipriltab 2.5 mg , ranitidineinj 50 mg / 2 ml , ranitidinetab 150 mg , ranitidine, dicyclomine ( 150+10mg ) tab , ranitidine, domperidone ( 150+10mg ) tab , rbc diluting fluid , reduced osmolarity ors pkt. who formula o.r.s. glucose 75meq, sodium 75m eq or m mol / l, chloride 65m eq or m mol / l, potassium 20meq or m mol / l , citrate 10m mol / l osmolarity 245m osm / l, dextrose 13.5g / l sodium chloride 2.6g / l potassium chloride 1.5g / l, trisodium citrate dihydrate 2.9g / l+trisodium citrate dihydrate may be replaced by sodium hydrogen carbonate ( sodium bi carbonate ) 2.5g / l. , ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride , risperidone 1 mg tab , risperidone tab 2 mg , roxithromycin 150 mg , roxithromycin150mg + seratopeptidase10mg ( tab ) , salbutamol 2mg / 5ml100 ml , salbutamolnebulizing solution 5 mg / 2.5 ml , salbutamolsyp 2mg / 5ml , salbutamoltab 4 mg , salbutamol 100 mcg + beclomethasone 50 mcg / puff ( 200 mdi ) , salbutamol 1mg, theophylline50mg, bromhexine 4mg, per 5ml ( 100ml syrup ) , salbutamol 2 mg , salbutamol rotacap , salbutamol sulphate , salbutamol2mg+guaiphenesin100mg+bromhexinehcl4mg / ml syrup. ( 50ml ) , salbutamole 1mg + ambroxal 30mg + guaiphenesin 50mg + menthol 0.5mg / 5ml syrup ( 50ml ) , sargramostininj 500 mcg / ml vial , savlon 500 ml , scolin 10 ml / vial , semen diluting fluid , seratiopeptidase, + diclofenac pottasium 10+50mg tab. , serrapeptase 5 mg , serratopeptidase 10 mg , sertraline 25 mg , serum albumin kit , serum calcium kit , serum creatinine ( mfg pathogyme diagnostics ) ( 100 ml ( 2 x 50 ml ) ) , consumable [ 700735 ] , serum electrolyte monovials of sodium potassium chloride , serum urea , sgot ( mfg pathogyme diagnostics ) ( 25 ml ) , consumable [ 700736 ] , sgpt kit , sildenafil 50 mg tab , silver sulphadiazinecream usp 1% , silver sulphadiazine crèam 1% 250 gm , silver sulphadiazine crèam 1% 500 gm , sitagliptin 50 mg , sodium bicarbonate inj7.5% w / v , sodium chloride hypotonicinj n / 2 ( 0.45% ) , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) , sodium chloride 1 / 2, normal, hyper tonic & dextrose 5% inj. 500ml , sodium chloride 3.5g. pot. chloride 1.5g. sod. citrate 2.9g. dextrose anhydros 20g ( electrolyte powder ) 50gm , sodium nitro prusside , sodium thiopentone 0.5 gm powder / vial 20 ml vial , sodium valproate200 mg cr tab , sodium valproate500 mg cr tab , sodium valproate 500 mg / 5 ml amp inj , sodium valproate enteric coated tab. 200 mg10x10 tab. , sodium valproate syrup 100mg / 5ml , soluble insulin 30% isophane insulin 70%100 iu 10 ml vial , spironolactone 100 mg , spironolactone 50 mg , spironolactone tab 25 mgtab 10x10 tab. , spray finatlue for , sterile urine container , stool examination kit , streptokinase injection 750000 iu , streptomycin 0.75 g vial , streptomycin inj 1g vial , strip for digital hemoglobin meter 50 no each pkt , sucralfate 1gm / 5ml susp. 100 ml , sucralfate susp / local application cream, 19 / 5ml 200ml bottle , sulfacetamide 20% eye drops10ml , sulfadoxine 500 mg + pyrimethamine 25 mg , sulfamethoxazole +trimethoprim oral liquid ( sulfamethoxazole 200mg + trimethoprim 40 mg ) / 5 ml , sulfamethoxazole +trimethoprim tab sulfamethoxazole 100mg + trimethoprim 20 mg , sulfamethoxazole +trimethoprim tab sulfamethoxazole 800mg + trimethoprim 160mg , surfactant bovine ( intratracheal ) natura 4 ml amp. , tacrolimus 0.03% 10 gm ointment , tacrolimus 0.1% 10 gm ointment , teicoplanin 200 mg vail , teicoplanin 400 mg / vial , telmisartantab 40 mg , telmisartan 80 mg , telmisatran 20 mgtab 10x10 tab , terbinafine hydrochloride 1% 10 gm cream , terbutaline 0.5 mg / ml 1ml amp , terbutaline suplhate 2.5mg tab 10x10 tab. , terlipressin 1 mg / 10 ml 10 mlamp , tetanus toxoid5 lf 5ml vial inj , tetanus toxoidinj 25 units / dose , tetanus toxoid 0.5 ml ampouleinj , tetracyclline 250 mg , tetracyclline 500 mg , thiopentone inj 0.5gm powder / vial , throat swab culture 50 no pkt , thyroid profile kit , thyroxine sodium 25 mcg , thyroxine sodium tab 100mcg 10x10 tab. , thyroxine sodium tab 50 mcg 10x10 tab. , tincture iodine 500 ml , tincturebenzoin compound ip 500 ml bottle , tinidazole 150mg / 5ml , tinidazole susp. 150mg / 5ml , tinidazole tab 300 mg , tinidazole tab 500mg 10x10 tab. , tobramycin 0.3 % eye drops5ml , tobramycin+dexamethasone eye drops 5ml vial , tobramycine60 mg / 1.5ml vial , tobramycine 80 mg / 2ml vial , torasemidetab 10 mg , torasemide 100 mg / 2 ml vail , torasemide 20 mg , total protein kit , tramadol 100 mg / ml 2mlamp , tramadol 100 mg tab , tramadol inj 50 mg / ml , tramadol tab 50mg , tranexamic acidinj 500 mg / 5 ml. , tranexamic acidtab 500mg , tranexicam acid 500mg+ mefenamic acid tab , triamcinolone 4 mg tab 10x10 tab. , triamcinolone acetate 10 mg / ml 1ml vial , triamcinolone acetate 40 mg / ml 1ml vial , tricholine citrate 0.55 gm , sorbitol 7.15 gm / 10 ml200 ml , triglyceride kit enzymet 5x20ml 200test / kit [ 987761 ] , trihexyphenidyltab 2 mg , tropicamide 1% eye drops , troponin i card , typhoidcard , typhoid vaccine ( purified vi capsular polysaccharide of salmonella typhi ) 0.5 mlvial , ultra sonogram gel 250ml bottle , uric acid kit , urine microscopy ( bilesalt, acetone, bile pigment ) , urine strips for blood and acetone , urokinase 5 lac iu / vial , valethamate bromide 8 mg / ml 1mlamp , valparin susp , valproateoral solution 200mg / 5ml , valproatetab 200 mg , vancomycin1 gm / vial , vancomycin250 mg / vial , vancomycin500 mg vial , vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable [ 700754 ] , vecuroniuminj 2 mg / ml , verapamiltab 40 mg , vit b12 500 mcg / ml 30 ml vial , vit. a 1 lac iu , vit. b2 500 mg / ml 30 ml amp. , vitamin a 50000 iu / mlamp , vitamin a usp soft gelatin 1 lakh iu , vitamin a usp soft glelatin capsule each capsule contains vit. a 2 lac iu , vitamin b1 10mg + vit.b6 3mg + vit.b12 15 mcg 2 mlamp , vitamin b12 1500 mcg 1 mlamp , vitamin c 100 mg / ml 5mlamp , vitamin c 500 mg , vitamin d1.vitamin d3 cap. / tab. , vitamin k inj. 10 mg / ml , vitamin k1inj 1 mg / 0.5 ml , vitamin. b complex tab nfi ( prophylactic ) b1 2 mg, b2 2mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1mg , vtm kit 50 pack , warfarintab 5 mg , wbc diluting fluid , white petroleum jelly 100 % 1kg , widal test kit , x ray film 10 x 12 50 sheets / pack ( digital ) , x ray film 10 x 12 50 sheets / pack [ 6811076 ] , x ray film 12 x 12 50 sheets / pack , x ray film 12 x 15 50 sheets / pack [ 6341126 ] , x ray film 8 x 10 50 sheets / pack ( digital ) , x ray film 8 x 10 50 sheets / pack [ 6811075 ] , x ray film devoloper ( powder to make 13.5 liters pkt ) , consumable [ 700539 ] , x ray film fixer ( powder to make 13.5 liters pkt ) , consumable [ 700539 ] , xylometazoline0.05% nasal drops 10ml , xylometazoline 0.1% nasal drop10ml , zidovudineoral liquid 50mg / 5ml ( 50ml ) , zidovudine cap 250 mg 10x10 tab. , zinc sulphate tab dispersible 20mg , zolpidem 10 mg tab...

Directorate Of Medical Education - Madhya Pradesh

29207351 tender for medicine / surgical item / i.v. fluid / surgical suture / kits chemical and surgical stapler , medicine, surgical item, i.v. fluids, surgical suture, kits chemical and surgical stapler , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , acyclovir 250 mg inj , acyclovir 500 mg inj , acyclovir 750 mg inj , adalimumab 20mg inj , adalimumab 40mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml 10 ml vial , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine b ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , anti hemophillic factor viii 500 iu ( vial ) , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 100mg / ml 5ml amp ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml2ml amp , azithromycin 100mg / 5ml inj , azithromycin 500mg / 5ml inj , bendamustine 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bortezomib 3 .5 mg vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp 4 ml amp , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulfan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10% 10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , carboplatin 150 mg inj , carboplatin 450 mg inj , carboprost tromethamin 250 mcg / ml 1ml amp , carmustine 100 mg vial , cefaparazone with salbactum 1.5gm ( cefaparazone 1000 mg with salbactum 500 mg ) vial , cefazolin 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +500 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 2mg / ml 100mg / 50ml vial , cetuximab 2mg / ml 200ml / 100 ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , cladribine 10 mg inj , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection 150mg / ml 4ml amp , clonidine100 mcg / ml 10 ml vial , colistimathate sodium for injection 1 million iuvial , colistimathate sodium for injection 2 million iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dactinomycin 0.5 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone sodium phosphate 4mg / 2mlinj , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) , dexmedetomidine100 mg / ml ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lyophilized ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edaravone60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj , enoxaparin 60mg inj , ephedrine 30mg / ml 1ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4000 iuinj pfs , erythropoietin 10000iu inj 1ml pfs , erythropoietin 2000 iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , etanercept 25mg inj , etanercept 50mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fludarabine 50 mg vial , fluorescein 20% 5 ml amp , flupentixol 20 mg inj , flupentixol 25 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu inj , haloperidol 5 mg / ml 1 ml amp , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium succinate inj ) , hydroxyprogesterone caproate 250mg / ml 2ml inj , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosfamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , infliximab 100mginj , iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose 20 mg / ml 5 ml amp , isobaric levobupivacaine 0.5% inj , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , leucovorin calcium 50 mg / 5 ml vial , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia lignocaine 5% +destrose 7.5% 2 ml amp heavy , lignocaine hydrochloride + adrenaline 2% + 0.005 mg / ml 30 ml vial , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , methacarbamol 100 mg. / 10ml vial , methotrexate 15 mg / ml ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg10 ml vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoclopramide 5mg / ml 2ml amp , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2ml amp , micronized progesterone 100mg / ml2ml amp , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) 100iu / ml , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine sulphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nab paclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , neostigmine 0.5 mg / ml, 1ml amp , nikethamide amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 mlamp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olanzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , rabies immunoglobulin inj 300 iu / 2 ml , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , ropivacaine 10mg / ml 2.5ml vial , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , sargramostim 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , tecoplanin 400mg vial , terbutaline 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 100 mg inj50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml amp , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide12 mg inj , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , zuclopenthixol acuphase 50 mg inj , zuclopenthixol decanoate 200 mg inj , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin200 mg / 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% 500 ml glass bottel with rubber cork , dextrose saline ( dns ) 5% + 0.9% 500 ml ffs bottle , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection type iii ip ) , type iii ip 500 ml ffs bottle , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) type i ip 500 ml ffs bottle , fat emulsion 20% ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion 500 ml ffs bottle , levofloxacin 500 mg / 100 mlffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 mlffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 200mg / 100 ml bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle , total parenteral nutrition 1000 ml with 763 kcal dextrose 15% w / v, amino acids 10% w / v with electrolytes & intravenous fat emultion triglycerides 20% w / v ) ( all in one inthree chamber bag ) , 1000ml , tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ) 15% dextrose 10% amino acids 2000 ml , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumarol2 mg tab , acetazolamide 250 mg tab , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipine 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atomoxetine 10 mg tab , atomoxetine 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen extanded release40 mg , baclofenextanded release 30 mg , baclofen extanded release 20 mg , benfothiamin 150mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonanserin 2 mg , blonanserin 4 mg , buprinorphine 4mg , buprinorphine 8 mg , bupropion150 mg , bupropion300 , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate 500 mg tab , calcium d3 / 500mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 200 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine 5 mg tab. , ciprofloxacin500 mg , clarithromycin 250 mg , clindamycin 300mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , clomipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine 100 mcg tab , clopidogrel75 mg , clopidogrel 150mg+ aspirin 75 mg , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , coenzyme q , crizotinib 250mg , cyclophosphamide 50 mg tab , dasatinib 50 mg , deferasirox dispersible 250 mg tab , deferasirox dispersible 500 mg tab , deflazacort 30 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratiopeptidase 10mg tab , diclofenac 50mg + paracetamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , doxophylline400 mg , duloxetine 20 mg tab , duloxetine 30 mg tab , dydrogesterone 10mg , empagliflozin 25mg tablet , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , farmalin 1gm tab ( 100 tab per box ) , febuxostat 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg tab , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glucagon 0.1mg tablet , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg equivalent to 100mg of elemental iron +folic acid ip 0.5mg tab ferrous sulphate of elemental iron +folic acid ip 0.5tab ferrous sulphate dessicated ip mg equivalent to 20mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , l carnosine , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+25mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , lurasidone 20 , lurasidone 40 , magnesium oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , melatonin 3mg , melatonin 6mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformin sr 1gm tablet , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methyldopa 250 mg tab , methylphenidate 10 mg , methylphenidate 20 mg , methylphenidate 5 mg , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tab. mtp kit , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil200 , modafinil 100 , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) , mycophenolate mofetil, 500 mg , n acetyl cysteine 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nicoumalone 2mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxanide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , perampanel 4mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , pioglitazone 15 mg tab , pioglitazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , pramipexol 0.26 sr , pramipexol 0.50mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil 50mg , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubitril plus valsartan 50mg , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valproate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tadalafil 20 , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin+dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine 88mcg tablet , thyroxine sodium12.5 mcg , thyroxine sodium 137 mcg , thyroxine sodium150 mcg , thyroxine sodium 62.5 mcg , thyroxine sodium 100 mcg , thyroxine sodium 25 mcg , thyroxine sodium 50 mcg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenydyl hydrochloride 2mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , venlafaxine 37 , venlafaxine 75 , verapamil40 mg , vilazodon 20 , vilazodon 40 , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, niacinamide 25mg, calciuym pantothenate 1mg ( with appropriate overges ) , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.2mg tablet , voglibose 0.3 mg tab , voriconazole 200 mg , vortioxetine 20mg , vortioxetine10mg , vortioxetine5 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 375 mg cap. , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , deferiprone 500 mg cap. , doxycycline 100 mg , fluoxetine 40 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 mcg thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) cap. , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , palbociclib 100 mg cap , palbociclib 125 mg cap , palbociclib 75 mg cap , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , sildenafil 20mg , temozolamide 100 mg , temozolamide 250 mg , vitamine400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% 10 ml , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml , pilocarpine eye drops 2% , polyvinyl alcohol 1.4% 5 ml , prednisoloneeye / drop. , proparacaine , sodium chloride opthalmic solution 5% eye drop , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ turpentine oil 15% w / v ear drop , beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5%5 ml ear drop , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle , prostaglandin e2 0.5 mg 3 gm pre filled syringe , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethasone valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , fluconazole ointment 20 gm tube , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm , papain urea and silk protein based debriding ointment and cream 100 gm , papain urea and silk protein based debriding ointment and cream 50 gm , papain urea and silk protein based debriding ointment and cream 25 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 25gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 50 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 100 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 250gm , silver nitrate hydrogel wound dressing 25gm , centella asiatica extract based skin moisturization and antiscar gel 30gm , mct oil 100ml bottle , mct oil 100ml bottle , paracetamol suppository , lactobacillus, 150 million spores, , l arginine sachet 10gm , hmf1 gm sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 100 gm , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 50 gm , silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial , silk protein and antimicrobial nano silver based surgical particle wound dressing 10ml vial , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 propano+25%1.propanol+2.5% chx+0.5 triclosan.500 ml , antiseptic hospital concentrate contdaining 20% chlorohexidine soln ip 7.5% v / v cetrimide ip 15%w / v iso peopyl alchohol 6 8% 1000ml. , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml , feracrylum solution 1% 100 ml , formaldehyde solution37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enema , hand wash solution ( sol.isoprapanol, propanol , mecetronium, skin care additives ) 500 ml bottle , hydrogen peroxide solution 20% 500 ml bottle , sodium hypochloride solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant each 100 gm contains: 1.6 dihydroxy, 2 5 dioxahexane 11.2 g. glutaraldehyde 5.0 g. benzalkonium chloride ip 5.0 g.5 ltr , topical heparin solution 5ml vial , aluminium hydro gel syp 100ml bottle , albendazole suspension 200 mg / 5ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, 100ml bottle , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml bottle syp , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, zinc, magnesium syp 100ml bottle , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 mlbottle , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium citrate 57.03mg / 5 ml , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondansetrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml 100 ml bottle , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , saline nasal spray 20 ml , methylcobalamin nasal spray 250 mcg , saline nasal gel 15 gm tube , saline nasal wash 3gm kit , h2o2 mouth gargle 3% , povidone iodine mouth gargle 2% w / v 100 ml , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , kmno4 mouth wash , mouth paint clotrimazole 1%15 ml , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorable cotton roll, net 500gm , absorbable gelatine spongip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , adult diaper size l & xl , ag ion impregnated central venous double lumen polyurethane catheter, 7.5 fr, g 16x18 length 16cm , ag ion impregnated central venous triple lumen polyurethane catheter, 7.5 fr, g 14x18x18 length 16cm , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, l 15cm, with polyurethan extention tube, flow rate per lumen – 320ml / min , air bed mattress with complete set , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , anesthesia kit spinal & epidural with balloon indicator lor syringe type 16g / 25g ( 80mm*113mm / 90mm*123mm ) , 18g / 27g ( 80mm*113mm / 90mm*123mm ) , antimicrobial , liquid parafin based silver sulphate / chlorhexidineantiseptic tulle10cmx12cm , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 18x18, l 15 / 16cm. peadiatric , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 18x18, l 15 / 16cm. , antimicrobial incise drape 3 meter , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 16*18x18, l 15 / 16cm. peadiatric , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 16*18x18, l 15 / 16cm. , armored cuffed tube made of 100% silicon, radio opaque, should have prefilled stylet mounted connector, piot balloon with universal port. size. fr 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5 6, 6.5, 7, 7.5, 8, 8.5, 9 should be fda / ce approved , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzer ) with side tubing ( for heparinization and av pressure monitorig ) blood tubing set dialysis , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered , biopsy gun 16 20 gauze , bipap mask size large , bipap mask size medium , bipap mask size small , bipolar cable , bipolar forceps cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set double moldedchamber without airway , blood transfusion set single molded chamber without airway , bone marrow aspiration needles ( 14 ) , bone marrow aspiration needles ( 15 ) , bone marrow aspiration needles ( 16 ) , bone marrow aspiration needles13 g , bone marrow biopsy needle , bone wax , bp cuff adult & pediatric , camera cover disposable , cannula fixer set , carbolic acid 500 ml , c arm cover disposable , catheter mount adult size , catheter mount pediatric size , catheter single lumen4.7 no , catheter single lumen6.6 no , catheter single lumen7.7 no , catheter double lumen7.7 no , cautery pencil disposable , cautery platedisposable , central line double lumen 16 fr , central line single lumen , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , colostomy kit , condom catheter , cord clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crepe bandage 2 , crepe bandage 4 , crepe bandage 6 , cresol with soap solution5ltr jar , cvc line double lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7fr, g 16x16 length 15cm , cvc line triple lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7.5 fr, g 14x18x18, length 15cm, 20cm ( anti microbial coated ) , cvl dressing10 cm*12 cm pad for central line , cvl dressing7 cm* 8.5 cm for central line , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation , disposable eye shield u / v light protector for infants & neonates. sterile single pack. , disposable face mask triple layer ( standard ) , disposable hivfull protection kit , disposable n95 mask , disposable needle 18g ( single use ) , disposable needle 18g 1 1 / 2 ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx 1 1 / 2 , disposable needle no 26gx1 / 2 , disposable paper gloves , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , disposable surgeon cap , distilled water 5 lit. , double lumen peripherally inserted central venous silicon catheter ( 3fr, 4fr, 4.5fr, 5fr ) length 60cm , double lumen peripherally inserted central venous silicon catheter ( 7fr, 9fr, 11fr, 14fr ) length 90cm, with subcutaneous cuff for long term venous access , drap sheeth 120cm x 210cm sterile , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. , ear cotton swab , ecg disposable electrode , ecg paper 80mmx20 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed4 , endotracheal tube cuffed5 , 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize 9.5 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size 9 , endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 , endotracheal tubes plain without cuff size 2, 2.5, 3, 3.5, 4, 4.5 , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination gloves sizesmall ( 100 pcs / pkt ) , examination gloves size large ( 100 pcs / pkt ) , examination gloves size medium ( 100 pcs / pkt ) , exchange transfusion catheter with four way adaptor size 4cm, l 40 cm , extention line 100cm , extention line 10cm , extention line 150cm , extention line 200 cm , extention line 50cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10, 12, 14 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluorescein strips pkt , fogharty catheter 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley catheter size 20 two way , foley urinary catheter size 8 10 pediatrics , gasket for humidifier bottel , gasket forvaccume jar 1000 ml , gasket forvaccume jar 600 ml , gigli saw wire , glass slide iso mark no 12mm , glass tube 125x150 , glucometer strips pkt ( 50 strip / pkt ) , guedel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hme filter , humbysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain management , incubating laryngeal mask airway 4, 5 , insulin syringe , intraocular lens 14 30d dioptre , intravenous drip set adult size , intravenous drip set pediatric size , introducer sheath 6fr , iv .regulator set ( control drop set ) , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , iv cannula size 16 g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , j tip 0.035 mm guidewire , jugularcatheter 12 fr ( adult ) , jugular catheter 8fr ( pediatric ) , k 90 catheter , kellys pad disposable , laryngeal mask airway classic 1, 1.5, 2, 2.5, 3, 4, 5 , liga clip 200mm, 300mm, 400mm , lma reusable pro seal second generation with gastric drain tube and reinforcement airway tube. size 1, 1.5, 2, 2.5, 3, 4, 5. , long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm , low adherent absorbent wound dressing with a polyester perforated wound contact layer size 50cm 7mtr roll , lung excersizer , mackintosh double colour water proof roll ( 20 meter per roll ) , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , medical dry imaging film 10x12 , medical dry imaging film 14x17 , medical dry imaging film 8x10 , mesure volume set soft chamber, with bulb latex 110ml , methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 , micro drip set with bulb latex , microlaryngeal surgery tube no 5 , monopolar cautry wire disposable , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , multifunctional mask with the attachment of nebulizer mask, venture mask, oxygen mask, aerosol mask, with 7 oxygen and paediatric. , naso pharyngeal airway adult all size , naso pharyngeal airway paediatric all size , nebulization mask ( set ) adult & pediatric , neonatal urine collection and measurement bag 100 ml , nitrile gloves size small / medium / large , non rebreathing mask ( oxygen mask with reservoir bag , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural latex micro rough finish for better grip , non sterile surgical rubber gloves 7 no. ( pair ) made of natural latex micro rough finish for better grip , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural latex micro rough finish for better grip , oxygen adaptor 5 type , oxygen catheter , oxygen connection with flow meter for central line , oxygen connection with flow meter for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) , oxygen regulator for control penal board ( oxygen pipe line ) , oxygen tailpipe ( flexible metalic ) , p t tubes 3.8% sodium citrate ( prothrombin tube ) , pacing leads 6 fr , paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g – 20x20 length – 6cm, 12.5cm , paediatric epidural set ( with 19g needle with matel stylet 22gcatheter 0.22 micron epidural catheter andsyringes , paediatric triple lumen polyurethan cvc line with nitinol j guide wire, 4.5 fr, g 20*23*23, l 6cm, 8cm, 10cm, 12.5cm , paper adhesive plaster microporous surgical tape 2inch x 10mt roll , paper adhesive plaster microporous surgical tape 3inch x 10mt roll , paper adhesive plaster microporous surgical tape 4inch x 10mt roll , paper adhesive plaster microporous surgical tape 6inch x 10mt roll , pec haemostatic patch for post renal dialysis size 5cm x 7cm , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm pediatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter 6 fr ( 150 cm ) , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron disposable , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , proseal lma ( plma ) 1, 1.5, 2, 2.5, 3, 4, 5 , radial a catheter , rectified sprit 4.5 ltr. , reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. , ryles tube size 10, 12, 14, 16, 18 , self adhering silicon external catheter should be built in band, clear odorless single sterilized pack, 100% latex free. size 25 / 29 / 32 / 36 / 41mm. , semi automatic core biopsy instrument set with 2 throw length of 10 mm and 20 mm in a single device along with a throw length indicator window and a fire ready indicator mark compatible adjustable coaxial and a blunt tip stylet. should be usfda approved 18g*10cm, 18g*16cm & 18g*20cm, 20g*10cm, 20g*16cm , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , should have dual hook for zero migration post deployment should have the option of repositioning after deployment should have dustable twisted wire construction for durability. 20g*107mm , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 10 cmx 10 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 20cmx20cm , silk protein based sterile surgicalwound dressing sheet20 cmx 40 cm , silk protein based sterile surgical pu foam dressing 20cmx20cm , silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilizedsizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , spring loaded automatic biopsy gun one handed cocking machanism with non roll handle design. angle sample notch for enhance needle action choice of two firing buttons.should be usfda approved 16g* 10cm, 16g* 16 cm, 18g* 10cm, 18g* 16cm, 18g* 20cm, 18g* 25cm , sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile disposable syringe with needle 03 ml , sterile disposable syringe with needle 2ml , sterile disposable syringe with needle 5ml , sterile gauze swab / pad , sterile gloves isi 6.5 made of natural latex, micro rough finish for better grip , sterile gloves isi size7.5 made of natural latex, micro rough finish for better grip , sterile gloves isi size8 made of natural latex, micro rough finish for better grip , sterile gloves isi size 7 made of natural latex, micro rough finish for better grip , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 50ml , sterile leur lock syringe 20ml , sterile leur lock syringe 50ml , sterile luer lock syringe 10 ml , sterile luer lock syringe 5 ml , sterile powder free glovessize6.5 made of natural latex, micro rough finish for better grip , sterile powder free glovessize7 made of natural latex, micro rough finish for better grip , sterile powder free glovessize7.5 made of natural latex, micro rough finish for better grip , sterile powder free glovessize8 made of natural latex, micro rough finish for better grip , supreme lma ( slma ) , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tear test strip ( 100 strips in box ) , thermometer digital , thomas splint , three way stop cock , tmt graph paper , tounge depresser wooden , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , transducer set for invasive b.p. , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula padiatric , urine collecting bag 2 ltr. , urine collecting bag with urometer 1 ltr. , urine sugar diagnostic stip , vaccum adaptor 5 type , vaccum jar 1000 ml with regulator , vaccum jar 2000 ml with regulator , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter mount+bacteria filter ) , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt blue sensitive , x ray films size 12x15 50film per pkt blue sensitive , x ray films size 8x10 50film per pkt blue sensitive , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankauer suction catheter ( complet set ) , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 030cm , green37mm1 / 2 circletaper point , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 2 0 30cm , green37mm1 / 2 circletaper point , 20g round body cutting needle 1 / 2 circle , absorbable adhesion barrier in the form of off white knitted fabric prepared by oxidized regenerated cellulose indicated for both open and laparoscopic procedures size , absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved , absorbable unidirectional barbed devicepolydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed devicesymmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm , black braided silk eyeless needled suture usp, size 8 0 suture length76cm, needlelength & description 3 / 8 circle round bodied 30mm , black braided silk eyeless needled suture usp, code 5036 size 2 0 suture length in cm 76cm, needle length & description 3 / 8 circlereverse cutting 45mm , black braided silk eyeless needled suture usp, code 5082 size 4 0 suture length76cm, needlelength & description 3 / 8 circle round bodied 16mm , black braided silk eyeless needled suture usp, code 5333 size 2 0 suture length 76cm, needle length & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 5 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 16mm , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 25mm , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 suture length76cm, needle length & description 1 / 2 circle round bodied 20mm , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in , braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) , braided synthetic absorbable eyeless needled suture uspbraided ab. suture 6 0 rc 1 / 4 circle 45cm needle 8 mm , braided synthetic absorbable polyglactin 910 eyeless needled suture size6 0 round body needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2341, size 2 0 suture length in 70cm 1 / 2 circle round bodied 30mm , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2346, size 1 0 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2347, size 1 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2421, size 1 suture length in 90cm 1 / 2 circle rc 40mm os needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2534, size 1 0 suture 90cms, 1 / 2 circle rc 36mm, os6 needle , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 20mm length 75cm size 3 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 30mm length 100cm size 2 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 36mm length 90cm size 3 / 0 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 / 0 , complete absorbable mesh fixation device with minimum strap length 7.0 mm2 point fixation to hold the mesh and device with 25 tacks only. , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. , knotless wound closure device with unidirectional 2 0 45cm , undyed24mm3 / 8 circlereverse cutting , knotless wound closure device with unidirectional 3 0 58cm, undyed24mm3 / 8 circlereverse cutting , macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene.15cmx15cm , monofilament glycomer0, 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer1 , 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer2 0 , 75cm, violet27mm1 / 2 circletaper point , monofilament glycomer3 0 75cm, undyed24mm3 / 8 circlereverse cutting , monofilament glycomer3 0 75cm, violet22mm1 / 2 circletaper point , non absorbable pre shaped polypropylene mesh large size , non absorbable pre shaped polypropylene mesh medium size , non absorbable pre shaped polypropylene mesh small size , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in x 2 in ( 2.5cm x 5.1cm ) , oxidized regenerated cellulose based topical absorbable hemostar thicker weave 4x8 , oxidized regenerated cellulose based topical absorbable hemostat, fibrillar / layer form, with bactericidal property. fibril material ( 7layers ) for broad surface area coverage. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 4x4 inch , oxldlzed regenerated cellulose; rayon fiberas per us phrmcopela standards enforceable by us fda with bactericidal property 2x3 , oxldlzed regenerated cellulose; rayon fiber as per us phrmcopela standards enforceable by us fda with bactericidal property 3x4 , patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or andus fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. , pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system , poliglecaprone 25 undyed 3 0, 3 / 8 circle reverse cutting26mm 70cm. , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , polydioxanone122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. , polydioxanone150cm usp1 0 rb ctx, 1 / 2 circle, 48mm , polyester suture no. 2 x 100 45mm hc tc , polyester suture no. 5 x 75 55mm hc tc , polyglactin 910 1 x 100 45mm hc rb , polyglactin 910 fast und 0 x 110 40mm hc rb , polyglactin 910 fast und 2 0 x 100 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 100 55mm hc rb , polyglactin 910 with triclosan no. 1 x 90 36mm hc tc , polyglactin 910 with triclosan no. 1 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 x 90 40mm hc rb , polyglactin 910 with triclosan no. 2 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 0 x 90 30mm hc rb , polyglactin 910 with triclosan no. 2 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 20mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 36mm hc tc , polyglactin 910 with triclosan no. 4 0 x 70 20mm hc rb , polyglactin 910 with triclosan no. 5 0 x 45 16mm hc rb , polyglactin 910 with triclosan no.1 0x 90 36mm hc rc , polyglactin 910 with triclosan no.1 0x 90 40mm hc rb , polyglactin 910 with triclosan no.1 0x 90 40mm hc tc , polyglycolic acid no. 1 x 180 50 / 40mm cu rb hc tc dn , polypropylene 6 0x60 10mm hcrb dntp3 , polypropylene 7 0x60 09mm hcrb dntp3 , polyster braided1 / 2 circle tapercut double needle with 17 mm needle and suture lenght 90cm , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved , scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved , self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved , sterlizedabsorbable eyeless needled suture usp, code 2341, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlizedabsorbable eyeless needled suture usp, code 2345, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm , sterlizedabsorbableeyeless needled suture usp, code 2304, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbableeyeless needled suture usp, code 2317, size 2 0 suture length in cm 90cm needle length & description 1 / 2 circle round 30mm , sterlizedabsorbableeyeless needled suture usp, code 2437, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2303, size 5 0 suture length in cm 45cm needle length & description 1 / 2 circle round bodied 16mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2442, size 5 0 suture length in cm 45cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3317, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polyamide eyeless needled suture usp, code 3318, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circlecutting cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3328, size 3 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 26mm , sterlized monofilament polyamide eyeless needled suture usp, code 3336, size 2 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 45mm , sterlized monofilament polyamide eyeless needled suture usp, code 3347, size 1 suture length in cm 100cm needle length & description 1 / 2 circleround bodied 40mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 7003, size 10 0 suture length in cm 30cm needle length & description 3 / 8 circledouble arm 6mm heavy , sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 829, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 13mm double armed. , sterlized monofilament polypropyleneeyeless needled suture usp, code 841, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 842, size 1 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropylene eyeless needled suture usp, code 823, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle slim blade cutting 15mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 843, size 1 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm heavy , sterlized monofilament polypropylene eyeless needled suture usp, code 849, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 870, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 881, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 882, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm.double 16mm armed , sterlized surgical chromic gutsutue eyeless needied usp, code 4201, size3 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle cutting 22mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4216, size2 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4217, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4221, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 40mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4227, size 1, suture length in cm 100cm needle length & descriptio 1 / 2 circle round bodied 45mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4237, size3 / 0, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4259, size1, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 40mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. , surgical silk bradedsterile foilover wrappack code 213 size 2 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 214 size 1 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 215 size 1 suture length in 2 x 75cm , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. , synthetic absorbable surgical suturetriclosancoated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved , synthetic absorbable surgical suture , polyglactin 910 with triclosancoated undyed 2 0, 1 / 2 circle round body taper point ct 1 36 mm , 90 cm undyed , synthetic absorbable surgical suture , polyglactin 910 with triclosancoated, undyed 3 0, 3 / 8 circle cutting ps1 prime, multi pass ethalloy, 24 mm, 70 cm undyed , synthetic absorbable surgical suture triclosancoated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm , synthetic absorbable surgical suture triclosancoated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved , synthetic absorbable surgical suture, polyglactin 910 with triclosancoated undyed1, 1 / 2 circle round body taper point ct 1 36mm, 90cm undyed. , transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system , triclosan antibacterial coated polyglactin with 23 mm needle suture length 70cm, reverse cutting portt heavy needle size 1 no. , v shape clip applicators large , v shape clip applicators medium , v shape clip applicators medium large , v shape clip applicators small , v shape ligation clip large , v shape ligation clip medium , v shape ligation clip medium large , v shape ligation clip small , ada kit , aluminium ammonium sulphate powder 500gm , ana test kit , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera 10 ml , anti b sera 10 ml , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , dengue card test , dpx mount 250ml , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , haematoxylene 5gm , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , malaria parasite elisa test kit , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , malaria parasite antigen test kit rapid , n / 10 hcl 500ml , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test kit , rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , sugar albumin urin stics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for adult ( bac t / alert pf plus , blood culture media anaerobic for pediatric ( bac t / alert pf plus ) , ki67 / mib 1 06 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close system ) , absorbable 2 0 endo suture cartridge 48 length , advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , advance rf energy hand instrument of 5 mm shaft diameter for laproscopicprocedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , disposable circular stapler 25 / 26mm diameter , disposable circular stapler 28 / 29mm diameter , disposable trocar 05mm , disposable trocar 10mm , disposable trocar 12mm , disposable trocar 15mm , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable clipapplier medium 10mm with 20 clips , disposable clip applier medium 5mm with 16 clips , disposable curved cutter stapler , disposable curved cutter stapler , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposable hemorrhoidal stapler with detachable anvil. , disposable linear stapler with fixed staple height 75mm 90mm size , disposable linear stapler with fixed staple height 55mm 60mm size , disposble skin stapler with pins , distal tip closure titanium ligation clip large size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip small size , endoscopic cutter & stapler60mmregular length , endoscopic cutter & stapler60mmlonglength , endosuturing device 10mm with toggle lever , handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh , handpiece ( transducer ) compatible with ultrasonic vessel sealing dissectorinstalled in myh , locking clip cartridge medium / large , mesh fixation device with 15 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with 30 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , multifire clip applier long size 15 clip , multifire clip applier small size 20 clip , non absorbable 2 0 endo suture cartridge 48 length , open clip applicator 100 20cm length , open clip applicator 200 20cm length , open clip applicator 300 , open clip applicator 400 , partially absorbable mesh with absorable & semi absorbable sides 15cm x 15cm , partially absorbable mesh with absorable & semi absorbable sides 10cm x 15cm , plastic locking clip applicator medium / large , polycearbonte bladeless trocarwith reducer seal 10mm , polycearbonte bladeless trocarwith reducer seal 12mm , polycearbonte bladeless trocar with reducer seal 5mm , polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm , polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm , reload 55 60mm for medium thick tissue blue compatible with linear cutter. , reload 55 60mm for thin / vascular tissue white compatible with linear cutter. , reload 75 80mm for medium thick tissue blue compatible with linear cutter. , reload 75 80mm for thick tissue green compatible with linear cutter. , reload compatible with curved cutter , reload endoscopic cutter & stapler45mm purple , reload endoscopic cutter & stapler60mm purple , reload endoscopic cutter & staplter45mm blue , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm white , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload forlinear cutter 90mm 100 mm size green , reload for linear cutter 55mm 60mm size blue , reload for linear cutter 90mm 100 mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size green , reload for linear stapler with fixed staple height 55mm 60mm size blue , reload for linear stapler with fixed staple height 55mm 60mm size green , reusable laparoscopic clip applicator for large titanium clips with15cm 20cm length , reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly , reusable laparoscopic clip applicator for large titanium clips. , reusable laparoscopic clip applicator for medium large titanium clips with28cm 30 cm length , reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , skin staple remover with plastic handle , suture locking autolock , titanium clip 100 , titanium clip 200 , titanium clip 300 , titanium clip 400 , universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. , universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m....

Government College - Madhya Pradesh

29076210 4809 / kits supply of medical kits , laying and jointing pvc pipe. heading , hbsagcard 50 , hiv card 50 , urine for albumin / sugar 100 , urine for pregnancy stip and card 50 , malaria antigen pf / pv 50 , urine strip for 10 para ( laura ) 100 , urine strip for 5 para 100 , syphlis card for vdrl 50 , rapidaso ( latex slide test ) 20 , rapid crp ( latex slide test ) 20 , rapid ra ( latex slide test ) 20 , rapid widal ( o, h, ah, bh ) slide test 4*5ml , widal ( o, h, ah, bh ) test tube method 4x50ml , blood group kit ( antisera ) 3*10ml , glucose ( god pod ) 4x50ml , cholesterol ( chod pod mathod ) 4x25ml , direct hdl cholesterol 2 x 24 / 2 x 8 ml , triglycerides ( gpo pap 4x25ml , bilirubin ( t&d ) ( modified jendrassik method ) 4x50ml , sgot ( ast ) kinetic 5*10ml , sgpt ( alt ) kinetic 5*10ml , alkaline phosphatase ( pnpp ) kinetic 3*10ml , uric acid ( uricase ) 5x5ml , urea ( ned kinetic ) 4 x 20 / 4 x 5ml , creatinine fk ( kinetic ) 2 x 25 / 2 x 25ml , ra ( quantitative immune turbid metric 50ml , aso ( quantitative ) 50ml , calcium ( ocpc ) 1x50ml , crp ( rapid quantitativetest finecare ) 25 test , crp ( quantitative ) 2 x 20 / 2 x 5ml , hba1c ( rapid quantitativetest finecare ) 25 test , electrolyte ( na, k, cl ) medica , electrolyte internal filling solution medica regent pack , electrolyte daily cleaningsolution medica regent pack , electrolyte easily level control medica regent pack , sodium hypochlorite 5 lt , diluent ( 20 liter ) mindraym 30 d , rinse cleaner ( 20 liter ) mindray m 30 r , lyse ( 500ml ) mindray m 30 cfl , probe cleaner ( 17ml ) mindray , quality control ( 17ml ) mindray , vitamin d ( rapid quantitativetest finecare ) 25 test , psa ( rapid quantitativetest finecare ) 25 test , ca 125 ( elisa ) 96 test , vitamin b12 ( elisa ) 96 test , lh ( elisa ) 96 test , fsh ( elisa ) 96 test , prl ( elisa ) 96 test , hbsag ( elisa ) 96 test , ferritin ( elisa ) 96 test , t3 ( rapid quantitativetest finecare ) 25 test , t4 ( rapid quantitativetest finecare ) 25 test , tsh ( rapid quantitativetest finecare ) 25 test , il 6 ( rapid quantitativetest finecare ) 25 test , d dimer ( rapid quantitativetest finecare ) 25 test , t3 ( elisa ) 96 test , t4 ( elisa ) 96 test , tsh ( elisa ) 96 test 96 test , isotonac ( nihon koden ) 18 lt , cleanac ( nihon koden ) 5 ltr , cleanac 3 ( nihon koden ) 2 ltr , hemolynac 3n 500ml , bariumchloride 10% w / v 500ml , benadictsreagent 5lt , fouchet’s reagent 250ml , drabkins solution with standard ( for hb ) 5000ml , glacial acetic acid 500ml , edta 5% w / v 500ml , sulfuric acid con. 500ml , field stain a 500ml , field stain b 500ml , hydrochloric acid n / 10 500ml , immersion oil ( microscopy grade ) dropping bottle 30ml , wbc diluting fluid 500ml , rbc diluting fluid 500ml , reticulocyte counting fluid ( biolab ) 25 ml , semen diluting fluid 100ml , formalin 5 lt , formalin 30lt , fructose 100ml , acetone 250 test , leishman stain with buffer 250ml , sulphur powder 500g , liquor ammonia solution 500gm , sodium nitroproside 100gm , carbol fuchsin ( zn strong ) 500ml , meth line blue 500ml , xyline 2.5ltr , needle 23, 24 1x100nos , sprit 4.5 ltr ( methy ) , distilled water 5ltr , paps smear staining , slide stand alu , esr niddle , micropipete stand , hemocytometr , glucometre and strip , glucometer strips 1x50nos , micropipette fix volume , micropipette variable volume 0.5 5ul , micropipette variable volume 5 50ul , micropipette variable volume 10 100ul , micropipette variable volume 20 200ul , micropipette variable volume 100 1000ul , incubator ( inner chamber ss digital with fan ) 14x14x14 , water wath ( digital ) 10x12x7 , hemoglobin meter , urinometer , slide box , pipette glass 2.0ml , pipette glass 5.0ml , pipette glass 0.2ml , pipette glass 0.1ml , pipette glass 10*75mm , pipette glass 10*75mm , test tube without rim glass 12*100mm , test tube without rim plastic 1x100nos , test tube without rim 1x100nos , test tube without rim 1x100nos , reagent bottle , reagent bottle 12 inch , plastic droper , glass rod , rbc pipette 100 , wbc pipette 10gm , capillary tube 1x100nos , cover slip 18, or 22mm 1x20 nos pack , wintrobe tube for esr , test tube cleaning brush , pipette bulb , test tube holder , tourniquet , citrate vail , edta k3 vail , fluoridevail , plain vail ( activator ) , ria vail 100 , chattels forceps straight ss , urine container sterile 30 ml 1 pack , micropipete tips 10 100 u and 100 1000 u, 1 pack , tissue paper , filterpaper 100 pack , insulin syringe , polythene gloves 100 , surgical gloves 6; no 7 n0 , non dispo gloves 100 , postmortem gloves , syringe 50ml , syringe , 20 ml , syringe 10 ml , syringe , 5ml , syringe 2ml , ecg gelly 250ml , usg gelly 250ml , cotton roll 500 g , usg roll upp 1105 in ( 110mmx20m ) thirmal print media ) , dental x ray film ( 1.0.p.a.25x33mm ) , gloves powder 500gm , povidione solution 500 ml , povidione ointment 15gm , savlon 1ltr , dettol 1ltr., , dettol500ml, , dettol 100ml , hydrogen peroxide 450 ml 30ml , lignocaine gelly 2% , lignocaine inj with adrenol 2% 30ml , lignocaine spray 10 % , lignocaine inj 2% , lignocaine inj 4% , lignocaine tropical vail 4% , tinbenzone 100ml , pure hand , bandage ( antiseptic ) , micropore 2inch , micropore 4inch , n. saline, dns, d5, d10 , scalpvan set , berbar thred 20 no. , enima pot , enima pipe with nozal , hot water beg , rubber catheter red , bandage than , roll bandage 0.5x 0.5, 7 , roll bandage 5x 5 , roll bandage 10x5 , ecg roll ( 12 channel gotiz ) , mechontosh , head cap disposable 100 , sanityzer 5lt , x ray film digital fuzi 14x17 , x ray film digital duzi 8 x 10 , nylon silk suture4.0 , 31inch*72inch color white non woven fabric for single use bedsheet , weighing machine adult , weighing machine child , weighing machine digital , stethoscope adult , stethoscope child , bp instrument led mercury , goniometer , formalin , pulse oximeter , non contact thermometer , face mask disposable 3 layar , n 95 face mask...

Department Of Defence Research And Development - Madhya Pradesh

29040005 chemicals chemicals ( list of items as per appendix a ) , chemicals , sodium dihydrogen phosphate 500gm , potassium chloride 500gm , trichloroacetic acid 100gm , 1 butanol 500ml , ammonium chloride 500gm , hydrogen peroxide. 500ml , glacial acetic acid 100% 500ml , methanol 500ml , sodium carbonate 500gm , sodium chloride 80gm , disodium hydrogen phosphate 500gm...

Government College - Madhya Pradesh

28855705 e tender inquiry for rate contract for supply of lab chemicals and kits hbsagcard 50 , hiv card 50 , urine for albumin/sugar 100 , urine for pregnancy stip and card 50 , malaria antigen pf/pv 50 , urine strip for 10 para (laura) 100 , urine strip for 5 para 100 , syphlis card for vdrl 50 , rapidaso (latex slide test) 20 , rapid crp(latex slide test) 20 , rapid ra (latex slide test) 20 , rapid widal (o, h, ah, bh) slide test 4*5ml , widal (o, h, ah, bh) test tube method 4x50ml , blood group kit (antisera) 3*10ml , glucose (god pod) 4x50ml , cholesterol (chod pod mathod ) 4x25ml , direct hdl cholesterol 2 x 24 / 2 x 8 ml , triglycerides (gpo pap 4x25ml , bilirubin (t&d)(modified jendrassik method) 4x50ml , sgot (ast) kinetic 5*10ml , sgpt (alt) kinetic 5*10ml , alkaline phosphatase(pnpp) kinetic 3*10ml , uric acid (uricase ) 5x5ml , urea (ned kinetic ) 4 x 20 / 4 x 5ml , creatinine fk (kinetic) 2 x 25 / 2 x 25ml , ra (quantitative immune turbid metric 50ml , aso (quantitative) 50ml , calcium (ocpc) 1x50ml , crp (rapid quantitativetest finecare) 25 test , crp (quantitative) 2 x 20 /2 x 5ml , hba1c(rapid quantitativetest finecare) 25 test , electrolyte (na, k, cl) medica , electrolyte internal filling solution medica regent pack , electrolyte daily cleaningsolution medica regent pack , electrolyte easily level control medica regent pack , sodium hypochlorite 5 lt , diluent (20 liter) mindraym 30 d , rinse cleaner (20 liter) mindray m 30 r , lyse (500ml) mindray m 30 cfl , probe cleaner (17ml) mindray , quality control (17ml) mindray , vitamin d(rapid quantitativetest finecare) 25 test , psa(rapid quantitativetest finecare) 25 test , ca 125 (elisa) 96 test , vitamin b12 (elisa) 96 test , lh (elisa) 96 test , fsh(elisa)96 test , prl(elisa) 96 test , hbsag (elisa) 96 test , ferritin(elisa) 96 test , t3(rapid quantitativetest finecare) 25 test , t4 (rapid quantitativetest finecare) 25 test , tsh(rapid quantitativetest finecare) 25 test , il 6(rapid quantitativetest finecare) 25 test , d dimer(rapid quantitativetest finecare) 25 test , t3 (elisa) 96 test , t4 (elisa) 96 test , tsh(elisa) 96 test 96 test , isotonac ( nihon koden) 18 lt , cleanac ( nihon koden) 5 ltr , cleanac 3 ( nihon koden) 2 ltr , hemolynac 3n 500ml , bariumchloride 10% w/v 500ml , benadictsreagent 5lt , fouchet’s reagent 250ml , drabkins solution with standard (for hb) 5000ml , glacial acetic acid 500ml , edta 5% w/v 500ml , sulfuric acid con. 500ml , field stain a 500ml , field stain b 500ml , hydrochloric acid n/10 500ml , immersion oil (microscopy grade) dropping bottle 30ml , wbc diluting fluid 500ml , rbc diluting fluid 500ml , reticulocyte counting fluid (biolab) 25 ml , semen diluting fluid 100ml , formalin 5 lt , formalin 30lt , fructose 100ml , acetone 250 test , leishman stain with buffer 250ml , sulphur powder 500g , liquor ammonia solution 500gm , sodium nitroproside 100gm , carbol fuchsin (zn strong) 500ml , meth line blue 500ml , xyline 2.5ltr , needle 23, 24 1x100nos , sprit 4.5 ltr (methy) , distilled water 5ltr , paps smear staining , slide stand alu , esr niddle , micropipete stand , hemocytometr , glucometre and strip , glucometer strips 1x50nos , micropipette fix volume , micropipette variable volume 0.5 5ul , micropipette variable volume 5 50ul , micropipette variable volume 10 100ul , micropipette variable volume 20 200ul , micropipette variable volume 100 1000ul , incubator (inner chamber ss digital with fan) 14x14x14 , water wath (digital) 10x12x7 , hemoglobin meter , urinometer , slide box , pipette glass 2.0ml , pipette glass 5.0ml , pipette glass 0.2ml , pipette glass 0.1ml , pipette glass 10*75mm , pipette glass 10*75mm , test tube without rim glass 12*100mm , test tube without rim plastic 1x100nos , test tube without rim 1x100nos , test tube without rim 1x100nos , reagent bottle , reagent bottle 12 inch , plastic droper , glass rod , rbc pipette 100 , wbc pipette 10gm , capillary tube 1x100nos , cover slip 18,or 22mm 1x20 nos pack , wintrobe tube for esr , test tube cleaning brush , pipette bulb , test tube holder , tourniquet , citrate vail , edta k3 vail , fluoridevail , plain vail ( activator) , ria vail 100 , chattels forceps straight ss , urine container sterile 30 ml 1 pack , micropipete tips 10 100 u and 100 1000 u, 1 pack , tissue paper , filterpaper 100 pack , insulin syringe , polythene gloves 100 , surgical gloves 6; no 7 n0 , non dispo gloves 100 , postmortem gloves , syringe 50ml , syringe ,20 ml , syringe 10 ml , syringe ,5ml , syringe 2ml , ecg gelly 250ml , usg gelly 250ml , cotton roll 500 g , usg roll upp 1105 in (110mmx20m) thirmal print media) , dental x ray film (1.0.p.a.25x33mm) , gloves powder 500gm , povidione solution 500 ml , povidione ointment 15gm , savlon 1ltr , dettol 1ltr., , dettol500ml, , dettol 100ml , hydrogen peroxide 450 ml 30ml , lignocaine gelly 2% , lignocaine inj with adrenol 2% 30ml , lignocaine spray 10 % , lignocaine inj 2% , lignocaine inj 4% , lignocaine tropical vail 4% , tinbenzone 100ml , pure hand , bandage (antiseptic) , micropore 2inch , micropore 4inch , n. saline,dns,d5,d10 , scalpvan set , berbar thred 20 no. , enima pot , enima pipe with nozal , hot water beg , rubber catheter red , bandage than , roll bandage 0.5x 0.5,7 , roll bandage 5x 5 , roll bandage 10x5 , ecg roll (12 channel gotiz) , mechontosh , head cap disposable 100 , sanityzer 5lt , x ray film digital fuzi 14x17 , x ray film digital duzi 8 x 10 , nylon silk suture4.0 , 31inch*72inch color white non woven fabric for single use bedsheet , weighing machine adult , weighing machine child , weighing machine digital , stethoscope adult , stethoscope child , bp instrument led mercury , goniometer , formalin , pulse oximeter , non contact thermometer , face mask disposable 3 layar , n 95 face mask...

Public Health Engineering Department - Madhya Pradesh

28760183 supply of crm and chemicals for water testing laboratory dist p.h.e.d. ratlam , tds standard 1000 mg / l traceable to srm from nist make merck, sigma enrich, thermo orium nis lab solution, bnd or any iso 17034 certified make . , conductivity standard 1410 micromhos . traceable to srm from nist make . , sulphuric acid 0.02 n sol. , inhibitor for hardness test. , sodium hydroxide 1 n sol. , phenolphthalein. indicator soln , glacial acetic acid ar grade , potassium iodide ar grade , starch ar grade , sodium thio sulphete ar grade , nitric acid ar grade , reagent grade 1 water...

Directorate Of Health Services - Madhya Pradesh

28543471 supply of drugs , surgical item material equipment etc during the year 2021 2022 1 tablet 2 acetazolamide tab ( 250mg ) , tablet 3 acyclovir tab 400 mg ( 400 mg ) , tablet 4 acyclovir ( 800mg ) , tablet 5 albendazole tablets ip 400mg 6 alprazolam ( 0.5mg ) , tablet 7 aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethecon ( tab 300 mg+50mg + 25 mg+25 mg ) , tablet 8 amlodipin tab ( 5mg ) , tablet 9 amlodipine ( 10mg ) , tablet 10 amlodipine ( 2.5mg ) , tablet 11 amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet 12 amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet 13 amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet 14 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet 15 antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp 16 anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet 17 ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet 18 aspirin low dose 75mg tab 19 atenolol ( 100mg ) , tablet 20 atenolol ( 25 mg ) , tablet 21 atorvastatin ( 10 mg ) , tablet 22 atorvastatin ( 20mg ) , tablet 23 atorvastatin ( 40mg ) , tablet 24 atorvastatin ( 5 mg ) , tablet 25 carbamazepine ( sr ) 100 mg tab 26 carbamazepine tab ( 400mg ) , tablet 27 carbamazepine ( 200 mg ) , tablet 28 cefadroxil 250 mg tab 29 cefadroxil 500 mg tab 30 cefixime ( 50 mg dt ) , tablet 31 cefpodoxime 100 mg ( ) , tablet 32 cefpodoxime ( 200 mg ( dispersible tab ) ) , tablet 33 cefpodoxime ( 50 mg ) , tablet 34 cefuroxime 250 mg, tablet 35 cefuroxime 500 mg, tablet 36 cephalexin dispersible ( 125 mg ) , tablet 37 cetirizine ( 10 mg ) , tablet 38 chewable antacid containing magnesium hydroxide minimum 250mg to 500mg+aluminimum hydroxide minimum 250mg to 500mg +simethecon / dimethicon minimum 25mg to 50mg tab ( additional component will also be accept ) , tablet 39 chloraxozone + paracetamol 250 mg + 500 mg tab 40 chlorpromazine hydrochloride ( 25 mg ) , tablet 41 chlorpromazine ( 50 mg ) , tablet 42 cinnarizine ( 25 mg ) , tablet 43 ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet 44 ciprofloxacin 500mg + tinidazole 600mg ( ) , tablet 45 clobazam ( 5 mg ) , tablet 46 clobazam ( 10 mg ) , tablet 47 clonazepam 0.25 mg ( tablet ) , tablet 48 clonazepam ( 1 mg ) , tablet 49 clopidogrel ( 75 mg ) , tablet 50 deferasirox dispersible ( 250mg ) , tablet 51 deferasirox dispersible ( 500mg ) , tablet 52 dexamethasone ( 0.5mg ) , tablet 53 dexamethasone ( 4 mg ) , tablet 54 diazepam ( 5 mg ) , tablet 55 diclofenac 50mg +seratopeptidase 10mg tab ( 10mg ) , tablet 56 diclofenac sodium + paracetamol +serratiopeptidase 50 mg +325 mg + 10 mg tab 57 diclofenac sodium 50mg + paracetamol 325mg tab 58 diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet 59 dicyclomine hydrochloride ( 20 mg ) , tablet 60 diethylcarbamazine tab ( 100mg ) , tablet 61 diethylcarbamazine ( 50 mg ) , tablet 62 digoxin tab 0.25mg ( 25x10 ) , tablet 63 dilitiazem tablets i.p. 30 mg 64 diltiazem tablet ( 60 mg ) , tablet 65 dispersible zinc tab ( 10mg ) , tablet 66 dispersible zinc ( 20mg ) , tablet 67 disulfiram 250 mg tab 68 divalproex sodium 250 mg tab 69 divalproex sodium 500 mg tab 70 divalproex sodium 750 mg tab 71 domperidone ( 10mg ) , tablet 72 doxycycline tab. 100mg ( ) , tablet 73 doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet 74 doxylamine succinate ( 10 mg ) , tablet 75 drotaverine ( 40 mg ) , tablet 76 drotaverine ( 80 mg ) , tablet 77 dydrogesterone 10 mg tab 78 enalapril maleate tab ( 5mg ) , tablet 79 erythomycin stearate ( 250mg ) , tablet 80 erythromycin stearate ( 500 mg ) , tablet 81 escitalopram 10mg tablet ( 10x10 ) , tablet 82 escitalopram ( 20 mg ) , tablet 83 escitalopram ( 5 mg ) , tablet 84 ethamsylate 250mg tablet 85 ethamsylate tab 250 mg ( ) , tablet 86 etiophylline theophylline sr tab. 300mg ( ) , tablet 87 etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet 88 ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg tablet 89 fluconazole 100 mg tab 90 fluconazole ( 150 mg ) , tablet 91 flunarizine 10 mg tab 92 fluphenazine ( 2.5 mg ) , tablet 93 folic acid ip ( 5 mg ) , tablet 94 furazolidone ( 100mg ) , tablet 95 gabapentine ( 100 mg ) , tablet 96 glibenclamide ( 5 mg ) , tablet 97 gliclazide ( 80 mg ) , tablet 98 griseofulvin ( tablet 250 mg ) , tablet 99 haloperidol ( 5mg ) , tablet 100 hydrochlorthiazide ( 12.5 mg ) , tablet 101 ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet 102 ibuprofen ( 200 mg ) , tablet 103 ibuprofen ( 400mg ) , tablet 104 iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg ( blue tablet ) 105 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet 106 iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet 107 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet 108 isosorbide mononitrate ( 20mg ) , tablet 109 isosorbide 5 mononitrate ( tab.20 mg ) , tablet 110 isoxsuprine ( 10mg ) , tablet 111 ketoconazole tab 200mg ( ) , tablet 112 labetalol ( 100 mg ) , tablet 113 lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet 114 levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet 115 levofloxacin ( 250mg ) , tablet 116 levofloxacin ( 500mg ) , tablet 117 lorazepam 1 mg tab 118 lorazepam ( 2 mg ) , tablet 119 losartan tab 25 mg ( 10x10 ) , tablet 120 losartan ( 50 mg ) , tablet 121 magnesium hydroxide and aluminium hydroxide ( ) , tablet 122 medroxy progesterone acetate 10 mg tab 123 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 124 mefenamic acid + drotaverine hcl 250 mg + 80 mg tab 125 metformin + glimepiride 500 mg + 2 mg tab 126 metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet 127 metformin ( 500 mg ) , tablet 128 metformine 500mg + glibenclamide 5mg ( tab ) , tablet 129 methyl prednisolone sodium succinate tablet 8 mg 130 methyl prednisolone tab ( 16 mg ) , tablet 131 methyl prednisolone ( 4mg ) , tablet 132 methyl prednisolone ( 8mg ) , tablet 133 methylcobalamin / mecobalamin ( 500 mcg ) , tablet 134 metoclopramide ( 10mg ) , tablet 135 metoprolol ( 50mg ) , tablet 136 metronidazole tab ( 400mg ) , tablet 137 micronised progesterone ( 100 mg ) , tablet 138 micronised progestrone ( 200 mg ) , tablet 139 mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet 140 mirtazapine 15 mg ( tablet ) , tablet 141 misoprostol 400 mcg 4 tablets / strip 142 misoprostol ( 200mcg ) , tablet 143 nifedipine tablets 10mg tab 144 nimesulide +paracetamol ( 100 + 325 mg ) , tablet 145 nimesulide ( 100 mg ) , tablet 146 nitrofruantoin ( 100mg ) , tablet 147 norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet 148 ofloxacin + ornidazole ( 200mg and 500mg ) , tablet 149 ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet 150 olanzapine 2.5 mg tab 151 olanzapine 7.5 mg tab 152 olanzapine ( 5 mg ) , tablet 153 ornidazole tab ( 500 mg ) , tablet 154 pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet 155 pantoprazole tab ( 40 mg ) , tablet 156 paracetamol tab 650 mg ( 650 mg ) , tablet 157 paracetamol ( 500mg ) , tablet 158 penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet 159 pentoprazole 40mg, domperidone 10mg tab tablet 160 phenobarbitone tab. 60 mg ( ) , tablet 161 phenobarbitone ( 30 mg ) , tablet 162 phenytoin sodium ( 100mg ) , tablet 163 prednisolone ( 10 mg ) , tablet 164 prednisolone ( 5mg ) , tablet 165 primaquin ( 2.5mg ) , tablet 166 primaquin ( 7.5mg ) , tablet 167 promethazine tab ( 25 mg ) , tablet 168 promethazine ( 50 mg ) , tablet 169 propranolol tab ( 10 mg ) , tablet 170 quinine sulphate ( 300mg ) , tablet 171 quinine sulphate ( ip 600mg ) , tablet 172 rabeprazole ( 20 mg ) , tablet 173 ramipril ( 2.5 mg ) , tablet 174 ramipril ( 5 mg ) , tablet 175 ranitidine ( 150mg ) , tablet 176 roxithromycin 150mg tablet 177 salbutamol sulphate ( 4mg ) , tablet 178 secnidazole ( 500 mg tab ) , tablet 179 serratiopeptidase 10 mg tab 180 sodium valporate 300 mg tab 181 sodium valproate + valproate 333 mg + 145 mg ( tablet ) , tablet 182 sodium valproate enteric coated tab. bp ( 200 mg ) , tablet 183 sodium valproate ( 200mg ) , tablet 184 sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet 185 sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet 186 sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet 187 sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet 188 telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet 189 telmisatran ( 40 mg ) , tablet 190 thyroxine sodium tab 100 mcg ( 100 tab bottle ) ( 100 tab ) , tablet 191 tinidazole ( 300 mg ) , tablet 192 tinidazole ( 500mg ) , tablet 193 torasemide tab ( 20mg ) , tablet 194 torasemide ( 10mg ) , tablet 195 tramadol ( 50mg ) , tablet 196 tranexamic acid 500 mg tab tablet 197 verapamil ( 40 mg ip ) , tablet 198 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet 199 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet 200 vitamin c tab 500 mg tablet 201 vitamin. b complex ( nfi ( prophylactic ) ) , tablet 202 voglibose ( 0.3mg tab ) , tablet 203 warfarin sodium 5 mg ( 5 mg ) , tablet 204 zinc sulphate dispersible ( 10mg ) , tablet 205 capsule 206 alfacalcidiol capsule ( 0.25 mcg ) , capsule 207 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg 208 amoxycilline ( 500mg ) , capsule 209 ampicillin trihydrate ( 500mg ) , capsule 210 antioxident ( cap ) , capsule 211 b complex minerals with zinc cap ( ) , capsule 212 cephalexine ( 250mg ) , capsule 213 cephalexine ( 500mg ) , capsule 214 clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule 215 cloxacillin capsules 500mg 216 doxycycline ( 100 mg ) , capsule 217 itraconazole cap ( 100 mg ) , capsule 218 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule 219 methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule 220 micronised progesterone ( 400 mg ) , capsule 221 nifedipine ( sublingual ) 10 mg ( ) , capsule 222 nifedipine capsule 5mg cap 223 omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule 224 omeprazole capsule ( 40 mg ) , capsule 225 omeprazole ( 20mg ) , capsule 226 piroxicam ( 20 mg ) , capsule 227 tramadol cap ( 50mg ) , capsule 228 vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule 229 vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule 230 vitamin e usp ( 400 mg ) , capsule 231 syrup 232 albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup 233 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup 234 alkaline citrate with k oral solution ( 100ml ) , syrup 235 ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( 100ml bottle ) , syrup 236 ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 237 ampicilline 125mg / 30ml syrup 238 antacid mint flavour ( 170ml ) , syrup 239 antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup 240 anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup 241 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup 242 bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup 243 calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup 244 calcium syp 100ml syrup ( 240mg / 5 ml ) 245 carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , syrup 246 cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 247 cefixime syrup 50mg / 5ml ( 30 ml bottle ) , syrup 248 cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup 249 cetirizine syrup ( 5mg / 5ml 30 ml bottle ) , syrup 250 cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup 251 chloroquine phosphate ( ) , syrup 252 cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) 253 cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup 254 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 255 dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup 256 dextromethorphan syrup ( ) , syrup 257 dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syrup 258 dicyclomine syrup 259 diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup 260 disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup 261 drop paracetamol 100mg / 15ml 262 etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup 263 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup 264 ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup 265 iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup 266 iron syrup 200 ml ( elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg / 5 ml ) , consumable 267 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup 268 metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup 269 metronidazole 100mg / 5ml ( 30ml ) , syrup 270 milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup 271 multivitamin 200ml syrup 272 multivitamine 100ml syrup ( 100 ml ) , syrup 273 norfloxacin + tinidazole ( ( 100 mg + 100 mg ) 30ml syrup ) , syrup 274 norfloxacin +metronidazole 30ml syrup 275 ofloxacin+ metronidazole ( 30ml ) , syrup 276 ondansetron syrup 2mg / ml 277 ondansetron ( 2mg / 5ml 30ml bottle ) , syrup 278 oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup 279 paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) 280 paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml ) syrup 281 phenobarbitone syp 200mg / 5ml ( ) , syrup 282 potassium chloride syrup 200ml ( each ) , syrup 283 quinine sulphate 150mg / 5ml syrup 60 ml 284 salbutamol sulphate ( 2mg / 5ml 60ml ) , syrup 285 salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup 286 syp. cefodroxil 125mg / 30ml syrup 287 syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup 288 syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup 289 syrup cefpodoxime 50 mg 290 vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup 291 vitamin b complex nfi formula ( 100ml bottle ) , syrup 292 vitamin b complex nfi formula ( 200ml bottle ) , syrup 293 vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup 294 zinc sulphate 10 mg elemental zinc / 5 ml ( 100 ml bottle ) , syrup 295 zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup 296 inhaler / powder 297 budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler 298 budesonide ( inhalation 200 mcg per dose ) , inhaler 299 salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler 300 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 301 salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule 302 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder 303 ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l 304 vitamin d3 granules ( 60000 iu sachet ) , powder 305 injection 306 acyclovir inj 250 mg / vial 307 acyclovir inj ( 500mg / vial ) , injection solution for 308 adenosine inj 6 mg / 2ml ( 2ml amp ) 309 adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection 310 alpha beta arteether ( 150mg / 2ml ) , injection 311 amikacin ( 100mg / 2ml vial ) , injection 312 amikacin ( 250mg / 2ml ) , injection 313 amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection 314 aminophylline ( 25 mg / ml 10 mg vial ) , injection 315 amiodarone 50mg / ml ( 3ml vial / amp ) , injection 316 amoxicillin + clavulanic acid ( 125 mg + 25 mg / vial ) , injection 317 amoxicillin 250mg + clavulanic acid 50mg inj vial 318 amoxicillin ( 250 mg / vial ) , injection 319 amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection 320 amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection 321 amoxycilline and clavulanic acid inj 322 amphotericin b inj ip ( 50 mg ) , injection 323 ampicillin inj. 250 mg / vial 324 ampicillin ( 1 gm vial ) , injection 325 ampicillin ( 500 mg / vial ) , injection 326 ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection 327 anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection 328 anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for 329 anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection 330 anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection 331 artesunate ( 60 mg / vial ) , injection 332 atracurium besylate ( 10mg / ml inj amp ) , injection 333 atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection 334 atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection 335 azithromycin inj 100mg / 5ml 336 azithromycin ( 500 mg / 5ml inj ) , vial 337 benzyl penicillin 10lac / vial ( penicillin g ) , injection 338 betamethasone sodium phosphate ( ml contain betamethasone na phosphate equal to 4mg of betame ( 1ml amp ) ) , injection 339 biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection 340 biphasic isophane insulin ( 30 / 70 40iu / ml ( 10 ml vial ) ) , injection 341 bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp ( 4 ml amp ) , injection 342 bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule 343 bupivacaine hydrochloride inj 0.25% ( 20 ml vial ) ( 20 ml vial ) , injection 344 caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection 345 calcium chloride inj. ( ) , injection solution for 346 calcium gluconate ( 10% ( 10 ml vial ) ) , injection 347 calcium leucovorin 50 mg / vial inj 348 carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection 349 carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection 350 cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection 351 cefoperazone 500mg + sulbactam 500mg ( vial ) , injection 352 cefotaxime sodium inj ( 500 mg / vial ) , injection 353 cefotaxime sodium ( 1 gm vial ) , injection 354 cefotaxime sodium ( 250 mg vial ) , injection 355 ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection 356 ceftriaxone inj 500mg vial 357 ceftriaxone ( 1g ) , injection 358 ceftriaxone ( 250mg vial ) , injection 359 ceftriaxone+tazobactum 250mg+31.25mg inj ( vial ) , injection solution for 360 ceftrioxone inj.usp ( 1gm / vial ) , injection 361 chlorpheniramine maleate 10mg / ml inj 10 ml vial 362 chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for 363 cloxacillin sodium inj. 500mg 364 dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection 365 dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection 366 diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection 367 diclofenac sodium 25 mg / ml ( 3ml amp ) , injection 368 dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection 369 digoxin 250mcg / ml ( 2ml amp ) , injection 370 dobutamine hcl 50 mg / ml ( 5ml amp ) , injection 371 dobutamine ( 12.5 mg / ml 20 ml vial ) , injection 372 dobutamine ( 50 mg / 5 ml ) , injection 373 dopamine hcl 40 mg / ml ( 5ml amp ) , injection 374 doxorubicin ( lypholozed ) ( 50mg vial ) , injection 375 drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection 376 enoxaparin ( 20mg / 0.2ml ) ( 0.2 ml prefilled syringe ) , injection 377 enoxaparin sodium 40mg ( 20mg / 0.2ml ) prefilled syringe inj ( ) , syrings 378 enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection 379 enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection 380 erythropoietin ( 4000 iu inj vial ) , injection 381 ethamsylate inj ( 250mg ( 2ml amp ) ) , injection 382 etiophylline and theophylline ( 220 mg / 2ml ) , injection 383 fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampoule 384 ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection 385 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection 386 gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection 387 gentamicin inj. 40 mg / ml, 2ml amp 388 gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection 389 glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for 390 glycopyrolate 0.5% 5ml and neostigmin 2.5 mg / 5 ml injection ( each ) , injection 391 glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) ( 1 ml amp ) , injection solution for 392 haloperidol inj 5mg / ml ( 1 ml amp ) 393 hcg ( human chorionic gonadotropin ) inj 5000 iu vial 394 heparin inj ( 5000iu / ml 5ml vial ) , injection solution for 395 heparin ( 1000iu / ml 5ml vial ) , injection 396 hepatitis b immunoglobulin im inj 200 iu / vial 397 human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution for 398 human chorionic gonadotropin inj 5000 iu 1ml amp 399 human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection 400 human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection 401 human normal immunoglobin ( 5gm / 100ml ) , injection 402 hydrocortisone inj 100 mg / vial ( ) , injection 403 hydrocortisone sodium succinate inj. 200mg vial ( ) , injection 404 hydrocortisone sodium succinate ( 100 mg / vial ) , injection 405 hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection 406 inj.iv dns ( ) , injection 407 insulin biphasic / premix 50:50 ( 100 iu / ml ( 10 ml vial ) ) , injection 408 insulin biphasic / premix 50:50 ( 40 iu / ml ( 10 ml vial ) ) , injection 409 insulin human mixtard inj. 30:70 ( ) , injection solution for 410 insulin soluble inj. 40 iu / ml 411 iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection 412 iron sucrose ( 20 mg ) , injection 413 isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for 414 iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection 415 ketamine hydrochloride inj. 50mg / ml ( 2 ml amp ) 416 ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection 417 ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection 418 labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection 419 lidocaine 2% inj. 30 ml vial ( ) , injection solution for 420 lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection 421 magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule 422 magnesium suplhate injection i.p.50 % w / v 10ml amp 423 magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection 424 medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection 425 mephentermine inj 30mg / ml ( 10 ml vial ) , injection 426 meropenem ( 1gm ) , injection 427 meropenem ( 500 mg / vial ) , injection 428 methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection 429 methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vial 430 methyl prednisolone sodium succinate inj. usp 500mg 431 methyl prednisolone sodium succinate inj.1000mg vial 432 metoclopramide inj. 5mg / ml ( 2 ml amp ) 433 metoprolol inj 1 mg / ml ( 5ml vial ) , injection solution for 434 micronised progestrone ( 50 mg / ml 4 ml amp ) , injection 435 midazolam ( 1mg / ml ( 10ml vial / amp ) ) , injection 436 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 437 morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection solution for 438 morphine sulphate inj. ip 15mg / ml 439 multivitamin 10ml amp inj 440 n acetyl cysteine inj 200mg / ml in 10ml amp 441 naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for 442 neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection 443 nitroglycerine inj. usp 25 mg / 5ml ( 5ml amp ) 444 noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection 445 noraderanaline inj. 2 mg base / 2 ml amp 446 omeprazole 40mg ( vial ) , injection 447 ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection 448 oxytocin 10 iu / ml ( per ampolule ) , injection 449 oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection 450 pantaprazole ( 40mg ) , injection 451 paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection 452 pentaprazole inj vial ( 40 mg ) , injection 453 pentazocin lactate ( 30mg / ml ( 1 ml amp ) ) , injection 454 pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection 455 phenobarbitone ( 200 mg / ml ) , injection 456 phenytoin sodium 250 mg / 5 ml ( 5ml vial ) , injection 457 phenytoin sodium inj. 100 mg ( ) , vial 458 phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection 459 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection 460 piperacillin + tazobactam 2000 mg + 250 mg 20ml vial ( ) , injection 461 piperacillin + tezobactin ( 4.5 g ) , injection 462 potassium chloride inj. 150 mg / 10ml 463 pralidoxime ( pam ) inj. 25 mg / ml ( 20 ml amp / vial ) , injection 464 promethazine inj 25 mg / ml ( 2 ml amp ) ( 2 ml amp ) , injection 465 propofol 1% ( 10ml / 5ml 20ml ) , injection 466 quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection 467 quinine sulphate inj. 300mg / ml . 468 rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection 469 rabies vaccine inj ( vero cell culture ) inj. intra dermal ( ) , vial 470 rabies vaccine ip human ( ( cell culture ) ) , injection solution for 471 rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution for 472 ranitidine ( 50mg / 2ml , 2ml amp ) , injection 473 snake venom anti serum ip liquid form ( ) , injection 474 sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule 475 sodium thiopentone ( 500mg ) , injection powder for 476 soluble insulin 30% isophane insulin 70% 100 iu inj 477 streptokinase inj 15 lac iu ( vial / amp ) , injection 478 streptokinase inj ( ) , injection solution for 479 succinyl choline inj. 50mg / ml 1ml amp 480 succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection 481 teicoplanin ( 200 mg / vial ) , injection 482 tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection 483 tetanus toxide inj 5ml ( ) , injection solution for 484 tetanus toxiod ( inj. ) , injection 485 tetanus toxoid ( adsorbed ) ip ( 5ml vial ) , injection 486 tramadol ( 100mg / ml ( 2 ml amp ) ) , injection 487 tramadol ( 50mg / ml ( 2ml amp ) ) , injection 488 tranexamic acid inj. 125mg / ml amp 489 tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection 490 urokinase ( 5 lac iu / vial inj ) , injection powder for 491 vancomycin hydrochloride ( 1000mg vial ) , injection 492 vecuronium bromide inj 2mg / ml ( 2ml amp ) 493 vecuronium bromide inj 4mg / ml amp 494 vitamin b complex injection nfi formula 30ml / vial ( 30ml / vial ) , injection 495 vitamin b12 inj 500 mcg / ml ( 30 ml amp ) 496 vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection 497 water for injection 5 ml amp 498 water for injection inj 10 ml amp 499 water for injection ip ( 2 ml amp ) , injection 500 iv fluid 501 ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) 502 dextrose 10% 500ml bfs bottle ( ) , injection solution for 503 dextrose 10% ( ffs / bfs 500ml bottle ) , injection 504 dextrose 25% inj 500ml bfs bottle ( ) , injection solution for 505 dextrose 25% inj 500ml ffs / bfs bottle ( ) , injection solution for 506 dextrose 25% inj ( 100ml ffs / bfs bottle ) , injection solution for 507 dextrose 25% ( 500ml ffs bottle ) , injection 508 dextrose 5% 500ml bfs bottle ( ) , injection 509 dextrose 5% inj 500ml ffs / bfs bottle ( ) , bottle 510 dextrose 5% ( 500ml ffs bottle ) , injection 511 dextrose 50% inj 100ml ffs / bfs bottle ( dextrose 50% inj 100ml ffs / bfs bottle ) , injection solution for 512 dextrose 50% inj. bottle ( 500ml ffs / bfs ) , injection solution for 513 dextrose with saline 5% + 0.9% inj 500ml bfs bottle 514 dextrose with saline 5% + 0.9% inj 500ml ffs / bfs bottle 515 dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection 516 electrolyte g inj 500ml bfs bottle ( ) , injection solution for 517 electrolyte g inj ffs / bfs bottle ( 500ml ) , injection solution for 518 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) intravenous fluid [ each 100ml contains: anhydrous dextrose 5 gm, sod.chloride 0.37g, potassium chloride 0.13g, ammonium chloride 0.37g ] ( 500ml ffs bottle ) ( 500 ml ) , bottle 519 electrolyte m inj 500ml bfs bottle ( ) , injection solution for 520 electrolyte m inj 500ml ffs / bfs bottle ( ) , injection solution for 521 electrolyte m inj ( 500ml ffs bottle ) , injection solution for 522 electrolyte p inj 500ml bfs bottle ( ) , injection solution for 523 electrolyte p inj 500ml ffs / bfs bottle ( ) , injection solution for 524 electrolyte p inj ( 500ml ffs bottle ) , injection solution for 525 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , injection 526 human normal immunoglobin ( 5gm / 100ml ) , injection 527 mannitol inj. 20% 350ml ffs bottle 528 mannitol injection i.p. 20% 100ml bottle ( ) , injection solution for 529 moxifloxacin ( 100ml ) , injection 530 normal saline ( 0.9% ( 500ml ffs bottle ) ) , injection 531 ofloxacin infusion ( 2mg / 1ml ( 100ml ffs bottle ) ) , bottle 532 ofloxacin inj 2mg / 1ml 100ml 533 ringer lactate inj iv 500ml bfs bottle ( ) , injection solution for 534 ringer lactate inj iv 500ml ffs / bfs bottle ( ) , injection solution for 535 ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , injection solution for 536 sodium chloride 0.9% injection ip 100ml bottle ( ) , injection powder for 537 surgical spirit ( 100ml ) , bottle 538 eye drops / ear drops 539 atropine sulphate eye drops 1% ( 5 ml vial ) ( 5 ml vial ) , eye drops / ointment 540 carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop 541 carboxymethylcellulose ( 5 ml ) , eye drop 542 chloramphenicol 0.5% ( 5ml ) , eye drop 543 chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop 544 ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop 545 ciprofloxacin 0.3% ( 5ml vial ) , eye drop 546 clotrimazole 1%w / v +lignocaine 2%w / v ( 10ml ) , eye drop 547 fluconazole eye drop 3 mg / ml ( 10 ml vial ) ( 3 mg ) , eye drop 548 gentamycin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop 549 moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 550 moxifloxacine eye drop 0.5%w / v 551 ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop 552 ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop 553 ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop 554 cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops 555 clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop 556 clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial 557 cream / ointment 558 aciclovir 3% ( 5gm tube ) , ointment 559 aciclovir cream 5% ( 5g tube ) ( ) , cream 560 acyclovir 5% ( 5gm ) , ointment or cream 561 atropine sulphate eye ointment 1% ( 3 gm tube ) 562 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream 563 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment 564 benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment 565 benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube 566 betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream 567 betamethasone valerate cream 0.05% ( 15gm tube ) , ointment 568 betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment 569 betamethasone valerate oint / cream ip. 0.12% 570 cetrimide cream bp ( 0.1% w / w ) , tube 571 chloramphenicol eye ointment 1% ( 4 gram ) , tube 572 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 573 clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream 574 clotrimazole cream 1% ( 15 gm tube ) , cream 575 clotrimazole cream 1% ( 15 gm tube ) , cream 576 clotrimazole i.p. 2%w / w ( 15gm tube ) , cream 577 compound benzoic acid ointment 578 cream sumag ( ) , cream 579 framycetin sulphate 1% cream ( 30 gm tube ) , cream 580 fusidic acid 0.02 ( 15 gm ) , cream 581 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 582 gentamycin sulphate 0.1% ( 15gm tube ) , ointment 583 miconazole cream i.p. 2% w / w ( 15 gm tube ) , consumable 584 mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment 585 neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube 586 permethrin 5% ( 30 gm ) , cream 587 povidone iodine cream 250 gm 588 povidone iodine ointment 5% 15gm tube 589 povidone iodine ointment 5% 250gm jar ( ) , each 590 salicylic acid ointment ( 6% ) , ointment 591 salicylic acid ( 0.02 30 gm ) , ointment 592 silver sulphadiazine cream usp 1% w / w 25gm 593 silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream 594 soframycin ointment 30 mg tube ( ) , ointment 595 lab test kits and reagent 596 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 597 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 598 anti abd grouping serum 3x10ml consumable 599 anti b sera igm ( 10 vial ) , consumable 600 anti d sera igg+igm 10ml vial ( each ) , consumable 601 anti d ( polyvalent ) ( 1x10 ml ) , consumable 602 auto pippets fixed volume 10 micro liters each 603 auto pippets fixed volume 1000 micro liters each 604 auto pippets fixed volume 20 micro liters each 605 benedicts qualitative reagent ( 1x5 lit ) , consumable 606 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 607 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 608 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 609 bilirubin kit ( colorimeter semi auto ) 4x60 ml 480 test / kit consumable 610 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 611 blood agar powder ( 500 grm ) , consumable 612 blood bag 100ml 613 blood bag 350ml 614 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 615 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 616 blood grouping anti sera a monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 617 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 618 blood grouping anti sera b monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 619 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) 620 blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 621 blood urea ( bun ) uv ( 1000 ml ) , consumable 622 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable 623 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable 624 blood urea ( arba ) , consumable 625 capillary tube 100 pieces consumable 626 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 627 cholesterol kit end point enzymatic kit 50 test / kit 628 cholesterol kit end point enzymatic kit 5x20ml 200 test / kit 629 conc hcl ( 1x500 ml = 500 ml ) , consumable 630 cover slip 18 x 18 mm 10gm 631 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 632 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 633 creatinin kit 634 crp kit 1x100 biolab qualitative ) 635 crp latex slide per test 636 crp test kit ( latex / card ) ( 25 test / kit ) 637 crp test kit ( latex / card ) , kit of 25 tests ( mfg pathogyme diagnostics ) ( 25 test / kit ) , consumable 638 dengu card antigen ( 25 card / pkt ) , consumable 639 dengue card test 100 test kit 640 developer powder ( 22.5 ltr ) 641 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 642 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 643 digital x ray film 10x12 ( 150 films / pkt ) 644 digital x ray film 11x14 ( 150 films / pkt ) 645 digital x ray film 8x10 ( 150 films / pkt ) 646 echo jelly 20ml bottle 647 echo jelly 250 ml ( mfg by precious life care ) , bottle 648 edta k3 vial each 649 edta solutions k3 ( 500 ml ) 650 edta solutions k3 ( mfg by himedia ) ( 500 ml bottle ) , consumable 651 field stain a 500ml 652 field stain b 500ml 653 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 654 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 655 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 656 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable 657 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 658 glacial acetic acid ( 2.5 liter ) , consumable 659 glass slide 75mm x 25mm 1.1 mm 660 glass slide 75mm x 25mm 1.35 mm 661 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 662 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt 663 glass test tube 12 x 75 ( small size ) heavy quality 100 / pkt 664 glass test tube 5 without edge 665 glucometer strip ( 1x100 ) 666 glucose kit ( god / pod ) ( 350ml ) , digonstic 667 h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable 668 hba ag elisa 96 kit 1x96 ( each ) , consumable 669 hba ag rapid card test ( each ) , consumable 670 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 671 hcl n / 10 ( 500 ml bottle ) 672 hcv elisa ( 96 test kit ) , consumable 673 hcv kit card test ( 25 test / kit ) , digonstic 674 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 675 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 676 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 677 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 678 hiv kit card ( 25 test / kit ) 679 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 680 k3 blood vaccutainer edta 100 tubes / pkt 681 leishman stain 500 ml 682 malaria antigen card pf / pv card ( as per nvbdcp guidelines ) ( 10 card, 10 dropper, 1 buffer solution ) 683 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 684 malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species 685 malaria pf / pv antigen card 686 malaria pf / pv rapid test 687 methyline blue ( 100 ml ) , solution 688 micro pipet 1000 fix and variable each 689 micropiptte 100 1000 690 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 691 n / 10 hcl 500ml 692 nebulization mask kit ( pediatrics ) 693 nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable 694 nebulization mask kit ( adult ) 695 new born baby kit [ 4 piece set ] 696 pregnancy test card ( 10 card pack ( mfg oscar medicare pvt ltd ) ) , consumable 697 ra factor 50 test kit qualicative 698 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 699 test tube 12 x 100 ( medicm size ) 100 / pkt 700 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 701 test tube 15x125 702 tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each 703 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 704 tips for auto pippetes 10 to 100 micro litres 705 tissue paper roll ( each ) , consumable 706 tourniquet with belt ( good quality pairs ) , pairs 707 tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable 708 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 709 typhoid test card. 710 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 711 umbical cord clamps plastic material ( box of 100 clamps ) , consumable 712 urine albumin & suger 713 usg gel ( mfg precious life care pvt ltd ) ( 250 ml bottle ) , consumable 714 usg thermal paper 715 vdrl ( rpr ) 1x100 sd strip 716 vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable 717 vdrl kit ( strip ) ( 50 test / kit ) , consumable 718 widal 2x2 sera slide kit 719 widal 2x2 tube test kit 720 widal 4x5 ml 721 slide blue star 722 sputum cup with sticker 723 paraffin strip roll 724 zipper polybag 725 alluminium foil roll 726 hand wash liquid 727 falcon tube 728 thermacol box 729 gel pack 730 bamboo stick 731 tape roll 732 spirit lamp 733 disposible material 734 adhesive plasters usp 7.5 cm x 10 mts / roll 735 adhesive plasters usp 7.5 cm x 5 mts / roll 736 adhesive roll 1 inch x 5 m / roll 737 baby oxygen mask set of all sizes 738 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag 739 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag 740 disposable appron consumable 741 disposable cap 742 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 743 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 744 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 745 disposable needles 22g consumable 746 disposable needles is 10654:2002 22g 747 disposable needles is 10654:2002 24g 748 disposable needles is 10654:2002 26 g ( ) , needle 749 disposable paper gloves size 7 inches consumable 750 disposable paper gloves size 7, 1 / 2 inches consumable 751 disposable plastic appron ( full size ) 752 disposable pricking lancet ( pkt of 200 units ) 753 disposable pricking lancet 100 units consumable 754 disposable scalp vein set size 20 no 755 disposable scalp vein set size 22 no 756 disposable sharp collection containers 1.5 l 757 disposable sharp collection containers 5 ltr 758 disposable sideport knife ( num ) , consumable 759 disposable sterile gloves size 6 inches consumable 760 disposable sterile gloves size 61 / 2 inches consumable 761 disposable sterile gloves size 7, 1 / 2 inches consumable 762 disposable sterile hypodermic syringe 10ml ( each ) , consumable 763 disposable suction catheter assorted covering all sizes 10, 12, 14, 16, 18 consumable 764 disposable suction catheter ( size 12 ) , consumable 765 disposable suction catheter ( size 14 ) , consumable 766 disposable surgeon cap ( box of 100 caps ) 767 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 768 disposable syringe with needle ( 2ml each ) , syrings 769 disposable syringe with needle ( 3ml each ) , syrings 770 disposable syringe with needle ( 5ml each ) , needle 771 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 772 kellys pad disposable 773 n 95 mask ( as per attached specification ) , consumable 774 oxygen mask adult ( standard size ) 775 oxygen mask paediatric ( standard size ) 776 plain disposable vial 3ml ( each ) , consumable 777 scalp vein set ( size 24g, disposable ) , consumable 778 three layer surgical mask 779 urine container 5ml disposable ( 50 per pkt ) 780 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 781 x ray related 782 x ray film 10 x 12 50 sheets / pack 783 x ray film 12 x 12 50 sheets / pack 784 x ray film 12 x 15 50 sheets / pack 785 catgut / b.b. silk 786 b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable 787 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle 788 b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle 789 b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material 790 b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material 791 black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) 792 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable 793 black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt 794 black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt 795 catgut chromic size:2 / 0 length 150 cm 796 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet 797 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable 798 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable 799 chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length 150 cm ) , consumable 800 chromic catgut , round body needle no. 1.0 801 chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) 802 chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt 803 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle 804 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 805 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 806 non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable 807 non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable 808 silk no 1 cutting needle 1x12 ( 1x12 ) , consumable 809 suture mersilk 8 0 ( 12 foil ) 810 cotton and related, chadar, bedsheet 811 absorbent cotton roll 100 gm each consumable 812 absorbent cotton wool ip 500 grms ( each ) , consumable 813 cotton crape bandage 10cm x 4m ( box of 10 bandages ) 814 cotton crape bandage 15cm x 4m ( box of 10 bandages ) 815 cotton delivery belt 816 adhesive tape 817 adhesive tape 7.5cm x10 ( mtr / roll ) , consumable 818 cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable 819 paper adhesive microporous surgical tape 3 inch x 5 m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable 820 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll 821 paper adhesive plaster microporous surgical tape 2 inch x 5m / roll 822 paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll 823 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 824 paper adhesive plaster microporous surgical tape 6 inch x 5m / roll 825 umblical cotton tape length 75cm. 826 catheter 827 disposable suction catheter ( size 12 ) , consumable 828 disposable suction catheter ( size 14 ) , consumable 829 feeding tube ( catheter ) 10g 830 foleys catheter size 12 2 way ( 10 each ) , consumable 831 foleys catheter size 14 2 way 832 foleys catheter size 14 3 way 833 foleys catheter size 16 2 way ( 11 each ) , consumable 834 foleys catheter size 18 2 way 835 foleys catheter size 20 2 way ( 12 each ) , consumable 836 foleys catheter size 22 2 way ( 13 each ) , consumable 837 foleys catheter size 24 2 way ( 14 each ) , consumable 838 foleys urinary catheter 2 way size 8 839 infant feeding tube ( catheter ) size: 3g 840 infant feeding tube ( catheter ) size: 4g 841 infant feeding tube ( catheter ) size: 5g 842 blade 843 surgical blade isi marked, size 15 ( 100 per packet ) , surgical material 844 surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material 845 surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material 846 surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material 847 surgical blade, size 11 848 ecg 849 ecg jelly 250 gms 850 ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable 851 ecg paper computerizesd triple channel 20m 852 ecg paper ( chemical coated ) 50mm x 20mm roll 853 ecg paper ( chemical coated ) 50mm x 30 mtr. roll 854 ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll 855 ecg paper ( wax coated ) mfg by life o line technologist ( 50mm x 30 mtr, roll ) , consumable 856 ecg roll three channel 20m 857 ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable 858 needle 859 absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) 860 absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable 861 blood vessel introducers needles 16g, sterilized, set 862 chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle 863 chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle 864 chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle 865 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 866 intravenous set with airway and needle ( ( adult ) ) , surgical material 867 intravenous set with airway and needle ( children ) , surgical material 868 sterile hypodermic syring with needle 10 ml 869 sterile hypodermic syring with needle 20 ml 870 sterile hypodermic syring with needle ( 5 ml ) , syrings 871 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable 872 iv cannula 873 cannula fixer set consumable 874 i.v cannula with injection valve size : 18g 875 i.v. cannula with injection valve 20g 876 iv cannula ( two way ) size 20 877 iv cannula ( two way ) size 22 878 iv cannula ( two way ) size 24 879 iv cannula size 26g ( ) , consumable 880 biomedical waste collection plastic bag small ( all colours ) 881 biomedical waste collection plastic bag medium ( all colours ) 882 biomedical waste collection plastic bag large ( all colours ) 883 mattress 5kg cotton 3 ft x 6 ft 884 pillow with 2kg cotton 885 tericot sharee 886 compunder dress ( male ) 887 bed sheet single bed ( white ) 888 bedsheet double bed ( white ) 889 bed sheet single bed ( coloured ) 890 bedsheet double bed ( coloured ) 891 baby diapers small ( 10 diaper per pkt ) 892 chair cushion box type 893 chair cushion box type 894 chair cushion cover 895 compounder coat / lab tec / xry tec std size 896 curtain green redymade 897 curton cloth rangeen 898 curton cloth rangeen design 899 dionised water 5 ltr cane ( each ) 900 front aprin 901 metresses 3x6 with raxine cover 4 density 902 napkin sup. quality std size ( white ) 903 napkin sup. quality std size ( coloured ) 904 peticote blauge cloth shuti rangeen 905 peticote / blauge cloth shuti bleach 906 pillow cover cloth bleach 907 rangeen baag print kapda 908 rangeen baag print kapda 909 rangeen design towel beev kapda 910 rangeen design weft stripe kapda 911 table cloth rangeen ( small ) 912 table cloth rangeen ( large ) 913 biomedical waste collection plastic dustbin small ( all colours ) 914 biomedical waste collection plastic dustbin medium ( all colours ) 915 biomedical waste collection plastic dustbin large ( all colours ) ...

Directorate Of Medical Education - Madhya Pradesh

28408130 purchase of reagents chemicals and solutions 2 acetone 3 alcohol 100% 4 acetic acid 5 acetic acid glacial 6 agar agar powder no1 7 alberts stain a 8 alberts stain b 9 alpha naphthylamine solution 10 ammonium hydroxide 11 ammonium sulphate 12 ammonium oxalate 13 anhydrons sodium carbonate 14 basic fuschin powder 15 basic fuschin prepared 16 banadict’s solution 17 baritt reagent a 18 baritt reagent b 19 barbituric acid 20 barium chloride solution prepared 21 benzene 22 benzidine powder 23 bismith nitrate 24 bis acrylamide 25 bovine albumin 26 casein 27 castor oil 28 canada balsom 29 crystal violet 30 carbon tetra chloride 31 citric acid 32 chloroform 33 copper sulphate 34 corn oil 35 creatinine zinc chloride 36 diethyl ether 37 distill water 38 dinitro salicylic acid 39 drabkins solution 40 d.p.x. 41 d l aspartic acid 42 dettol 43 dextrine 44 dextrose / glucose 45 2 6 dichlorophenol indophenol 46 di sodium hydrogen orthophosphate 47 ethanol 48 ethyl alcohol 49 eithidium bromide 50 eosine ( yellow ) 51 eosine powder 52 egg albumin 53 edta powder 54 formaldehyde 55 fauchet’s reagent 56 glacial acetic acid 57 glucose powder 58 gram’s iodine 59 giemsa powder 60 glycerol 61 glycerin 62 gention voilet 63 g6 pd solution prepared 64 hydrogen per oxide 65 hydrochloric acid 66 haematoxyline prepared 67 haematoxyline harris 68 hplc grade methanol 69 hplc grade water 70 iodine crystal 71 iodine solution 72 iso propyl alcohol 73 lead acetate 74 liquid paraffin 75 liquid ammonia 76 lithium carbonate 77 leishman stain powder 78 lacto phenol cotton blue 79 lypoenlavide solution 80 l lysine monohydrate 81 l methionine 82 lithium carbonate 83 meta phosphoric acid 84 micobacteria decolourizer 85 malachite green 86 methanol 87 methelene blue powder 88 methelene blue solution 89 methyl voilet solution prepared 90 methyl voilet powder 91 mercury metal 92 mercuric chloride 93 nigrosin stain 10% w / v 94 nitric acid 95 ninhydrine 96 n / 10 hcl 97 orthophosphoric acid 98 oxidase reagent 99 oxalic acid 100 paraffin wax 101 pandy’s solution prepared 102 perchloric acid 103 phosphotungustic acid 104 potassium chloride 105 potassium iodide 106 potassium hydroxide 107 potassium dichromate 108 potassium oxalate 109 potassium dihydrogen orthophosphate 110 phenyl liquid 111 phenol 112 phenolic auramine 113 potassium permangnate 114 picric acid 115 prepared reticulocyte fluid 116 prepared pandy’s solution 117 prepared leishman stain 118 prepared concentrate 6% fauschets reagents 119 pumic stone powder 120 rectified spirit 121 r.b.c. diluting fluid 122 rotheras test reagent ( ketone body ) na. sodium nitroprusside nb. liquer ammonia nc. ammonium sulphate 123 sugars all types 124 sodium citrate 125 schaeffer & fulton spore stain a 126 schaeffer & fulton spore stain b 127 silver nitrate 128 silica gel 129 soft soap 130 sodium acetate 131 sodium citrate 132 sodium tri citrate 133 sodium chloride 134 sodium carbonate 135 sodium bicarbonate 136 sodium hydroxide 137 sodium hydroxide palet 138 sodium phosphate 139 sodium pot. tartrate 140 sodium hypo chlorite 5% 141 sodium hypo chlorite 10% 142 silver nitrate 143 sodium hypo chloride 144 sprit ammonia aromatic 145 spirit denatured 146 sulfuric acid con. 147 sulfuric acid 20% 148 sulphar powder 149 sulphosalicylic acid 150 savlon 151 tincture cardimum 152 turpentine oil 153 tri sodium citrate 154 tri chloroacetic acid 155 topffer reagent 156 tris buffer 157 tris base 158 temed 159 thymol 160 w.b.c. diluting fluid 161 xylene sulphar free 162 soft soap 163 loboline 164 phenylalanine 165 sodium hippurate 166 benzoic acid 167 list of reagent kits for semi / fully auto analyzer & other kits 168 a.s.o.test 169 c.r.p. test 170 erba wash 171 hbsag card test 172 hepatitis a 173 hepatitis e 174 malaria pf / pv antigen kit 175 montoux vaccine for adult 176 montoux vaccine for child 177 pregnancy card test 178 prothombin time kit isi 1.0 179 r.a. test 180 rapid pap kit 181 rpr test ( slide ) 182 rpr test ( tube ) 183 rpr card test 184 s.g.o.t. kit ( ast ) 185 s.g.p.t. kit ( asi ) 186 serum acid phosphate kit 187 serum albumin kit 188 serum alkaline phosphate kit 189 serum bilirubin kit 190 serum calcium 191 serum cholesterol kit 192 serum creatinine kit 193 serum hdl kit 194 serum triglyceride kit 195 sugar ( glucose ) kit 196 tlc reagent spray bottle 197 total protein ( biuret method ) 198 urea kit 199 uric acid kit 200 urine strip ( albumin / sugar ) 201 ketone body strip 202 widal slide test 203 widal tube test 204 widal card test 205 dengue kit 206 dengue card ( antigen & antibody ) 207 dengue elisa igg 208 dengue elisa igm 209 dengue elisa ns1 antigen 210 chicken gunia rapid card 211 elisa tb igm 212 elisa tb igg 213 elisa tb iga 214 cardiolipin antibody igm 215 cardiolipin antibody igg 216 cardiolipin antibody iga 217 cpkmb kit 218 g6pd kit 219 aptt kit 220 torch elisa kit igm, igg, iga 221 list of blood bank items 222 triple sagam bag 450ml. 223 quadruple bag top & bottom sagam 450ml. 224 paediatrics bags 100ml. 225 blood grouping & cross matching by gel technology 226 forward abd grouping 227 forward & reverse abd grouping 228 cross matching / or coomb’s test 229 liss solution 230 blood grouping anti sera for slide & tube method 231 anti –a titer 1:256 232 anti –b titer 1:256 233 anti –d ( igg+igm ) 234 anti ab 235 anti a1 ( lactin ) 236 anti h ( lactin ) 237 anti c ( capital ) 238 anti c ( small ) 239 anti e ( capital ) 240 anti e ( small ) 241 anti k ( capital ) 242 anti k ( small ) 243 anti fya 244 anti fyb 245 anti jka 246 anti jkb 247 anti d should be of both types: anti d ( r0 ) & anti d ( r1 ) 248 hiv elisa 249 hiv elisa ( fourth generation ) 250 hcv elisa 251 hbsag elisa 252 hiv rapid card test 253 hiv rapid card ( flow through immuno dot method ) 254 hcv rapid card test 255 hcv rapid card ( flow through immuno dot method ) 256 hbsag rapid card test 257 vdrl rapid card test 258 m.p. antigen card test with specification pf / pv 259 e. micro tips 260 5μ to 200 μ tips 261 100μ to 1000 μ tips 262 sample collection tube 263 test tube with cap ( size 12mmx75mm ) 264 edta vial ( 2ml. ) 265 plain vial ( 5 ml ) 266 list of laboratory equipment / items 267 anaerobic gas pack system 268 comparator nessler 269 centrifuge machine 08 tubes 270 centrifuge machine ( 24tube ) 271 colorimeter 272 counter 273 dissecting microscope 274 distill water plant ( glass ) 275 electronic hemoglobin meter ( 530nm filter ) 276 electronic weighing balance 0gm 210gm. 277 enamal tray 278 extraction apparatus, fat, complete filter, pasteur chamberland, complete set 279 filter, berke fed 280 hot plate 281 hydrometer spirit 282 hydrometer milk 283 hydrometer wet dry bulb 284 height measuring stand 285 harpenders calipers ( for skin fold thikness ) 286 incubator 287 incubator digital 350x350x350 ( 14x14x14 ) watt. 288 improved neubers chamber 289 inoculation hood 290 improved neubers chamber 291 lovibond comparators 292 microtome manual 293 micrometer eye piece 294 micrometer stage 295 ph determination apparatus 296 ph meter 297 sahli haemoglobin meter 298 sealing machine for blood culture bottle 299 stop watch 300 slide tray 301 slide box 302 slide holding jars 303 salters baby weighing machine 304 still for distilled water 305 sterlizer electric 306 tissue cassette steel big 307 tissue cassette steel small 308 digital thermometers 309 tube sealer 310 tube streper & cutter mannual 311 throwing water bath 312 vdrl shaker 313 vortex machine 314 water bath 315 water bath serological 560c 316 slide tray allunimium 30cmx17cm 317 needle cutter 318 list of glasswares / miselleneous items 319 autopipette imported variable 320 autopipette imported fixed 321 autopipette stand 322 autopipette imported variable 323 animal diet for rabbit, mice, guinie pigs, rats 324 autopipette multiple dispenser 325 beaker 250cc 326 beaker 500cc 327 beaker 10ml. 328 beaker 25ml. 329 beaker 50ml. 330 beaker 100ml. 331 beaker 250ml. 332 beaker 500ml. 333 beaker 1 lit. 334 beaker 2 lit. 335 burette 25 cc 336 burette stop cok 25cc 337 blue litmus 338 blue litmus paper 339 cellulose acetate strip 150x25mm 340 capillary tube 341 capillary tube ( ctbt ) 342 capillary tube ( micro capillary ) 343 centrifuse tube 344 conical flask 50cc 345 conical flask 100cc 346 conical flask 250cc 347 conical flask 1000cc 348 conical flask 2500cc 349 conical flask 5000cc 350 conical flask 250ml. 351 conical flask 500ml. 352 cover slip round / square 22x22mm 353 cover slip round / squre 22x40mm 354 cover slip round / squre 22x50mm 355 cuplling jar 356 chittel forcep small 357 chittel forcep large 358 diamond pencil 359 disposable urine container 50ml. 360 durham’s tube 361 dreyers tube ( for widal test ) 362 dropping bottle 125ml. 363 dropping bottle 125 cc 364 dropping bottle 250 cc 365 esr ( wintrobe tube ) 366 esr tube 367 felix tube ( for widal test ) 368 filter paper 369 filter paper wattman 370 filter paper sheets 371 funnel large 372 funnel small 373 glass funnel 3” 374 glass funnel 6” 375 funnel 3cm. 376 funnel 5cm. 377 funnel 10cm. 378 funnel 15cm. 379 forceps big 380 forceps small 381 glass petridish 2 inch 382 glass petridish 3 inch 383 glass petridish 4 inch 384 glass rod for staining 385 glass slide 75x25mm 386 glass rod 2mm 387 glass rod 4mm 388 glass rod 6mm 389 glass jar 390 glass beaker 391 graduated pipette 1ml. 392 graduated pipette 2ml. 393 graduated pipette 5ml. 394 haemoglobin pipette 395 haemoglobin tube 396 haemoglobin tube ( round ) 397 hypo chloride 398 k2 vial 399 lancet 400 measuring cylinder 50ml. 401 measuring cylinder 100ml. 402 measuring cylinder 500ml. 403 measuring cylinder 1000ml. 404 micro centrifuge tube 405 micro tip big 406 micro tip small 407 multichannel pipette 408 meckentosh rubber sheets 409 match stick box 410 metal loop 411 micropipette 0 50 micro 412 micropipette 0 100 micro 413 micropipette 0 500 micro 414 micropipette 0 1000 micro 415 needle 416 paper roll 52 mm 417 pasteur pippet 418 pipette graduated 01ml. 419 pipette graduated 02ml. 420 pipette graduated 05ml. 421 pipette graduated 10ml. 422 pipette one marks 1ml. 423 pipette small 424 pipette tip small 425 pipette tip big 426 pipette volumetric 10cc 427 plastic reack 428 plastic test tube screw cap size 12mmx100mm 429 plastic test tube screw cap size 12mmx75mm 430 pricking needle 431 pipette volumetric 10cc 432 plasticin 433 ph paper roll ( p 2 10 ) 434 paediatric cup 5ml. 435 palne simple vial 436 reagent bottle 250cc 437 reagent bottle 500cc 438 reagent bottle large 439 reagent bottle small 440 red litmus 441 ria vial 442 serum tube 443 serum tube 15x150 444 serum test tube stand 445 sterilim hand wash 446 separating funnel 10ml. 447 separating funnel 25ml. 448 separating funnel 50ml. 449 separating funnel 100ml. 450 sterile tube with cotton stick 451 straight wire 452 scissors small 453 scissors big 454 savlon 455 scalpal 456 serum test tube stand 457 test tube 12 ml. 458 test tube 12x100mm 459 test tube 15x125 460 test tube 15x150mm 461 test tube 13mmx100mm 462 test tube large 20cc 463 test tube 4 inch 464 test tube 5 inch 465 test tube 6x0.5 466 test tube 6x3 large 467 test tube holder 468 test tube stand for 12x100ml. 469 tuberculin syringe 1ml. 470 tuberculin syringe 2ml. 471 tourniquet 472 test tube stand 473 testing needle 474 test tube rack 475 thermal rolls 476 uronometer tube 100ml. 477 uro stick 478 urostick complete test 479 urobilinogen test reagent 480 universal ph indicators strip 481 variable pipette 01 μl to 50 μl 482 variable pipette10 μl to 2000 μl 483 variable pipette 50μl to 5000 μl 484 volumatric flask 5ml. 485 volumatric flask 10ml. 486 volumatric flask 25ml. 487 volumatric flask 50ml. 488 volumatric flask 100ml. 489 volumatric flask 1000cc 490 volumatric flask 2000cc 491 widal round tube ¼ 492 widal conical tube ¼ 493 wooden rack 494 widal rack steel 495 whatman filter paper no 1 496 list of culture media 497 agar agar 498 bile esculin agar 499 beef extract 500 brain heart infusion agar 501 brain heart infusion broth 502 corn meal agar 503 deoxycholate citrate media 504 lab lamco 505 mack conkeys agar 506 muller hinton agar 507 motility sulphite media 508 manitol salt agar 509 mr reagent 510 nutrient agar 511 nutrient broth 512 oxidase reagent 513 peptone powder 514 potato dextrose agar 515 phenyl pyruvic acid media 516 simmons’s citrate media 517 sabourds dextrose agar 518 selenite f broth 519 triple sugar iron media 520 tcbs agar 521 tsi 522 urease agar base 523 wilson and blair 524 xld agar 525 clostridium difficile agar base 526 clostridium difficile supplement 527 gaspack ( le002a ) 528 robertson cooked meat media 529 cetrimide agar 530 reinforced clostridial hi veg. tm broth 531 soyabean casein digest broth 532 list of antibiotic disc 533 amikacin 534 amoxyclav 535 ampicillin 536 azithromycin 537 bacitracin 538 cefixime 539 cefoparaznoe / sabactum 540 cefoperazone 541 cefotaxime 542 cefotaxime+ clavulanate 543 cefpodoxine 544 ceftazidime 545 ceftazidime+clavulanate 546 ceftriaxone 547 cephalexin 548 ciprofloxacin 549 cifoxitin 550 cefepime 551 doxycyclin 552 erythromycin 553 gentamycin 554 imepenam 555 impenem edta disc 556 levofloxacin 557 meropanam 558 norfloxacin 559 novabiocin 560 nitrofurantoin 561 oxacillin 562 ofloxacin 563 piperac / tazobactum 564 piperacillin 565 polymyxin 566 ticarcillin clavlanic acid 567 vancomycin 568 list of items for biochemistry nmindray, backman coulter biosystem ba 400, electrolyte analyser 569 glucose 570 calcium 571 urea 572 creatinine 573 uric acid 574 sgot 575 sgpt 576 total bilirubin 577 direct bilirubin 578 total protein 579 albumin 580 alp 581 serum amylase 582 hdl cholestrol 583 cholestrol 584 triglycerides 585 washing solution 586 ise reagents 587 ise refrence 588 ise mid standard 589 ise buffer 590 ise na+ / k+ selectivity check 591 ise internal refrence 592 cleaning solution 593 ise high serum standard 594 ise low serum standard 595 system calibrator 596 control level 1 597 control level 2 598 electrolyte pack ( cbs 400 ) 599 sample cup 600 serum tube ( red cap ) 601 rotor 602 list of close system machine heamatolyser 3 part, 5 part cell counter make mindray, erma, hemax 330, meditech dm 5200 aspan chemilumenacense machine, coagulation machine, hplc, flow cycometer etc. & combosis ii, siemens abg 603 autodil plus hsn code 38220090 604 autolyse plus hsn code 38220090 605 autoclean plus hsn code 38220090 606 cleaning solution b hsn code 38220090 607 diluent 608 lyse 1 609 lyse 2 610 probe cleaner 611 m53 diluent 612 m 53 leo i 613 m 53 leo ii 614 m53 lh lyse 615 m 53 cleaner 616 sta neoplastine cl+5 ( pt ) 617 sta cepha screen 4 ( aptt ) 618 sta thrombin 2 ( tt test ) 619 sta lia test ( d dimer test ) 620 sta liquid fib ( fibrinogen test ) 621 sta liatest control n+p 622 sta coag.control n+p 623 sta cacl 20.00 25m 624 sta owren koller 625 sta desorb u 626 sta cleaning solution 627 sta satellite cuvettes 628 white stirring bar 629 bga 3 630 bga 4 631 cal 3 632 cal 4 633 wash 2 634 po2 membrane shell 635 pco2 membrane shell 636 k+ membrane shell 637 cl membrane shell 638 ca++ membrane shell 639 ref. membrane shell 640 protein remover 641 set tubing for roller 642 po2 sensor unit 643 pco2 sensor unit 644 cl conducting system 645 printer paper roll 646 ref.membrane shell 647 pco2 membrane shell 648 po 2 membrane shell 649 ca+ membrane shell 650 k+ membrane shell 651 refernece conducting system 652 ca+ conducting system 653 k+ conducting system 654 na conducting system 655 cell diluent 656 lyse 657 cleaner 658 probe cleaner 659 measurement cartidage & wash waste 660 printer paper 661 automatic quality control 662 80 a eluent 663 80 b eluent 664 80 ct eluent 665 80 h hemolysis washing solution 666 paper roll 667 d dimer 668 trop i 669 il 6 670 pct 671 ferritin 672 t3 673 t4 674 tsh 675 wash buffer 676 lcle 677 starter 1&2 678 reaction module 679 flowcycometer...

Directorate Of Health Services - Madhya Pradesh

28373201 supply of drugs and medicines and other equipment year 2021 22 2 desflurane 240 ml in aluminum container 3 5 fluorouracil (5 fu)(250mg),injection 4 5 fluorouracil (5 fu)(500mg inj),injection 5 acamprosate(333 mg),tablet 6 acarbose(25 mg),tablet 7 acarbose tab 50mg 8 aceborophylline 100 mg cap 9 aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab(10x10),tablet 10 aceclofenac 100mg+paracetamol 325mg tab( ),tablet 11 acenocoumarol tab i.p. 2 mg 12 actinomycin d(0.5mg vial),vial 13 acyclovir 5% ointment/cream(5gm ),ointment 14 adenosine inj 6 mg/ 2ml (2ml amp) 15 adrenochrome monosemicarbazone(0.75mg /ml (2 ml amp)),injection 16 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 45cm and should be both hand(foot activated with curved tip),consumable 17 aggs(anti gas gangrene serum) 10,000 iu/ml 18 aggs(anti gas gangrene serum)40000 iu/ml 19 biotene tablet 20 agomelatine 25 mg 21 albendazole 100 mg 22 alfacalcidiol capsule(0.25 mcg),capsule 23 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup 24 allopurinol 100 mg tab 25 aminoacid 10% (essential) ivf 26 aminoacid 5% ivf (100ml bottle) 27 aminoacid (essential) infusion(10% 100ml ffs bottle),bottle 28 amino acid glass bottle contain amino acid 6 gm, nitrogen 0.929, essential amino acid 51%, non essential amino acid 49%, bcca 22.6%, carbohydrate 5% inj 29 amino infusions 200ml bottle 30 aminophylline inj. 25 mg/ml 10 mg vial(25 mg/ml 10 mg vial),injection solution for 31 amiodarone tab 200mg(200mg),tablet 32 amisulpride(100 mg),tablet 33 amisulpride(200 mg),tablet 34 amisulpride(50 mg),tablet 35 amitriptyline tab. ip 25 mg 36 amlodipine 5mg+atenolol 50mg tab 37 amoxicillin 100 mg /ml 10 ml with dropper 38 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg 39 amoxicillin dispersible tab.usp 125 mg tablet 40 amoxycilline and clavulanic acid inj 41 amphotericin b inj ip(50 mg),injection 42 ampicilline + cloxacilline injection (250 mg + 250 mg) vial injection 5ml vial( ),injection 43 ampicilline + cloxacilline injection tablet((250 mg + 250 mg)),tablet 44 antacid syrup , 170 ml (dried alluminium hydroxide gel 200 mg, simethicon 25 mg / 5 ml, ) syrup 45 anti hemophilic factor ix complex coagulation factor ii,vii,ix,x concentrate(600 iu vial),injection 46 anti hemophilic factor viii inj. 500iu 47 antioxident capsule 48 anti rabies immunoglobulin inj.150 iu per 2 ml vial 49 aripiprazole(10 mg),tablet 50 aripiprazole 15 mg 51 aripiprazole 20 mg 52 aripiprazole 30 mg 53 artesunate tablets 50 mg + sulphadoxine 500 mg + pyrimethamine 25 mg tablets ip 54 ascorbic acid (vitamin c) tab i.p. 500mg 55 atomoxetine 10 mg 56 atomoxetine 25 mg 57 atorvastatin(5 mg),tablet 58 atracurium 10mg/ml inj 2.5ml vial 59 atropine + dexamethasone + chloramphenicol 1% + 0.1% + 0.5% 5 ml 60 azathioprine 50mg tab 61 azithromycin 1 gm, fluconazole 150 mg, secnidazole 1 gm tab tablet 62 azithromycin inj 100mg/5ml 63 aztreonam inj(500 mg),injection 64 azythromycin 1 gm + fluconazole 150 mg, + secnidazole 2 g, tablet c tablet 65 baclofen 20 mg 66 baclofen 30 mg 67 baclofen 40 mg 68 basal insulin glargin(100iu/ml (10ml vial)),injection 69 basal insulin glargine injection 300iu disposable pen 300iu with 4 needles per pen 31g needle( ),pens 70 basal insulin glargine penfill 300iu with free permanent pens one pen for each five cartridge and 10 needles per pen 71 b complex minerals with zinc cap 72 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate(0.025 % + 0.5 % + 2 % (5 gm tube)),ointment 73 benzathine penicillin 24 lac iu / vial vial 74 benzoic acid + salicylic acid(6% + 3% (15 gm tube)),ointment 75 benzoyl peroxide 0.025 20 gm 76 benzyl benzoate application i.p. 25%w/w (100ml bottle) 77 benzyl benzoate emulsion( ),emulsion 78 betamethasone sodium phosphate(ml contain betamethasone na phosphate equal to 4mg of betame (1ml amp)),injection 79 betamethasone valerate cream 0.05 %(0.05%),eye drops/ ointment 80 betamethasone valerate oint 0.1%(15 gm tube),ointment 81 betamethasone valerate oint/cream ip. 0.12% 82 bevacizumab(100 iu inj (4 ml vial)),injection 83 bicalutamide(50mg ),tablet 84 bismuth iodoform paraffin paste 200 gm jar 85 black disinfectant fluid (phenyl) as per schedule o grade iii 86 bleomycin 15 mg /vial vial 87 bleomycin 15 units / vial 88 blonanserin 2 mg 89 blonanserin 4 mg 90 blood cell counter key(key),consumable 91 bortezomib(2mg),injection 92 bortezomib(3.5mg vial),injection 93 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg/5ml syp(100 ml bottle),syrup 94 bupivacaine hydrochloride inj 0.25% (20 ml vial)(20 ml vial),injection 95 bupivacaine hydrochloride inj. 0.25mg (20 ml vial) 96 bupropion 150 mg 97 buspirone 10 mg 98 buspirone 5 mg 99 busulphan 2 mg 100 butorphanol tartrate 1mg /ml 1 ml 101 cabergoline 0.5 mg 4 tablets / strip 102 calcitriol 0.25 mcg 103 calcium acetate 667 mg 104 calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml(100 ml syrup),syrup 105 calcium carbonate + vitamin d3 + zinc(200 ml syrup),syrup 106 calcium chloride inj.( ),injection solution for 107 calcium citrate 500mg with vitamin d3 200mcg tablet 108 calcium gluconate 200ml syrup 109 calcium leucovorin 50 mg/vial inj 110 calcium phosphate(2 : 1 ratio (100 ml bottle)),syrup 111 calcium syp 100ml syrup (240mg/5 ml) 112 capecitabine 500 mg tab 113 capreomycin 1000 mg / vial injection(10 ml),vial 114 carbamazepine 100 mg / 5 ml 100 ml bottle 115 carbamazepine(200 mg),tablet 116 carbamazepine tab. 400mg 117 carbimazole(10 mg),tablet 118 carbondioxide gas in medium size cylinder(b type),miscellaneous 119 carbondioxide gas in small size cylinder(a type),miscellaneous 120 carboplatin(150mg 15 ml vial),injection 121 carboplatin(450mg 45ml multidose vial),injection 122 carboprost promithamin 250mcg/ml inj (1ml amp) 123 carboprost trome thamine inj usp 0.25mg/ml vial( ),injection solution for 124 carboxymethylcellulose(5 ml),eye drop 125 carboxymethylcellulose eye drop ip 1% w/v 10ml vial 126 carvedilol(3.125 mg),tablet 127 carvedilol 6.25 mg tab 128 cefazolin(1gm),injection 129 cefazolin inj 500mg vial 130 cefepime 1gm and tazobactam 125 mg inj(vial),injection solution for 131 cefepime(250 mg/vial),injection 132 cefepime 500mg/vial inj(500mg/vial),injection solution for 133 cefixime 100 mg / 5 ml 10 ml bottle 134 cefixime 50 mg/5ml, 30 ml, drop(30 ml),drop 135 cefixime(50 mg dt),tablet 136 cefixime + azithromycin 200 mg + 250 mg 137 cefixime syrup 50mg/5ml(30 ml bottle),syrup 138 cefoperazone 1000mg + sulbactam 1000mg inj(vial),injection 139 cefoperazone 1gm /vial vial 140 ceftazidime(250mg/vial),injection 141 ceftazidime inj(500mg/ vial),injection 142 ceftriaxone tab(250 mg),tablet 143 ceftriaxone+tazobactum 250mg+31.25mg inj(vial),injection solution for 144 cefuroxime 750mg powder for solution for injection(750mg),injection powder for 145 centchroman ip (30 mg),tablet 146 cetirizine syrup(5mg/5ml 30 ml bottle),syrup 147 cetrimide 15% w/v + chlorhexidine 1.5% w/v (1 liter bottle)( ),bottle 148 cetrimide + chlorhexidine (conc.) (15%+7.5%) (1 liter bottle)(15%+7.5%),liquid 149 cetrimide + choline salicylate 0.01% + 8% all w/v 10 gm tube 150 cetrimide + choline salicylate gel for oral ulcer 15ml tube 151 cetrimide cream bp(0.1% w/w),tube 152 charcoal activated (powder) 100 gm box/pouch 153 chlorambucil(2 mg),tablet 154 chloramphenicol 0.5%(5ml),eye drop 155 chloramphenicol 1% w/w 50 /pack 156 chloramphenicol 500 mg capsule 157 chloramphenicol eye ointment 1% 4 gram( ),tube 158 chlordiazepoxide 10 mg 159 chlordiazepoxide 20 mg 160 chlorhexidine gluconate solution 161 chloroquine phosphate inj. 64.5mg/ml 30ml vial( ),injection solution for 162 chloroquine phosphate syrup. 163 chlorpromazine hydrochloride 50 mg tab 164 chlorpromazine tab 50 mg 165 chlorthalidone 50 mg 166 cholecalciferol 60000 iu 167 choline salicylate + benzalkonium chloride 9% + 0.02% 10 gm 168 chymotrypsin and trypsin 100000 iu tab 169 ciprofloxacin inj 100 mg/50ml (100ml ffs bfs bottle) 170 ciprofloxacin + tinidazole(250 mg + 300 mg),tablet 171 cisplatin( 10 mg vial),injection 172 cisplatin 50 mg inj (50 ml vial) 173 clindamycin(150mg/ml (2 ml vial/amp)),injection 174 clobetasol 0.05% + gentamicin 0.1% cream 10 gm(10 gm tube),cream 175 clofazimine cap 50 mg capsule 176 clomiphene citrate 25 mg tab 177 clonazepam 0.5mg tab 178 clonidine 100 mcg tab 179 clopidogrel 75mg + aspirin 75mg tab 180 clotrimazole 1% 100 gm 181 clotrimazole 1% w/v 15 ml 182 clotrimazole 1%w/v +lignocaine 2%w/v(10ml),eye drop 183 clotrimazole 1%w/v +lignocaine 2%w/v ear drop 10ml vial bfs/ffs squeeze (10ml vial) 184 clotrimazole 1% w/w 30 gm 185 clotrimazole cream 1%(15 gm tube ),cream 186 clotrimazole vaginal 500 mg tab tablet 187 clotrimazole vaginal tablet i.p. 100mg (without applicator) 188 cloxacillin(125 mg / 5 ml 40 ml bottle),syrup 189 cloxacillin 250 mg / vial vial 190 cloxacillin cap(250 mg),capsule 191 cloxacillin capsules 500mg 192 cloxacillin sodium inj. 500mg 193 clozapine 25 mg 194 cold cough drop , 15 ml(phenyl ephrine 5 mg, chlorphenaramine 0.5 mg, paracetamol 125 mg/ 5 ml),consumable 195 colistinethate sodium inj bp(1 moillion iu),injection 196 compound sodium lactate injection ip (ringers lactate) 0.24 % w/v of lactic acid ( eq. to 0.32% w/v of sodium lactate), 0.6 % w/v sodium chloride, 0.04 % w/v potassium chloride and 0.027 % w/v calcium chloride (500 ml bottle)( ),solution 197 cream sumag( ),cream 198 crystalline penicillin 5 lakh iu / vial vial 199 curved blade having telescoping shaft(10cm 14cm with integrated hand activation control buttons),consumable 200 cyclobenzaprine 5 mg 201 cyclopentolate 1% w/v(5 ml),eye drop 202 cyclophosphamide(1000mg (vial/amp)),injection 203 cyclophosphamide 50 mg tab 204 cyclophosphamide inj(200 mg/vial),injection 205 cyclophosphamide inj 500mg/vial(each),injection solution for 206 cycloserine 250 mg 10 capsules 207 cyclosporine 25 mg 208 cyclosporine 50 mg 209 cyproheptadine hcl + tricholine citrate(2mg + 275 mg / 5 ml (200ml bottle)),syrup 210 cytra.bine 100 mg vial 211 dacarbazine(200 mg per vial),injection 212 dacarbazine inj. (dtic)(500 mg vial),injection 213 daunorubicin( 20 mg / vial),injection 214 daunorubicin 50 mg / vial vial 215 deferasirox dispersible tab. 400mg 216 desferioxamine inj 0.5g/vial 217 desferioxamine injection 500mg 218 des venlafaxine 100 mg 219 des venlafaxine(50 mg),tablet 220 dexamethasone sodium inj 4mg/2ml(2ml vial),injection 221 dexmedetomidine hydrochloride injection(100mg),injection 222 dexmedetomidine hydrochloride injection 1ml amp(1 ml amp),ampoule 223 dextran iv 40%(500ml ),injection 224 dextromethorphan hydrobromide syrup 13.5 mg/ 5ml (30 ml bottle) 225 dextrose 10% 500ml bfs bottle( ),injection solution for 226 dextrose(10% inj 500 ml ffs btl),injection 227 dextrose(25% 100 ml ffs bottle),injection 228 dextrose 25%(500ml ffs bottle),injection 229 dextrose 25% inj 100ml ffs/bfs bottle 230 dextrose 25% inj 500ml ffs/bfs bottle( ),injection solution for 231 dextrose 50 %, (25 ml) inj(50 %),injection 232 dextrose 50% inj 100ml ffs/bfs bottle 233 dextrose 5%(500ml ffs bottle),injection 234 dextrose with saline(5% + 0.9% (500ml ffs bottle)),injection 235 diacerein + glucosamine 50 mg + 750 mg 236 diazepam 10 mg tab. 237 diclofenac gel 1% 10gm tube 238 diclofenac + menthol(30gm),tube 239 diclofenac+paracetamol+chlorzoxazoe(50 mg + 325 mg + 250 mg),tablet 240 dicyclomine 20mg+paracetamol 325mg tab 241 dicyclomine drops 242 dicyclomine hydrochloride 20 mg tab 243 dicyclomine syrup 244 didanosine 250 mg 245 didanosine 400 mg 246 diethylcarbamazine 50 mg 247 digestive drop ( digestive enzyme and multivitamin with l lysine )( 15 ml),drop 248 diltiazem 5mg/1ml 5 ml 249 diltiazem tablet(60 mg),tablet 250 dimercaprol 50 mg / ml 2 ml amp 251 dinoprostone gel(0.5%),gel 252 diphenhydramine syrup 12.5mg/ml 253 diphtheria antitoxin 10000 iu (10ml vial) 254 diproex er tablet 500mg(500mg),tablet 255 disodium acid phosphate + sodium phosphate 10 gm + 8 gm /100 ml 100 ml 256 disodium hydrogen citrate 1.25gm/5ml 100 ml(100 ml),syrup 257 dispersible zinc tab 10mg 258 disulfiram 250 mg 259 divalproex sodium 250 mg 260 dobutamine 12.5 mg / ml 20 ml vial 261 dobutamine inj 50 mg / 5 ml 262 docetaxel(120mg vial),injection 263 docetaxel 20mg inj 264 docetaxel 80mg inj 265 domperidone(1 mg/ ml 10 ml with dropper),drop 266 domperidone +ranitidine 150mg tab 267 domperidone suspension 5mg/5ml 268 donepezil 10 mg 269 donepezil 5 mg 270 doxophylline 400 mg 271 doxorubicin inj 10mg 272 doxorubicin(lypholozed) 10 mg / vial 273 doxorubicin(lypholozed) 50 mg / vial 274 doxorubicin (lypholozed)(50mg vial),injection 275 doxycycline tab. 100mg( ),tablet 276 doxylamine succinate 10 mg 277 doxylamine succinate + pyridoxine(10mg+10mg),tablet 278 dpt with vvm 10 doses 279 drop iron 15ml 280 drotaverine 80 mg(10x10),tablet 281 duloxetine(20 mg),tablet 282 duloxetine 30 mg 283 duloxetine(40 mg),tablet 284 dydrogesterone 10 mg 285 each combipack red colour blister pack contains 3tab of artesunate 150mg and 2 tab of sulphadoxine pyrimethamine (500mg + 25mg)( age group 9 to 14 years),tablet 286 electrolyte m inj 500ml ffs bottle 287 elemental iron 50 mg /5 ml 150 ml bottle 288 elemental iron 50 mg /ml 15 ml with dropper 289 eltrombopag 25 mg 290 enalapril maleate inj. 1.25 mg per ml( ),injection 291 enalapril maleate tab 2.5mg 292 ephedrine 30 mg / ml 1 ml amp 293 epinephrine hydrochloride inj. 1 mg/ml( ),injection solution for 294 epirubicin(10mg vial),injection 295 epirubicin(50mg vial),injection 296 epirubicin inj 100mg/vial vial(each),injection 297 eplerenone 25 mg 298 equine anti rabies immunoglobulin inj. 299 erythromycin (as estolate)(125mg/5ml, 60ml blttle),suspension 300 erythromycin (as estolate) powder for susp(125 mg/5ml 40ml bottle),consumable 301 erythropoietin 10000iu inj 302 erythropoietin(4000 iu inj vial),injection 303 escitalopram + clonazepam 10 mg + 0.5 mg 304 esmolol 100 mg /vial vial 305 estradiol 10 mg /vial vial 306 estradiol 1 mg /gm 15 gm tube 307 estradiol cypionate + medroxy progesterone acetate 5 mg + 25 mg /0.5 ml 0.5 ml 308 ethacridine lactate 1 mg / ml 50 ml 309 ethamsylate 250mg tablet 310 ethamsylate inj(250mg (2ml amp)),injection 311 ethamsylate tab 500mg 312 ethinyl estradiol 0.01 mg 10 tablets 313 ethinyl estradiol 0.05 mg 10 tablets 314 ethinyl estriadiol+norethisterone tab(35 mcg +1mg),tablet 315 etophylline + theophylline sr tablet 231mg + 69mg( ),tablet 316 etoposide(100mg vial),injection 317 etoposide 50 mg 8 capsule 318 everolimus tab 10mg(4x7),tablet 319 fentanyl citrate inj 50 mcg/ml(2ml ampoule),ampoule 320 filgrastim 300mcg inj 321 filgrastim 300 mcg(prefilled syrings),vial 322 fluconazole 100 mg 323 fluconazole 200 mg 324 fluconazole 50 mg 325 fluconazole eye drop 3 mg / ml (10 ml vial)(3 mg),eye drop 326 flumazenil 0.1 mg / ml 5 ml multiple dose vial 327 flunarizine 10 mg 328 fluoxamine(50 mg),tablet 329 fluoxetine 40 mg 330 flupenthixol 20 mg/ml 1 ml 331 fluphenazine 2.5 mg 332 fluphenazine 25 mg / ml 1 ml amp 333 flurbiprofen sodium 0.03% 5 ml 334 formoterol + budesonide(6 mcg + 100 mcg/puff (120 mdi)),inhaler 335 frusemide 20 mg, spironolactone 50 mg, tab tablet 336 fusidic acid cream/sodium fusidic ointment 2% 5gm tube(5 gm),tube 337 gabapentine 100 mg 338 gefitinib tab 250mg 339 gemcitabine(1000mg vial),injection 340 gemcitabine(1.4 gm vial),injection 341 gemcitabine(200mg/vial),injection 342 gentamicin inj(40 mg/ml 2 ml amp),injection 343 gentamycin 40 mg /ml 10 ml vial(10 ml vial),injection 344 gentamycin + hydrocortisone 0.3% + 1% 5 ml vial 345 glibenclamide tab 2.5 mg 346 glimepiride + metformin hydrocloride sr tab 1 mg + 500 mg 347 glycerine + mag sulphate crystal 250 ml jar 348 glycerine + sodium chloride enema 15% + 15% 20 30 ml /pack 349 glycerine suppository usp 3 gm bottle /10 350 glycopyrrolate inj. 0.2 mg/ml (1 ml amp)(1 ml amp),injection solution for 351 granisetron 1 mg /ml 1 ml amp 352 griseofulvin tab. ip 125 mg 353 haemoccel, 500 ml inj (electrolight na, k, ca, cl) 354 haemocoagulase 1 iu /ml 10 ml 355 haemoglobin tube(tube),consumable 356 haemoglobi pippate(pippate),consumable 357 haloperidol 1.5 mg 358 hcg (human chorionic gonadotropin) inj 5000 iu vial 359 hemotocyto meter(meter),consumable 360 heparin 25000 iu 5 ml 361 hepatitis b immunoglobulin 100 iu/vial 362 hepatitis b immunoglobulin im inj 200 iu/vial 363 hepatitis b vaccine ( hep b) 10 doses 364 human albumin 20% (50 ml vial) 365 human chorionic gonadotropin 2000 iu / ml 1 ml amp 366 human chorionic gonadotropin inj 5000 iu 1ml amp 367 human insulin regular/soluble(100iu/ml (10ml vial)),injection 368 human insulin regular/soluble(40iu/ml (10ml vial)),injection 369 human normal immunoglobin(5gm/100ml),injection 370 hydrocortisone sodium succinate inj. 200mg vial( ),injection 371 hydroethylstarch 6% solution with sodium chloride 0.9% iv infusion (hydroxy ethylstarch solution ffs/bfs)(0.9% iv),bottle 372 hydroxyethylstarch 3%(500 ml),injection 373 hydroxyethyl starch 6%(each),suspension 374 hydroxyprogesterone caproate inj i.p. 250mg/ml 375 hydroxypropyle methyle cellulose opthalmic solution 2% 2ml pfs 376 hydroxypropyl methylcellulose eye drops(2% 5 ml vial),eye drop 377 hydroxy urea(500mg),capsule 378 hyoscine butylbromide inj. 20mg/ml 379 ibandronic acid inj(6mg),injection 380 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup(60 ml bottle),syrup 381 ibuprofen 10mg+paracetamol 125mg syrup 382 icthyol glycerine 1% 30 ml 383 id wrist band(identification for mother/child specific colour)(wrist band/no),consumable 384 ifosphamide 1gm lyophilised each vial + 3amp of mesna 100mg/2ml inj 385 ifosphamide + mesna(1gm),injection 386 imatinib 100 mg cap 387 imatinib cap/tab(100 mg),tablet 388 imatinib mesylate 400 mg 389 imipenem 250mg+cilastatin 250mg powder for solution(1 each),injection powder for 390 imipramine 25 mg 391 inj.iv dns( ),injection 392 insulin aspart in disposable pen 300iu with minimum 4 needles per pen 31g needle 393 insulin aspart penfill 300 iu with free permanent pen (one pen per five cartridges and ten needles per pen) 394 insulin biphasic lispro 25:75 100 iu/ml (3 ml cartridge)(firm has to supply compatible pen along with cartridges as and when required without any extra cost),cartridges 395 insulin biphasic/premix 50:50(100 iu/ml (10 ml vial)),injection 396 insulin biphasic/premix 50:50(40 iu/ml (10 ml vial)),injection 397 insulin human mixtard inj. 30:70( ),injection solution for 398 insulin intermediate inj 399 insulin lispro in disposable pen 300iu with minimum 4 needles per pen 31g needle 300iu(prefilled syringe),pens 400 insulin soluble inj. 40 iu/ml 401 insulin syringe(each),consumable 402 intraocular irrigating solution sodium chloride 0.49 % w/v, potassium chloride 0.075 % w/v, calcium chloride 0.048 %, magnesium chloride 0.03 % w/v, sodium acetate 0.39 % w/v, sodium citrate 0.17 % w/v. 500 ml ffs 403 intravenous fat emulsion 20% w/v(20% w/v),bottle 404 intravenous immuglobin (ivig)(each),injection 405 ipratropium bromide + levosalbutamol(20mcg+50mcg, 200 mdi),inhaler 406 ipratropium bromide powder for inhalation 250mcg/ml 407 irinotecan 100 mg inj (1 ml amp) 408 irinotecan(40mg/vial),injection 409 irinotecan hydrochloride(100 mg),injection 410 iron and folic acid entric coated tab dessicated ip 67mg equivalent to 20mg of elmental iron 411 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip (pink colored tab) wifs junior ifa tablets (detail specification as per tender)( ),tablet 412 iron dextran 50 mg / ml(2 ml amp),injection 413 iron ferrous sulphate folic acid 100ml(each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg),syrup 414 iron sucrose 20mg(20 mg),injection 415 iron syrup 200 ml (elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg/ 5 ml) 416 isoflurane(250 ml amber color bottle),inhalation 417 isoflurane solution (liquid for inhalation) 100ml (amber color bottle) 418 isoprenaline 2 mg /ml 1 ml 419 isoxsuprine hydrochloride inj. 5mg/ml (2 ml amp)(2 ml),injection solution for 420 isoxsuprine tablets i.p. 20 mg tablet 421 itraconazole cap(100 mg),capsule 422 ketamine hydrochloride inj(50mg/ml (10 ml vial)),injection 423 ketamine hydrochloride inj. 50mg/ml (2 ml amp) 424 ketoconazole tab 200mg( ),tablet 425 labetalol 20 mg / 4 ml inj (4 ml) 426 lactobacillus 150 million spores 1 sachet 427 lactulose solution 3.35gm/5 ml 428 lactulose syrup(10gm/15ml),syrup 429 lamotrigine dt(50 mg),tablet 430 lamotrigine dt tab(100 mg),tablet 431 l asparaginase 5000 iu lyophilised(vial),injection 432 letrozole(2.5 mg),tablet 433 leuprolide depot inj(3.75mg),injection 434 levamisole 50 mg 435 levodopa + carbidopa 200 mg + 50 mg 436 levodopa +carbidopa tab 250mg + 25mg 437 levofloxacin 500 mg(100 ml ffs bottle),injection 438 levonorgestrel emergency contraceptive(0.75mg),tablet 439 lidocaine 2% inj. 30 ml vial( ),injection solution for 440 lignocaine hydrochloride topical solution usp 441 linazolid(300ml),injection 442 linezolid 200mg/100ml(100ml ffs bottle),injection 443 linezolid tab(600 mg),tablet 444 lithium carbonate 300 mg 445 lomustine 40mg cap 446 lorazepam 1 mg 447 l ornithine +l aspartate 5mg inj 448 losartan tab 25 mg(10x10),tablet 449 magnesium hdroxide+aluminium hydroxide (625mg+312mg/5ml) 450 magnesium suplhate inj 50 % w/v (2ml amp) 451 magnesium suplhate injection i.p.50 % w/v 10ml amp 452 mannitol(20% 100 ml ffs bottle),injection 453 mannitol inj,10% 100 ml bottle 454 mannitol inj. 20% 350ml ffs bottle 455 mebendazole 100 mg tab 456 medroxy progesterone acetate 10 mg 457 medroxy progesterone acetate(150mg/ml 1 ml amp),injection 458 mefenamic acid + dicyclomine tab(250 mg + 10 mg),tablet 459 mefenamic acid + drotaverine hcl 250 mg + 80 mg 460 mefloquine 250mg tab 461 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg, pyridoxine hcl 3 mg cap capsule 462 memantine(10 mg),tablet 463 menadione usp (vitamin k3)(10 mg/ml (1 ml amp)),injection 464 mephentermine inj 15mg/ml 10ml vial 465 mesalamine (5 aminosalicylic acid) usp 800 mg 466 metformin 500mg + gliclazide 80mg tablet(10x10),tablet 467 methocarbamol 100 mg /ml 10 ml 468 methotrexate(10 mg),tablet 469 methotrexate 2.5 mg tab 470 methotrexate 5 mg 471 methotrexate(7.5 mg),tablet 472 methotrexate inj 15mg/ml (vial) 473 methotrexate inj 500mg vial 474 methotrexate inj 50mg (2ml) 475 methylcobalamine (vitamin b12) 500 mcg /ml 3 ml 476 methyl prednisolone(500mg),injection 477 methyl prednisolone sodium succinate inj.1000mg vial 478 methyl prednisolone sodium succinate inj. usp 125mg(10ml),vial 479 metoprolol + amlodipin 25 mg + 2.5 mg 480 metoprolol + ramipril 25 mg + 2.5 mg 481 metronidazole 0.01 15 gm cream 482 micronised progesterone(100 mg),tablet 483 micronised progesterone 400 mg 484 micronised progestrone(200 mg),tablet 485 micronised progestrone 50 mg /ml 4 ml amp 486 micronised progestron inj. 200mg/ml 487 midazolam inj. 1mg/ml 5ml amp 488 misoprostol 100 mcg 4 tables / pack 489 misoprostol 400 mcg 4 tablets / strip 490 modafinil 100 mg 491 mometasone 0.10% 15gm 492 morphine sulphate inj. ip 10mg/ml(1ml ampoule),injection solution for 493 moxifloxacin(100ml),injection 494 moxifloxacine eye drop 0.5%w/v 495 multivitamin 10ml amp inj 496 multivitamine 200ml syrup 497 multivitamin syrup 60 ml (each 5ml contains vitamin a (palmitate) ip 1600 iu+vitamin d3 ip 200 iu(+vitamin b2 ip 1.00mg+vitamin b6 ip 0.50mg+niacinamide ip 15.00mg+d panthenol ip 1.00mg),syrup 498 multivitamin without iron syrup(100ml),syrup 499 multivitamin with protein 200 ml(200 ml),syrup 500 multivitamin with zinc drop 15ml(15 ml),drop 501 n acetyl cysteine inj 200mg/ml in 1ml amp 502 naltrexone(50 mg),tablet 503 neomycin+bacitricin ointment 5mg+500 iu/g 504 azothioprine 50 mg 505 azothioprine 75 mg 506 azothioprine 100 mg 507 neostigmine 30mg 508 neostigmine 60 mg 509 netilmycin 25 mg /ml 1 ml vial 510 nicorandil 5 mg 10 x 10 511 nilotinib 150mg tab 512 nilotinib 200mg tab 513 nimesulide 100 mg tab 514 nimesulide +paracetamol 100 + 325 mg,tablet 515 nimesulide +paracetamol+serratiopetidase 100 + 325 + 10 mg 516 nitrofruantoin tablet ip 100mg 517 noraderanaline inj. 2 mg base/2 ml amp 518 norethisterone enanthate 200 mg/ml 1 ml 519 norethisterone tablets 5mg 520 norfloxacin 200 mg 521 norfloxacin + metronidazole suspension 100mg+100mg/5ml(30 ml bottle),bottle 522 norfloxacin + tinidazole((100 mg + 100 mg) 30ml syrup),syrup 523 norfloxacin + tinidazole 400mg tab 524 norfloxacin +tinidazole 400mg tab 525 normal saline injection 0.9% (500ml ffs bottle) 526 nortriptyline 10 mg 527 n s 3% hypotonic(100ml),injection 528 octreotide lar 30mg injection 529 ofloxacin 200mg +tinidazole 600mg tab 530 ofloxacin + dexamethasone 10 ml eye drop(10 ml),drop 531 ofloxacin inj 2mg/1ml 100ml 532 ofloxacin+ metronidazole(30ml),syrup 533 ofloxacin + ornidazole (50 mg + 125 mg) / 5ml 30 ml bottle(30 ml),suspension 534 ofloxacin suspension 535 ofloxacin suspension 50mg/5 ml 30 ml bottle 536 olanzapine 10 mg/vial vial 537 olanzapine 20mg tab 538 olanzapine 2.5 mg 539 olanzapine 7.5 mg 540 olopatadine hydrochloride ophthalmic solution usp 01% w/v 5ml( ),eye drop 541 omeprazole 10 mg 542 omeprazole capsule(40 mg),capsule 543 omeprazole + domperidone 20 mg + 10 mg(capsule),capsule 544 ondansetron 2 mg 545 ondansetron 8mg inj 546 ondansetron(drops) syrup(2mg/5ml (10 ml bottle)),syrup 547 ondansetron syrup 2mg/ml 548 ornidazole tab(500 mg),tablet 549 oxaliplatin(100mg),injection 550 oxaliplatin(50mg inj 25 ml vial),injection 551 oxcarbazepine 150 mg 552 oxcarbazepine(300 mg),tablet 553 oxcarbazepine(600 mg),tablet 554 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures(size 4x 4approved by us fda),consumable 555 oxytocin(5 iu/ml (2ml amp)),injection 556 oxytocin inj. 10 iu/ml 557 paclitaxel 260mg inj 43.4ml vial 558 paclitaxel 260mg inj( ),injection 559 paclitaxel 300mg inj 560 paclitaxel 30mg inj 561 paclitaxel inj 100mg 16.7 ml vial 562 paclitaxel nanoparticle/protein bound particles inj.(100mg vial),vial 563 paliperidone 1.5 mg 564 paliperidone 3 mg 565 pancuronium 2 mg / ml 2 ml amp 566 paracetamol 100 mg/ml, 150 ml drop(150 ml),consumable 567 paracetamol 150 mg/ml(15 ml bottle with dropper),drop 568 paracetamol + chlorphenaramine+ phenylephrine 250 mg + 2.5 mg + 10 mg 569 paracetamol drop 100 mg/ml 570 paracetamol drop 10mg/ml 571 paracetamol + phenylephrine + chlorpheniramine maleate (125mg+2.5 mg+1mg) /ml(15 ml bottle with dropper),drop 572 paroxetine cr 12.5 mg 573 paroxetine cr 25 mg 574 pemetrexed(100 mg vial),injection 575 pemetrexed(500mg),injection 576 penicillin v 125 mg 577 penicillin v 250 mg 578 pentoprazole 40mg, domperidone 10mg tab tablet 579 pentoprozole 40mg +domperidone 10mg tab 580 permethrin cream 5%(30 mg),cream 581 petrollium jelly ip 500 gm 582 phenobarbitine 20 mg/ml, 60 ml, syp syrup 583 phenobarbitone(200 mg/ml),injection 584 phenobarbitone syp 200mg/5ml( ),syrup 585 phenylepherine hcl & tropicamide 5% + 1% 5 ml 586 phenytoin sodium 250 mg/ 5 ml inj (5ml vial) 587 phenytoin sodium inj. 100 mg( ),vial 588 pilocarpine hydrochloride eye drops bp 2% 589 pilocarpine nitrate inj. ip 0.5 % w/v(1 ml),injection 590 piogliatazone tab. 15mg 591 piogliatazone tab. 30 mg 592 piperacillin + tazobactam 2000 mg + 250 mg 20ml vial( ),injection 593 piracetam 200 mg /15 ml 15 ml 594 piroxicam capsules 20 mg 595 pistol grip curved coagulating shears with ergonomic handle in the following shaft lengths 23 cm. can seal blood vessels upto and including(5mm in diameter),consumable 596 pistol grip curved coagulating shears with ergonomic handle shaft lengths 45 cm. can seal blood vessels upto and including(5mm in diameter),consumable 597 pneumococcal (polysaccharide) vaccine 23 valent/0.5ml inj 598 potassium chloride inj. 150 mg/ 10ml 599 potassium chloride oral solution 100mg/ml 600 povidone iodine cream 250 gm 601 povidone iodine ointment 5% 250gm jar 602 povidone iodine vaginal pessary 200 mg 603 pralidoxime chloride injection i.p.(pam) 1gm(20 ml amp),injection 604 prazosin tab 5 mg 605 prednisolone 10 mg tab 606 prednisolone(5mg),tablet 607 prednisolone eye drops(10 mg/ml (5 ml)),eye drop 608 prednisolone tab 20 mg 609 pregabalin + methylcobalamin 75 mg + 750 mcg 610 premixed insulin biphasic analogue 25/75 in penfill 300iu permanent pen one pen per five cartidges and ten needles per pen 611 premixed insulin biphasic analogue 30/70 in penfill 300iu permanent pens one pen per five cartridges and ten needles per pen 612 procaine penicillin 4 lac iu / vial vial 613 procyclidine 5 mg 614 promethazine inj 25 mg/ml (10 ml vail) 615 promethazine syrup. 5 mg/5ml(60 ml),syrup 616 promethazine tab 25 mg 617 proparacaine 0.50% 5 ml /vial 618 propofol 1%(10ml/5ml 20ml),injection 619 propofol sodium(1% w/v 10mg/ml, 10ml vial),injection 620 propranolol tr 20 mg 621 prostaglandin e2 gel 0.5mg ( 3gm tube) 622 protamine sulphate inj 10mg/ml 623 providone iodine 1% 1% 5 ml 624 pyrazinamide 750mg tablet(10x10),tablet 625 pyridostigmine 60 mg 626 quetiapine 200 mg 627 quinine dihydrochloride 150 mg /ml 2 ml amp 628 quinine dihydrochloride(300mg/ml (2ml amp)),injection 629 quinine sulphate(ip 600mg),tablet 630 rabeprazole 10 mg 631 rabies vaccine ip human (purified chick embryo cell culture)( ),vaccine 632 rabies vaccine ip inj human (chick embryo/vero cell culture) intra muscular( ),injection solution for 633 ranibizumab inj (10ml/mg),injection 634 ranitidine 15 mg /ml 100 ml bottle 635 recombiant factor vii 1mg 636 recombiant factor vii 2mg 637 recombinant anti hemophilic factor viii(1000 iu inj / vial),injection 638 recombinant anti hemophilic factor viii(250 iu inj / vial),injection 639 rh erythropoetin 2000 i.u pfs 640 ribavirin 200 mg cap( ),capsule 641 rituximab 100mg inj 642 rituximab 500mg inj 643 rosuvastatin. 10 mg 644 roxithromycin 150mg tablet 645 roxithromycin 300 mg 646 roxithromycin 50 mg / 5 ml 30 ml bottle 647 s adenosyl l methionine 400 mg 648 salbutamol sulphate(2 mg),tablet 649 salicylic acid 0.02 30 gm 650 salicylic acid ointment 6% 651 salmeterol 25 mcg + fluticasone 125 mcg inhaler (120mdi) 652 salmeterol 25 mcg + fluticasone 250 mcg inhaler (120mdi)(250 mcg),inhaler 653 secnidazole(500 mg tab),tablet 654 sevoflurane usp inhalation anesthetic 250 ml(250 ml),bottle 655 sics blade sideport(sideport entry knife),consumable 656 sildenafil 50 mg tab 657 silver nitrate 500 ml each 658 silver sulphadiazine cream usp 1%(500 gm jar),cream 659 sitagliptin(100 mg),tablet 660 sitagliptin(50 mg),tablet 661 sodium chloride 0.3% iv 100ml(1 each),injection 662 sodium chloride 0.45% + dextrose 5%(500 ml ffs bottle),injection 663 sodium chloride 1/2 normal, hyper tonic and dextrose 5% inj 664 sodium chloride inj iv 0.9% 500ml (glass bottle)( ),injection solution for 665 sodium chloride (ophthalmic) 5% 10 ml 666 sodium citrate 3.8% 500 ml 667 sodium hypochlorite 0.03 5 ltr 668 sodium thiopentone(500mg),injection powder for 669 sodium thiopentone inj. 0.5 gm powder/vial (20ml vial) 670 sodium valproate(200mg),tablet 671 sodium valproate 500 mg 672 inj metheline blue 673 soluble insulin 30% isophane insulin 70% 100 iu inj 674 sorafenib(200mg),tablet 675 stainic rack(each),consumable 676 sulphadoxine 500mg and pyrimethamine 25mg tab. 677 surfactant bovine(135 mg phopholipid per 5 ml) 5ml vial( ),vial 678 surfactant suspension (for intratrcaheal) natural surfactant inj 25 mg/ml 679 surfactant suspension (intratrcaheal) bovine 4ml amp natural inj( ),ampoule 680 swine flu vaccine 681 syp. alkaline citrate with k oral solution 100ml syrup 682 syp. cetirizine 5mg/5ml 30ml syrup 683 syp. ferric ammonium citrate 200mg +folic acid 0.5mg+vitamin b 125mcg+zinc 5ml syrup 684 syphalis card igg+igm s/s above 99.5 % syrup 685 syrup 100ml bottle. (5ml 100mg elemental fe iron & folic acid syrup(as per the standards provided)( ),syrup 686 syrup 50ml bottle (each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup ( as per the standards provided) with dropper)) 687 syrup cefpodoxime 50 mg 688 tadalafil 10 mg 689 tamoxifen(10 mg),tablet 690 tamoxifen(20mg),tablet 691 tamsulosin(0.4mg),tablet 692 tamsulosin 4mg tab 693 tamsulosin + dutasteride 0.4 mg + 0.5 mg 694 telmisatran 20 mg 695 temozolomide(100mg),capsule 696 temozolomide 250mg cap 697 terbutaline suplhate inj 698 terbutaline suplhate tab. 2.5mg 699 terlipressine inj. 1mg/10ml vial(1 each),injection 700 testcha(23),ampoule 701 tetracycline eye oint 1% 702 tetracycline eye ointment 1% 5 gm 703 thalidomide 100 mg 704 thiocholchecocide 4 mg 705 thiocholchecocide 8 mg 706 thiopentone injection 1gm 707 thyroxine sodium 25 mcg 100 per bottle 708 thyroxine sodium tab 50mcg(100 tab bottle) 709 tianeptin 12.5 mg 710 tinidazole tab 300 mg 711 topiramate 100 mg 712 topiramate 25 mg 713 topiramate 50 mg 714 torasemide(10mg),tablet 715 torasemide 20 mg / 2 ml vial 716 torasemide inj 100mg/2ml( ),injection 717 torasemide tab 20mg 718 total parenteral nutrition(including carbohydrate + proteins + fats solution 2000 ml),infusion 719 tpn(total parenteral nutrition) including carbohydrate + proteins + fats solution (brand: oliclinomel n7 2000 ml) 720 tranexamic acid injection bp/ip(100mg/ml (5ml amp)),injection 721 trastuzumab 440mg inj. 722 trastuzumav inj(440mg),injection 723 triamcinolone acetate 40mg/ml 724 tricholine citrate + sorbitol(550 mg + 7.15 g/10 ml (100 ml bottle) syrup),syrup 725 trifluoperazine 5 mg 726 trifluoperazine + trihexyphenidyle 5 mg + 2 mg 727 tri iodothyronine(t3),consumable 728 tropicamide eye drops 1% 5ml vial 729 trypan blue dye(1ml),consumable 730 tt with vvm 10 doses 731 tuberculin diluted ppd 5 tu/0.1 ml, 5 ml 732 ultravist 300mg(50 ml/vial),injection 733 urograffin 76% solution for injection 20ml vial 734 urograffin 76% solution for injection 50ml vial bottle 735 ursodeoxy cholic acid 150 mg tab 736 ursodeoxy cholic acid 300 mg tab 737 vancomycin hydrochloride(1000mg vial),injection 738 vancomycin hydrochloride(250mg vial),injection 739 vecuronium bromide inj 2mg/ml (2ml amp) 740 vecuronium bromide inj 4mg/ml amp 741 venlafaxine(150 mg),tablet capsule 742 venlafaxine 75 mg(cap),capsule 743 venlafaxine er/pr(37.5 mg),tablet capsule 744 ventilator adult model new port e 360 745 verapamil sugar coated tab ip 40mg 746 verapamil tab 80 mg 747 vildagliptin + metformin(50mg + 500mg),tablet 748 vinblastine 10mg inj. 749 vincristine sulphate(1mg/ml (cytocristin inj) 1 ml vial),injection 750 vitamin a (soft gelatin cap) 50000 i.u 751 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab( ),tablet 752 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg(folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more),tablet 753 vitamin b12 500 mcg /ml 10 ml vial 754 vitamin b12 inj 500 mcg/ml (30 ml amp) 755 vitamin b1 (thiamine) 100 mg 756 vitamin b1 (thiamine) 75 mg 757 vitamin b complex nfi formula(100ml bottle),syrup 758 vitamin b complex nfi formula(200ml bottle),syrup 759 vitamin b complex syp 200 ml 760 vitamin c tab 500 mg tablet 761 vitamin d3 drop 10ml (cholecalciferol 400 iu)(10 ml),drop 762 vitamin d3 granules(60000 iu sachet),powder 763 vitamin e 200 mg 764 vitamin k inj. 10 mg/ml 765 vitamin k inj (phytonadione inj)1mg/0.5ml( ),injection solution for 766 voglibose(0.3mg tab),tablet 767 voglibose dispersible 0.3mg tab 768 warfarin sodium 5 mg(5 mg),tablet 769 zinc sulphate 10 mg elemental zinc / 5 ml 100 ml bottle 770 zinc sulphate 10 mg elemental zinc / 5 ml 200 ml bottle 771 zoledronic acid(4mg vial),injection 772 zolpidem 10 mg 773 zonisamide 100 mg 774 zonisamide 50 mg 775 prostaglandin e2(dinoprostone gel) 0.5 mg pfs 776 alkaline citrate with pottsium 777 amlodipine 5 mg 778 calcium citrate 1000mg (elemental ca equivalent to 250 mg and vitamin d3 400 iu) 779 calcium with vitamin d tablets calcium carbonate 650mg eq. to elemental calcium 250mg and cholecalciferol 125 iu 780 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental calcium 500mg and cholecalciferol ip 250 iu 781 ceftazidime 1gm/vial inj(1 gm/vial),injection solution for 782 ceftriaxone inj 500mg vial 783 ceftriaxone+tazobactum(1gm+125mg,vial),injection 784 dextrose 5% inj 500ml ffs/bfs bottle( ),bottle 785 dextrose with saline 5% + 0.9% inj 500ml ffs/bfs bottle 786 diclofenac sodium + paracetamol +serratiopeptidase 50 mg +325 mg + 10 mg 787 dispersible zinc(20mg),tablet 788 enoxaparin (20mg/0.2ml)(0.2 ml prefilled syringe ),injection 789 enoxaparin sodium 40mg (20mg/0.2ml) prefilled syringe inj( ),syrings 790 meropenem(1000 mg (vial)),injection 791 nicotine 14 mg 792 nicotine 2 mg 793 nicotine 4 mg 794 nicotine transdermal patch 21 mg 795 nicotine transdermal patch 7 mg 796 norfloxacine 400mg and tinidazole 600mg tablet 797 ofloxacin tab 200mg 798 pantaprazole 40mg tab 799 paraffin liquid (liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml) syrup 800 pentaprazole inj. 40mg 10ml vial( ),injection solution for 801 piperacillin + tezobactin(4.5 g),injection 802 povidone iodine solution 5%(500 ml),bottle 803 providone iodine + metronidazole 5 % + 1 % 15 gm tube 804 rabies vaccine ip human cell culture 2.5 iu/dose (intra muscular use) 805 snake venom anti serum ip liquid form( ),injection 806 sodium chloride 0.9% injection ip 100ml bottle( ),injection powder for 807 syp. antacid mint flavour 170ml syrup 808 inj .paracetamol amp. 809 inj. cefotaxime 1 gram 810 inj. cefotaxime 250 m,g 811 inj. ceftazidime 1 gram 812 inj. diltizam30 mg 813 inj. tetanus toxoid 5ml vial 814 tab misoprostrol 200 mcg 815 a v fistula sterilized twin needle(17 g (two needle pack)),consumable [700786] 816 a.v. blood line (post haemodialysis tubing) [700428] 817 adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm to 15cm (curved)),consumable [700824] 818 adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm to 15cm (straight)),consumable [700823] 819 a v blood lines with av pressure transducer(acceptable for fitting to all standard dialyzers ) with side tubing (for heparinization and av pressure monitoring) ce and iso certificate essential with protector for all machines types and dialysers(medical grade pvc like of fresenius bain (dora), dialife ,nipro, b raun browndone,biolight or equivalent post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality),consumable [700787] 820 dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)(d) cotton gauze pieces 1,e) artery forceps 1 no (disposable) (mfg by precious life care pvt ltd)),consumable [700770] 821 fistula sterilized twin needle(16 g (two needle pack)),consumable [700785] 822 hemodialysis fluid for bicarb made(part a 10 ltr +part b 500gm 2/pkt),consumable [700254] 823 hemodialysis fluid for bicarb made(part a powder to make 10 ltr + part b 500gm 2/pkt),consumable [700822] 824 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid(5 ltr can),consumable [700820] 825 sterilant hot disinfectant for dialysis containing 21% (approx) citric acid, malic acid, lactic acid(5 ltr can),consumable [700821] 826 1.3/1.4 dora dialiser fluid 827 almirrah godrej type 828 artery forceps 829 attendent bed 2*6 830 attendent stool 831 autoclave 16*24 electric (s.s.) 832 autoclove (large) 12*20 833 autoclove (medium) 12*15 834 autoclove gasket small 835 autoclove gasket larg 836 autoclove gasket medium 837 autoclove indicator roll 838 b.p.apparatus digital 839 b.p.apparatus stand model 840 b.p.cuff adult 841 b.p.cuff infant 842 b.p.cuff paediatric/child 843 baby weighing machine digital 3 digit 844 bacilocid 845 back out solution 5 lit. 846 balance with agitator 847 bed side locker deluxe (steel) top epoxy powder coated 848 bed side screen 4 panel 849 bed side screen 3 fold 850 bio waste bucket 10 lit. 851 bio waste bucket 25 lit. 852 bio waste bucket 50 lit. 853 benzoin powder (for lab use) 854 1/2 ccs cut needle 48 mm stainless steel length 45 cm size 4 855 1/2 ccs cut needle 48 mm stainless steel length 45 cm size 5 856 1/2 ccs cut needle 48 mm stainless steel length 45 cm size 6 857 1.3/1.4 adult dialyzer (dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone) 858 1.5/1.6 adult dialyzer (dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone) 859 1.5/1.6 dialyzers multiple use made of polysulphone or polyethersulfone low/middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps(for dialysate inlet utlet for safer storage openable caps(red and blue)hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce/iso13485:2003sterlised),consumable 860 1%w/v available iodine in a non oxynol with soluble iodine suractant base with sodium iodide(< 1% w/v and surfactant < 5% w/v 500 ml),consumable 861 5 0 da polyglactin 910 coated with polyglactin 910 and calcium state mono with 1/4 circle spatulated needle (12 foils/pkt) 862 5mm lap dissecting hook(32 cm long),consumable 863 abdominal belt(32 inch each),consumable 864 abdominal belt(34 inch each),consumable 865 abdominal belt(36 inch each),consumable 866 abdominal belt(38 inch each),consumable 867 abdominal drain set 28 no 868 abdominal drain set 32 no 869 absolute alcohol (ethanol)(1x500 ml = 500 ml),consumable 870 acd a solution 500ml, model : pb 1ac500j8b(packing size : 2 bags/foil or 12 foils/box),consumable 871 acetone solution(100 ml bottle),consumable 872 adult double lumen catheter set 11.5 f 12 fr, 13cm (curved), kit 873 adult double lumen catheter set 11.5 f 12 fr, 13cm (straight), set 874 adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm (curved)),consumable 875 adult double lumen catheter set(size: 11.5 fr 12 fr,14cm (curved)),consumable 876 adult double lumen catheter set(size: 11.5 fr 12 fr, 15cm to (straight)),consumable 877 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand(foot activated),consumable 878 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand(foot activated with curved tip),consumable 879 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 14cm and should be both hand and( foot activated),consumable 880 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 25cm and should be both hand and(foot activated),consumable 881 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 35cm and should be both hand and(foot activated),consumable 882 advanced rf energy hand instruments of 12mm shaft diameter for open procedures with shaft lengths(22cm and should be both hand & foot activated),consumable 883 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths (35cm and should be both hand & foot activated with curved tip),consumable 884 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths(45cm and should be both hand & foot activated),consumable 885 advanced rf energy hand instruments of 5mm shaft diameter for open procedures with shaft(lengths 14cm and should be both hand & foot activated with curved tip),consumable 886 advanced rf energy hand instruments of(5mm shaft diameter for open procedures with shaft lengths 25cm and should be both hand & foot activated with curved tip),consumable 887 alkaline phosphate kit (autospan) 888 alkaline phosphate kit (erba) 889 alphacypermetherin 5% wdp(as per attached specifications in rc (confirming to is 15603 standards to be supplied in in 25kg or 20kg pack . 1 metric ton)),consumable 890 alt/gpt 600 ml(model ba 400 system (mfg bybio system)),consumable 891 aluminium potassim sulphate (each),consumable 892 ambu bag / adult each 1700ml, with oxygen connecting tube ,should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories,(should have silicon rubber bellow to withstand autoclave at 134 deg.c),consumable 893 ambu bag / resuscitator silicon 200 250 ml infant size each, with oxygen connecting tube ,should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories,(should have silicon rubber bellow to withstand autoclave at 134 deg.c),consumable 894 ambu bag (silicon type) paediatrics each 1400 1700 ml with oxygen connecting tube ,should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories,(should have silicon rubber bellow to withstand autoclave at 134 deg.c),consumable 895 ammonium sulphate (analar (gr/ar) (1x500 gm = 500gm),consumable 896 amunation boot, per pair as per measurment 897 ankle boot, per pair as per measurment 898 anti a1 lection sera5 ml vial(each),consumable 899 anti abd grouping serum 3x10ml consumable 900 anti ab sera igm 5 ml vial(each),consumable 901 anti a sera igm(10 vial),consumable 902 anti b sera igm(10 vial),consumable 903 anti d (polyvalent)(1x10 ml),consumable 904 anti d sera igg+igm 10ml vial(each),consumable 905 anti h sera 10 ml vial(each),consumable 906 apit(2x4 ml),consumable 907 apo a(100 tests),consumable 908 apo b(100 tests),consumable 909 aso kit(25 test/packet), (span) 910 ast/got 600 ml(model ba 400 system (mfg bybio system)),consumable 911 auto cleanser for cbc machine(4 liter),consumable 912 auto dill solution for cbc machine(20 liter),consumable 913 auto lyser solution for cbc machine(500ml),consumable 914 babcock laparoscopic 10mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip(36 cms length, independently moving jaws),consumable 915 babcock laparoscopic 5mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip(36 cms length, independently moving jaws),consumable 916 barium chloride 10% (500 ml bottle) 917 barium chloride 10%(mfg precious life care pvt ltd)(500 ml bottle),consumable 918 basic carbol fuchsin for afb staining(mfg precious life care pvt ltd)(25 gram/packet),consumable 919 bcg(1 ml each),syrings 920 syrum bilirubin total/direct (autospan/erba) 921 blood culture media fungus bottles per year, fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.; fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.( ),consumable 922 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 923 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 924 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail (eryclone anti d igm) 925 blood urea (autospan/erba) 926 blood vessel introducers needles 16g, sterilized, set 927 bone wax sterilised(2 gm/packet),consumable 928 bovine albumin (22% w/v)(1x5=5 ml),consumable 929 bovine albumin(each),consumable 930 brain thromboplastin(5ml bottle (mfg tulip diagnostics)),consumable 931 brain thromboplastin for prothrombin time (pt reagent) 5ml (liquiplastin) 932 calcium arsenazo 600 ml(model ba 400 system (mfg bybio system)),consumable 933 cannula fixer set consumable 934 carelyte 503(calibrator 1&2),consumable 935 carelyte 503(complete tubing set),consumable 936 carelyte 503(enzyme cleaning solution),consumable 937 carelyte 503(pottasium electrode),consumable 938 carelyte 503(pump tubing),consumable 939 carelyte 503(refernce electrode),consumable 940 carelyte 503(sodium electrode),consumable 941 carelyte 503(thermal printer roll),consumable 942 chromic catgut (12 foils/pkt)(size:1/0 length 150 cm),consumable 943 chromic catgut monofilament with 1/4 circle reverse cutting needle 6 0 ( 12 / pkt ) 944 chromic catgut no 1.0 round dody, 40 mm 12 foils/pkt 945 chromic catgut , round body needle no. 1.0 946 chromic catgut suture (12 foils/pkt)(3/8 cir r cutting needle 19 mm needle, suture length 76 cm size 4/0),needle 947 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm(5/0 12 foils/pkt)),sutures 948 chromic size 1, (12 foils/pkt)(1/2 cir rb needle 40 mm, length 76 cm),needle 949 chromic size 1, 12 foils/pkt(1/2 cir rb needle 45 mm, length 100 cm),needle 950 chromic with 1/2 cir rb needle 20 mm length 76 cm, 3 0 usp, absorbable surgical suture surgical material 12foils/box 951 chromic with 1/2 cir rb needle 30 mm length 76cm, 2 0 usp, absorbable surgical suture surgical material 12 foils/box 952 chromic with 1/2 cir rb needle 40 mm length 76 cm (with needle) ) absorbable surgical sutures usp,(size 1, 12 foils/pkt),surgical material 953 chromic with 1/2 cir rb needle size:1/0, 30 mm length 76cm absorbable surgical suture surgical material 954 chromic with cd cutting needle 12 mm length 70cm size:3/0 955 chromic with cd rb needle 30 mm length 76 cm size:2/0 absorbable surgical suture surgical usp, 12 foils/boxmaterial 956 chromic with cd.rb needle absorbable surgical suture (12 foils/pkt)(40 mm length 76 cm size:1/0),surgical material 957 chromic with st rb needle (12 foils/pkt)(60 mm length 76 cm size:2/0),consumable 958 citric acid analar/gr/ar (1x500 gm = 500gm),consumable 959 cleanac 3 4000 pack size 5l(cell counter (model no mek 6420p japan)),consumable 960 cleanac 3n 5litre solution(each),consumable 961 cleanac 4000 pack size 5l(cell counter (model no mek 6420p japan)),consumable 962 cleanac 5 litre solution(each),consumable 963 close wound drainage device under negative pressure(closed wound suction unit) size 200 ml(catheter size 16),consumable 964 close wound drainage device under negative pressure(closed wound suction unit) size 200 ml(catheter size 18),consumable 965 cloth based surgical adhesive tape roll(1 inch x 5 mtr / roll),consumable 966 coated polyster braided with cd white d needle 25 mm (curved reverse cutting or curved round body or taper cut) size:2/0 967 coated polyster with cd green needle 17 mm (curved reverse cutting or curved round body or taper cut) size:2/0 length 90cm 968 collagen sheets 10 x 10 cm sheet 969 complete absorbable mesh fixation device with minimum strap length 7mm2point fixation to hold the mesh and device should be of (25 absorbable straps),consumable 970 conc hcl (1x500 ml = 500 ml),consumable 971 conc washing solution 500 ml(model ba 400 system (mfg bybio system)),consumable 972 coombs ahg sera 5ml(each),consumable 973 coombs reagent 5 ml bottle(each),consumable 974 coombs serum (anti human globulin) (polyvalent)(1x5=5 ml),consumable 975 corrugated drainage sheet, sterile, multichannel, single use(2 inch x 6 inch (pvc) piece),consumable 976 cotton delivery belt 977 cover slip 18 x 18 mm 10gm 978 cpk mb kit (kinetic) 25 test/kit 979 creatinine mfg by ba 400 biosystems diagnostics pvt ltd(600 ml),consumable 980 crp (hs)(100 tests),consumable 981 crp test kit(latex/card),kit of 25 tests(mfg pathogyme diagnostics)(25 test / kit),consumable 982 crp test kit (autospan) 983 curved scissors laparoscopic 5mm size, 360 degree rotating with insulated shaft, non ratchet , plastic grip(36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving jaws),consumable 984 cvp line complete set 985 cyanemeth solution for hb(mfg by beacon diagnostic)(5 lit can),consumable 986 cytochrome stain with buffer (500 ml),consumable 987 d dimer(10x3 ml),consumable 988 dengue card test 100 test kit 989 developer powder (22.5 ltr) 990 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast/fog ratio and good shelf life 2 lit can( to make 9 liters working solution) (bromodex mp developer concentrate) 9ltr packing 991 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast/fog ratio and good shelf life 3 lit can( to make 13.5 liters working solution) (bromodex mp developer concentrate) 13.5 ltr packing 992 dexamethasone + gentamycin eye drop 0.1%+0.3% 993 dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)cotton gauze pieces 1 994 dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)(d) cotton gauze pieces 1,e) artery forceps 1 no (disposable) (mfg by precious life care pvt ltd)),consumable 995 dionised water 5 ltr cane(each),consumable 996 diphenhydramine inj 50mg/ml 997 disinfectant renaclean cold sterilant (5 ltr can) 998 disinfectant renasteril hot disinfectant (5 ltr can) 999 disinfectant with stabilizer by 0.01%w/v agn03 and h2p04(each),consumable 1000 disposable(24 g each),needle 1001 disposable appron consumable 1002 disposable cap 1003 disposable cup for urine sputum 30ml 80 to 90 mm diameter 100/pkt 1004 disposable dust mask jl246c equivalent to n 95 mask 1005 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 1006 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 1007 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 1008 disposable needle 20 g no isi marked 1009 disposable needles 22g consumable 1010 disposable needles 23g 1011 disposable needles 26g x 1/2 consumable 1012 disposable needles is 10654:2002 22g 1013 disposable needles is 10654:2002(23g),needle 1014 disposable needles is 10654:2002 24g 1015 disposable needles is 10654:2002 26 g 1016 disposable needles is 10654:2002 26g x 1/2 1017 disposable pricking lancet (pkt of 200 units) 1018 disposable sharp collection containers(1.5 l mfg by precious life care),each 1019 disposable sharp collection containers(5 l (mfg by precious life care)),each 1020 disposable spinal needle 18 no 1021 disposable spinal needle 22 no 1022 disposable spinal needle 23 no 1023 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd.(23 no),needle 1024 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422, 6.5 inch / pair 1025 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422, 7.5 inch / pair 1026 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422, 7 inch / pair 1027 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair 1028 disposable sterile gloves isi marked surgical rubber hypoallergenic latex 100% powder free 7 1/2 inc 1029 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 6 1/2 inches 1030 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 6 inches 1031 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 7 inches 1032 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6.5 inch / pair 1033 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6 inch / pair 1034 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free(7.5 inch / pair),consumable 1035 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 7 inch / pair 1036 disposable syringe (for vitamin k inj)(1ml with needle 26g),consumable 1037 disposable syringes is 10258:2002 with needle is 10654:2002 10ml 1038 disposable syringes is 10258:2002 with needle is 10654:2002 cgs 10cc (in ribbon pack) 1039 disposable syringes is 10258:2002 with needle is 10654:2002 cgs 2cc (in ribbon pack) 1040 disposable syringes is 10258 2002 with needle is 10654 2002 cgs 5cc in ribbon pack 1041 disposable syringes is 10258:2002 with needle is 10654:2002, mfg by ph health care pvt ltd(10ml),consumable 1042 disposable syringes with needle cgs 10cc consumable 1043 disposable syringes with needle cgs 2cc consumable 1044 disposable syringes with needle cgs 5cc consumable 1045 dissecting hook having telescoping shaft(10cm 14cm with integrated hand activation control buttons),consumable 1046 distilled water 5 litre(each),consumable 1047 dj stent for ureter 6 fr 1048 dj stent for ureter 8 fr 1049 double blood bag 450 ml cpda(each),consumable 1050 double lumen hoemodialysis catheter with pur ext tube 1051 double lumen polyurethane cvp catheter 4 to 5 fr(length 8 to 13 cm),consumable 1052 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, length 15cm 1053 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, length 8cm 1054 double lumen polyurethane cvp catheter 5 fr(length 13 to 15 cm),consumable 1055 dpx(1 x 250 lit),consumable 1056 drabkin solution for hb (1x5 lit),consumable 1057 drop paracetamol 100mg/15ml 1058 dusting powder, 10 gm ( neomycin sulphate 5 mg, baccitracin 250 unit, sulphacetamide sodium 60 mg) 1059 ea 50 (modified) (for cytology)(1x125 ml),consumable 1060 ecg paper(chemical coated) 50mm x 20mm roll 1061 ecg paper(chemical coated) 50mm x 30 mtr. roll 1062 ecg paper (chemical coated)(80mmx 20 mtr each),consumable 1063 ecg paper computerizesd triple channel 20m 1064 ecg paper computerizesd 6 channel 20m 1065 ecg paper computerizesd 12 channel 20m 1066 ecg roll three channel 20m 1067 edta solutions k3(mfg by himedia)(500 ml bottle),consumable 1068 edta vaccutainer 3 ml + needle(each),consumable 1069 edta vial 1070 egc roll 66 mm x 15 mm 1071 egc roll, mfg by life o line technologist(66 mm x 15 mm roll),consumable 1072 ehrilichs aidehyde reagen (2x250 ml),consumable 1073 electrolyte solution a 250ml(250ml),consumable 1074 electrolyte solution b 250ml(250ml),consumable 1075 endotracheal tube internal dia 2.5 mm to 5 mm 1076 endotracheal tube internal dia 5.5mm to 9.5mm 1077 endotracheal tube internal with radioopaque line(dia 2.5 mm to 5 mm),consumable 1078 endotracheal tube,soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product(size 3),tube 1079 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product(size 4),tube 1080 endotracheal tubes size 5.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),combi blister pack 1081 endotracheal tubes size 5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1082 endotracheal tubes size 6.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1083 endotracheal tubes size 6 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1084 endotracheal tubes size 7.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1085 endotracheal tubes size 7 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1086 endotracheal tubes size 8.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1087 endotracheal tubes size 8 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1088 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque blue line 1089 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line(size 9.5),consumable 1090 endotracheal tubes size 9 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1091 endotreheal tube size 3 cuffed piece, should have silicon tube with radio opaque blue line 1092 endotreheal tube size 4 cuffed piece, should have silicon tube with radio opaque blue line 1093 enema 100 ml (sodium acid phosphate 10 gm, sodium phosphate 8 gm / 100 ml) 1094 eosin 2% solution (1x250 ml),consumable 1095 esbachs reagent (125 ml),consumable 1096 exchange transfusion catheter with four way adaptor size 4 cm, l 40 cm 1097 e z cleaner 100ml(each),solution 1098 factor ix deficient plasma (<1%)(10x1 ml),consumable 1099 factor vii deficient plasma (<1%)(10x30 ml),consumable 1100 fdp kit(4 ml),consumable 1101 femoral catheters double lumen kit curved double lumen catheter set 12 f (curved) adult, set 1102 femoral catheters single lumen set adult(size 6f to 8f, length 13 cm to 15 cm),consumable 1103 femoral catheters single lumen set pediatric(size 3f to 4f, length 13 cm to 15 cm or less),consumable 1104 femoral catheters single lumen size adult (set of 12 different sizes), set 1105 femoral catheters single lumen size size pediatrics (set of 12 different sizes), set 1106 femoral guide wires : straight (0.325 mm size) should meet the following standards : european ce, iso13485, sterile, fda, set 1107 femoral guide wires : straight/j tip((0.325 mm size) sterile: ce/iso13485 marked),consumable 1108 ferric ammonium citrate 200mg, folic acid 0.5mg 1109 fistula 16g, single sterilized eto single needle packing 1110 fistula 17g, single sterilized eto single needle packing 1111 fistula and wound management system(size 104 159 mm),consumable 1112 fistula and wound management system(size 156 228 mm),consumable 1113 fistula and wound management system(size 208 297 mm),consumable 1114 fistula sterilized twin needle(16 g (two needle pack)),consumable 1115 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 1116 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 1117 fixer powder (bromex acid fixer with hardner) ( 22.5 ltr/pkt) 1118 flow regulator (dial flow)(each),consumable 1119 foldable iol sterile lens +18d(each),lens 1120 foldable iol sterile lens + 18d (usfda approved, as per specification)(each),consumable 1121 foldable iol sterile lens + 19.5d (usfda approved, as per specification)(each),consumable 1122 foldable iol sterile lens +19d(each),lens 1123 foldable iol sterile lens + 19d (usfda approved, as per specification)(each),consumable 1124 foldable iol sterile lens + 20.5d (usfda approved, as per specification)(each),consumable 1125 foldable iol sterile lens +20d(each),lens 1126 foldable iol sterile lens + 20d (usfda approved, as per specification)(each),consumable 1127 foldable iol sterile lens + 21.5d (usfda approved, as per specification)(each),consumable 1128 foldable iol sterile lens +21d(each),lens 1129 foldable iol sterile lens + 21d (usfda approved, as per specification)(each),consumable 1130 foldable iol sterile lens + 22.5d (usfda approved, as per specification)(each),consumable 1131 foldable iol sterile lens +22d(each),lens 1132 foldable iol sterile lens + 22d (usfda approved, as per specification)(each),consumable 1133 foleys catheter size 14 2 way 1134 foleys catheter size 14 3 way 1135 foleys catheter size 18 2 way 1136 foleys catheter size 20 2 way(12 each),consumable 1137 foleys catheter size 22 2 way(13 each),consumable 1138 foleys catheter size 24 2 way(14 each),consumable 1139 foleys urinary catheter 2 way(size 22 each),consumable 1140 foleys urinary catheter 2 way size 8 1141 foleys urinary catheter 3 way size 12 1142 foleys urinary catheter 3 way size 16 1143 foleys urinary catheter 3 way size 18 1144 foleys urinary catheter 3 way size 20 1145 foleys urinary catheter 3 way size 22 1146 foleys urinary catheter pediatrics size 10 1147 foleys urinary catheter size 16 2 way 1148 formaldehyde 40% (conc. formaline)(1 x 30 lit),consumable 1149 formaldehyde (formolene liquid 450 ml 1150 formaldehyde (formolene ) tab pack 1151 fouchets reagent(mfg precious life care pvt ltd)(100 ml bottle),consumable 1152 g 6pd kinetic per ml 1153 g6pd (span) 1154 gauze swab/pad 4 layer 20x40 1155 gauze swab/pad 6 layer 10 ã— 10 1156 gauze swab/pad 6 layer 20 ã— 20 1157 giemsa stain (merck / span) (125 ml),consumable 1158 glacial acetic acid (2.5 liter),consumable 1159 glass slide 75mm x 25mm 1.1 mm 1160 glass slide 75mm x 25mm 1.35 mm 1161 glass test tube 5 without edge 1162 glucometer strip (1x100) 1163 gold chloride (1x1 gm),consumable 1164 gram iodine (gram stain) 125 ml 1165 grasper laparoscopic 5mm straight 360 degree rotating with insulated shaft, toothed a traumatic grasper with ratchet mechanism, plastic grip(36 cms length, independently moving jaws),consumable 1166 guide wire 3mm 1167 h2so4 (sulphuric acid)(25% 500 ml bottle),consumable 1168 h2so4 (sulphuric acid)(5% 500 ml bottle),consumable 1169 haematoxyline solution (harris)(1x125 ml),consumable 1170 haemocoagulase 1 nih unit/ml, 1 ml inj 1171 haemoglobin colour scale with paper 1172 haemoglobinometer (square tube pattern) 1173 capillary tube 1174 stop watch 1175 handpiece(blue),consumable 1176 handpiece(transducer),each 1177 hba 1 c (glycosylated hb)(100 tests),consumable 1178 hba ag elisa 96 kit 1x96(each),consumable 1179 hba ag rapid card test(each),consumable 1180 hbsag test kit (sd biolab) 1181 hcv elisa(96 test kit),consumable (sd biolab) 1182 hdl kit 50 test 1183 hematology cell counter reagents rinse solution (20 ltr) 1184 hemodialysis fluid for bicarb made(part a 10 ltr +part b 500gm 2/pkt),consumable 1185 hemolynac 3n 2340 500ml(each),consumable 1186 hemolynac 3n 2340 pack size 500 ml(cell counter (model no mek 6420p japan)),consumable 1187 heparin and benzyl nicotinate 20mg oint. 1188 heparin sodium benzyl nicotinate oint 1189 hiv 1+2 (rapid) per card j mitra 1190 hiv 1&2 test cards 1191 hiv kit (sd biolab) 1192 hpmed solution consumable (pack size: 16 bottles of 50 ml) , make polti s.p.a. ; model sani system(country of origin italy;),consumable 1193 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine 1194 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine(mfg by precious life care),each 1195 hydroethyl starch 6% solution with sodium chloride 0.9% 500 ml bottle(each),consumable 1196 hydrogen peroxide (conc.) h2o2 (500 ml),consumable 1197 hypodermic needles for single use bis gauze(23 length, 25 mm + 1),needle 1198 hypodermic needles for single use gauze 22 bis length, 25 +1/ 2 1199 hypodermic needles for single use gauze 23 bis length, 25 +1/ 2 1200 hypodermic syringe for single use 10ml bp/bis (without needle) 1201 hypodermic syringe for single use 1ml, is : 10258 (10 ml vial) 1202 hypodermic syringe for single use 2ml bp/bis (without needle) 1203 hypodermic syringe for single use 5ml bp/bis (without needle) 1204 individual identification panel for aerobic gram positive organism(gpid),each 1205 individual identification panel for anaerobic gram negative organism(anc),each 1206 individual identification panel for anaerobic gram positive organism(anc),each 1207 individual identification panel for fungus(yst),each 1208 infant feeding tube size: 5g 1209 inj. b complex 30ml 1210 inj. diclofenac 30ml 1211 inj. heamocoagulase 1cu 1ml 1212 inj. l ornithine l aspartate 10ml 1213 inj. meropenam 125mg 1214 inj. primacort hydrocotisone 200 mg 1215 inj. sigmacrome (obrochrome) 10ml 1216 instrument sterilant 10 minute sporicidal sterilant aldehyde free containing sodium perborate((810 grm packet)),powder 1217 instrument wash 500ml with spray pump 1218 insulin syringe/ each (graduation upto 100 units) 30 g needle, 40 units/ml(30 g needle, 40 units/ml),syrings 1219 intra camral saline (r.l) sep (eto sterelied, specialy(manufactured for intra camral),consumable 1220 iron alum a) ferric amino sulphate (1x500 ml = 500 ml),consumable 1221 iron & folic acid entric coated 100mg,of elemental iron (adult)+fa 1.5mg tab. 1222 iv cannula size with inj.valve (port)(18g ),consumable 1223 iv dextrose 40% 1224 jugular catheters : double lumen kit (curved), set 1225 k3 blood vaccutainer edta 100 tubes/pkt 1226 keratome 3.2 keratome –round stock 3.2mm full handle knives e.t.o. sterile angled bevel up 45 deg 1227 kores indelible ink marker pen 1228 k wire length 375mm size:1.6mm roll 1229 k wire length 375mm size:1.8mm roll 1230 k wire size:1mm 1231 labetalol 5 mg/ ml, 2 ml inj 1232 ladies sleeper, per pair as per measurment 1233 l alanyl l glutamine solution for infusion (20%w/v)(each),consumable 1234 laser fiber for dental laser , make faith inovation ; model fd10b ;(country of origin india),consumable 1235 ldh kit pack (50 ml bottle),consumable 1236 leishmann stain sol with buffer tablet ph (1x5 lit),consumable 1237 leishman stain(mfg precious life care pvt ltd)(500 ml bottle),consumable 1238 light weight composite mesh : polypropylene and polyglycolic acid partially absorbable composite mesh with large pore size 6 x 11 cm 1239 liquid paraffin 50ml(bottle ),consumable 1240 liquor ammonia (500 ml),consumable 1241 long line silicon catheter, g 24, fr 2, l 30cm 1242 low profile titenium chemo port with cilicon catheter (9.6 fr, 6.6fr, 3.9fr,) length 60cm,guide wire, peel away desilet,hubsite needle(22g*20mm) 1243 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card (as per gio nvbdcp specification) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 1244 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card (as per gio nvbdcp specification) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab (sd biolab) 1245 malaria card (antigen) atleast 100 microbes/desi ltr. for both species 1246 malaria pf/pv antigen card 1247 malaria pf/pv rapid test 1248 maryland dissector laparoscopic 5mm curved maryland dissector with tapering end, 360 degree rotating with insulated shaft, non ratchet , plastic grip(36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving),consumable 1249 masson trichrome staining kits(100 test),consumable 1250 medical x ray film polyester based imaging film 35.6cm x 35.6cm (14x14) size: 50 sheets in one packet 1251 medical x ray film polyester based imaging film 35.6 cm x 43.2cm (14x17) size: 50 sheets in one packet 1252 medigard hand scrub 1253 meropenem inj 1mg 1254 methyl blue for (z n)(mfg precious life care pvt ltd)(125 ml bottle),consumable 1255 methyline blue(100 ml),solution 1256 methyline blue 0.1% solu. 1257 miconazole nitrate 2 % w/w 15 gm, oint 1258 microalbumin urine(100 tests),consumable 1259 micro pipet 1000 fix and variable each 1260 micropiptte 100 1000 1261 microtips (2 200 ul) 1x1000(each),consumable pkt 1262 microtips yellow (10 200ul)1x1000(each),consumable 1263 micro and macro tips stand 1264 milkiwhite gel based sanitizer 1.ethinol (cas 64 17 5) 58 62% 2. benzoil coline chloride 0.52% 1 % 3.(ph neutral contact time 15 se 4. pack size 100 ml & 100 ml with dispensor),consumable 1265 milkiwhite gel based sanitizer 1.ethinol (cas 64 17 5) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ph neutral contact time 15 sec 4.(pack size l& 500 ml with dispensor),consumable 1266 mindray bc 2800, auto hematology analyzer(m 18 cfl lyes),consumable 1267 mindray bc 2800, auto hematology analyzer (m 18 cleanzer),consumable 1268 mindray bc 2800, auto hematology analyzer (m 18 diluent),consumable 1269 mindray bc 2800, auto hematology analyzer(m 18 probe cleanzer),consumable 1270 mindray bc 2800, auto hematology analyzer(m 18 rinse),consumable 1271 mindray bc 2800, auto hematology analyzer(paper roll),consumable 1272 mindray bc 2800, auto hematology analyzer(quality control),consumable 1273 mindray bc 5300, auto hematology analyzer part 5(m 53 cleaner),consumable 1274 mindray bc 5300, auto hematology analyzer part 5(m 53 diluent),consumable 1275 mindray bc 5300, auto hematology analyzer part 5(m 53 leo (ii) lyes),consumable 1276 mindray bc 5300, auto hematology analyzer part 5(m 53 leo (i) lyes),consumable 1277 mindray bc 5300, auto hematology analyzer part 5(m 53 lh lyes),consumable 1278 mindray bc 5300, auto hematology analyzer part 5(m 53 probe cleaner),consumable 1279 mindray bc 5300, auto hematology analyzer part 5(quality control),consumable 1280 montex test 2tu(1 vial),consumable 1281 mva kit (mannual vaccum aspiration kit) (as per attached specification)(mfg by women care global),consumable 1282 n/10 hcl 500ml 1283 nah2 po4 (anhydrous) analar / gr/ar (1x500 gm = 500gm),consumable 1284 needle hypodermic0insulin (metallic non0sterile) needle 1285 needle hypodermic size is 10654:2002 23g 1286 needle hypodermic size is 10654:2002 24g 1287 neomycin and sulfacetamide sprinkling powder 5 gm(each),consumable 1288 neubauers chamber(each),consumable 1289 nimesulide oint gel 20gm 1290 non foldable iol sterile lens ac + 18 1291 non foldable iol sterile lens ac + 20 1292 non foldable iol sterile lens pc+14d ,lens 1293 non foldable iol sterile lens pc+16d ,lens 1294 non foldable iol sterile lens pc+18d ,lens 1295 non foldable iol sterile lens pc+19d ,lens 1296 non foldable iol sterile lens pc+19.5d ,lens 1297 non foldable iol sterile lens pc+20 d ,lens 1298 non foldable iol sterile lens pc+20.5 d ,lens 1299 non foldable iol sterile lens pc+21 d ,lens 1300 non foldable iol sterile lens pc+21.5 d ,lens 1301 non foldable iol sterile lens pc+22 d ,lens 1302 non foldable iol sterile lens pc+22.5 d ,lens 1303 non foldable iol sterile lens pc+23 d ,lens 1304 non foldable iol sterile lens pc+24 d ,lens 1305 non foldable iol sterile lens pc+26 d ,lens 1306 non foldable iol sterile lens ac+19d ,lens 1307 non foldable iol sterile lens pc + 18.5(each),lens 1308 occult blood test kit (haem test kit) (1 x 100 strips),consumable 1309 og6 (for cytology)(1x125 ml),consumable 1310 oint. gentamycin sulphate 15gm 1311 optia granulocyte depletion set, model : 10300(packing size : 6 kits),consumable 1312 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures(size 1x 2approved by us fda),consumable 1313 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures(size 2x 4approved by us fda),consumable 1314 oxygen mask adult (standard size) 1315 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm (curved), kit 1316 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm (straight), set 1317 paediatric drip set(set),digonstic 1318 paediatric epidural set(19g needle, metal stylet,22g catheter,0.22micron epidural catheter lor syringe) 1319 adult epidural set with catheter 1320 pandys reagent csf (125 ml),consumable 1321 papaniculau stain kit (125ml bottle) 1322 paper adhesive microporous surgical tape 3 inch x 5 m / roll (10 roll/pkt)(3 inch x 5 m / roll (10 roll/pkt)),consumable 1323 paper adhesive plaster 1/2 x 9.0mts 1324 paper adhesive plaster 1 x 9.0mts 1325 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll 1326 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 1327 paracetamol 75 mg/ml, 10 ml inj 1328 paracetamol + chlorpheniramine(100 ml syrup),syrup 1329 paraffin wax histology (58 60)(1x1 kg = 1 kg),consumable 1330 patch buprenorphine(10mcg),consumable 1331 patch buprenorphine(20mcg),consumable 1332 personal protection kit(kit),consumable 1333 phenobarbitone inj. 100 mg/ml 1334 pistol grip curvedcoagulating shears ergonomic handle with att shaft lenght 36cm can seal blood vessel upto and inclding (5mm in diameter),consumable 1335 pistol grip curved coagulating shears with ergonomic handle in the(folloeing shaft lengths 36 cm can seal blood vessels upto and including 5 mm in diameter),consumable 1336 pistol grip curved coagulating shears with ergonomic handle shaft(langths 36 cm can seal blood vessels upto and including 5 mm in diameter att),each 1337 plain disposable vial 3ml(each),consumable 1338 plain vial(12 x 75 with screw cap each),consumable 1339 plain vial with screw cap(12 x 75),consumable 1340 p o p 1 kg pkt 1341 plastic bottle(300ml),consumable 1342 plastic bottle(500 ml),consumable 1343 platelet dilution fluid(mfg precious life care pvt ltd)(100 ml),consumable 1344 polybutylate coated with polyester braided(green) with 1/2 cir tap cut v 5 da needle 17mm, non abs surg suture usp 2 0 length 90cm (12 foils/pkt) 1345 polyester braided coated with cd white dn 17 mm curved rb 90cm 2/0 (12 foils/pkt) 1346 polyester braided coated with cd white dn 17 mm(curved rev cut) cut 90 cm 2/0 (12 foils/pkt) 1347 polyester braided coated with cd white dn 17 mm taped cut 90 cm 2/0 (12 foils/pkt) 1348 polyester braided coated with cd white dn 25mm(curved rb) 2 0 length 90cm (12 foils/pkt) 1349 polyethylene high pressure extension tube, length 100cm 1350 polyethylene high pressure extension tube, length 150cm 1351 polyglecaprone with 1/2 cir oval rb needle 26 mm length 70 cm (12 foils/pkt) 1352 poly l lysine coated slides (50 lidess x 1),consumable 1353 poly l lysine sol (for immunochisto chemistry) (1x100 ml),consumable 1354 polymaide mono filament (nylon) with cd cut needle 20 mm length 70 cm size 2/0 (12 foils/pkt) 1355 poly propylene mesh 15 x 15 cm 1356 poly propylene mesh 7.5cmx15cm 1357 poly propylene mono filament sterile precut with 1/2 cir rb d needle 16mm length 70 cm non absorbable surgical sutures usp size 5/0(12foils/pkt),consumable 1358 poly propylene mono filament sterile precut with 1/2 cir rb heavy needle 16 mm length 70 cm non absorbable surgical sutures usp 5/0 (12 foils/pkt) 1359 poly propylene mono filament sterile precut with 1/2 cir rb heavy needle 30mm length 70 cm non absorbable surgical sutures usp size 1 1360 poly propylene mono filament sterile precut with 1/2 cir rb needle 25 mm length 70 cm non absorbable surgical sutures usp size 3/0 1361 poly propylene mono filament sterile precut with 1/2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 1/0 1362 poly propylene mono filament sterile precut with 1/2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 2/0(12 foils/pkt),surgical material 1363 poly propylene monofilament sterile precut with 1/2 cir rb needle 30mm length 70cm size : 1/0(12 foils/pkt),consumable 1364 poly propylene monofilament sterile precut with 1/2 cir rb needle 30mm length 70cm size:2/0 (12 foils/pkt) 1365 poly propylene mono filament sterile precut with 1/2 cir rb needle 40 mm length 70 cm non absorbable surgical sutures usp size 1/0 1366 poly propylene monofilament sterile precut with 1/2 cir rb needle 40 mm length 70 cm size 1(12 foils/pkt),needle 1367 polytaxine powder(1x5 gm),consumable 1368 post operative bag with window size 100 mm(1 each),consumable 1369 post operative bag with window size 70 mm(1 each),consumable 1370 potassium chloride oral solution 500mg/10ml 1371 povidone iodine cream 250gm 1372 powder protien +vitamins +corbohydrates & minerals 200gm 1373 pregnancy detection kit ce marked/isi marked 30 test/ kit 1374 prolene 1 0 rb 1/2 circle 30 mm, l 70 cm (12 foils /pkt) 1375 prolene mesh 7.5 x 15 cm(12 foils /pkt) 1376 protein (total)(600 ml),consumable 1377 protein (total) (autospan) 1378 protein (total) (erba) 1379 protein (total) 600 ml(model ba 400 system (mfg bybio system)),consumable 1380 protien (total) mfg by ba 400 biosystems diagnostics pvt ltd(600 ml),consumable 1381 protien (urine) ba 400 biosystems diagnostics pvt ltd(240 ml),consumable 1382 ptah staining kits(100 test),consumable 1383 ptfe material, iv cannula, with luer lock, g 18 1384 ptfe material, i.v. safety cannula, with luer lock, g 16 1385 pt kit (time) (ist 1.00 1.20)(2x4 ml),consumable 1386 ptk (nishchay kit) 1387 quick diff staining kits for pap smear(100 test),consumable 1388 quincke bevel pediatric spinal needle, g 25, length 1.2 inch 1389 quincke pediatric spinal needles g 25, length 2.0 inch 1390 ra factor 50 test kit qualicative 1391 r a factor test kit (span) 1392 r a factor test kit (erba) 1393 reaction rotor 10 pc(model ba 400 system (mfg bybio system)),consumable 1394 hdl cholesterol(autospan/erba) 1395 reticulocyte kit (100 tests),consumable 1396 reuse prevention syringe 10 ml 1397 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles complaint to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized,non latex stopper 3ml 1398 reuse prevention syringe sterile single use reuse prevention syringewith detachable needles complaint to iso 7886:4 type i and type b, flow wrap/ blister package using medical grade breathable paper, eto sterilized, non latex stopper 2ml 1399 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles complaint to iso 7886:4 type i,b, flow rap/blister pack using medical grade breathable paper, eto sterilized, nonlatex stopper (prefd matr thmoplast ela)5ml 1400 reuse prevention syringe sterile single use reuse prevention syringe with fixed/ detachable needles complaint to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized.(10 ml),syrings 1401 reuse prevention syringe sterile single use reuse prevention syringe with fixed/detachable needles complaint to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(2ml),syrings 1402 reuse prevention syringe sterile single use reuse prevention syringe with fixed/detachable needles complaint to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(3ml),syrings 1403 reuse prevention syringe sterile single use reuse prevention syringe with fixed/detachable needles complaint to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(5ml),syrings 1404 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 typei and typeb 3ml 1405 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 type i and type b, flow wrap/ blister package using medical grade breathable paper, eto sterilized, non latex stopper (preferred material thermoplastic elastomer) 5ml 1406 rhyroid stimulating hormone(tsh),consumable 1407 rib belt large(mfg by precious life care),each 1408 rib belt medium(mfg by precious life care),each 1409 roll bandage 05 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1410 roll bandage 10 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1411 roll bandage 15 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1412 roll bandage 7.5 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1413 rolled bandage 10cm ã— 5m 1414 rolled bandage 15cm ã— 5 m 1415 rolled bandage 5cm ã— 5m 1416 rolled bandage 7.5cm ã— 5m 1417 safranine (gram stain) 500 ml bottle 1418 safranine (gram stain) (500 ml bottle (mfg sunlabs)),consumable 1419 s.albumin(each),consumable 1420 sargramostim (recombinant human granulocyte macrophage colony stimulating factor)(500 mcg/ml),injection 1421 s. b12(100 tests),consumable 1422 s.calcium(each),consumable 1423 scalp vein set(size 24g, disposable),consumable 1424 schirmer strip for ophthalmic use 1425 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft(lengths 17 cm can seal blood vessels upto and including 5 mm in diameter),each 1426 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft(lengths 9cm can seal blood vessels upto and including 5 mm in diameter),each 1427 s direct billirubin(1000 ml),consumable 1428 semen dilution fluid(100 ml bottle),consumable 1429 serum amylase (mfg by beacon diagnostic)(100 ml),consumable 1430 serum electrolite na+ k+ kit analizer(50 test per kit),consumable 1431 serum t4 kit, elisa(96 test kit each),consumable 1432 serum tsh kit, elisa(96 / pkt),consumable 1433 sevoflurane 20cc(each),consumable 1434 s. ferritin(each),consumable 1435 s. folate(100 tests),consumable 1436 sgot(mfg pathogyme diagnostics)(25 ml),consumable 1437 sgot(mfg autospan/erba 1438 sgpt kit lyphozyme 5x20 ml 1439 sgpt test kit reagent 1440 sgpt test kit reagent (autospan/erba) 1441 shoes uniform ,per pair as per measurment 1442 short iv catheter with straight guidewire. l 20, fr 2, g 22 1443 short iv catheter with straight guidewire. l 4, fr 2, g 22 1444 short iv catheter with straight/j tip guidewire(l 4, fr 2, g 22),consumable 1445 sics blade cresent(15 degree),consumable 1446 sics blade (disposable) cresent nife 2.8 (specialy long matel handle, micro sharp edge, isi/iso(manufaturer, eto stereliged),consumable 1447 silk no 1 cutting needle 1x12(1x12),consumable 1448 sulpher powder pkt 1449 s. iron (ferrozine)(100 tests),consumable 1450 s.lipase(each),consumable 1451 sliver nitrate (1x25 gm = 25 gm),consumable 1452 sodium chloride nacl analar / gr / ar (1x500 gm = 500gm),consumable 1453 sodium citrate 3.8%(mfg precious life care pvt ltd)(500 ml bottle),consumable 1454 sodium hydroxide (naoh) (analar / gr/ar) (1x500 gm = 500gm),consumable 1455 sodium hypo chloride 5 lit jar 1456 sodium metabisuiphite (na2s2o3) (analar (gr/ar) (1x500 gm = 500gm),consumable 1457 sodium nitroprusside (100 gm),consumable 1458 spectra optia collection set, model : 10110 / 10120(packing size : 6 kits),consumable 1459 spectra optia exchange set, model : 10220(packing size : 6 kits),consumable 1460 spectra optia platelet kit, model : 10400(packing size : 6 kits),consumable 1461 s. phosphorus (each),consumable 1462 spinal needle with metal stylet, mfg by nipro medical india pvt. ltd.(g 23),needle 1463 (ss) powder (1x25 gm = 25 gm),consumable 1464 sstromatolyser 4ds for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 126 ml),consumable 1465 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(pt ã¢â€â“sta neoplastin cl + 5),consumable 1466 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta cacl2 ),consumable 1467 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta cleaner solution),consumable 1468 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta coagcontrol n+p),consumable 1469 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta desorb u),consumable 1470 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta satellite cuvette),consumable 1471 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(white stirrer for pt test),consumable 1472 stain (1x25 gm = 25 gm),consumable 1473 staining kit reticulin(100 test),consumable 1474 staining kits (100 test),consumable 1475 stainless steel wire 28g 1476 stainless steel wire 30g 1477 sterigen c electrolyte solution one pack of 10 ltr. for sterigen 400 daf , make faith inovation; model sterigen sg 400 daf ;(country of origin india),consumable 1478 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid(5 ltr can),consumable 1479 sterilant hot disinfectant for dialysis containing 21% (approx) citric acid, malic acid, lactic acid(5 ltr can),consumable 1480 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd(20 ml),consumable 1481 sterile hypodermic syring with needle 10 ml 1482 sterile hypodermic syring with needle 20 ml 1483 sterile hypodermic syring with needle(5 ml),syrings 1484 sterile hypodermic syring with needle, mfg by ph health care pvt ltd(10ml),consumable 1485 sterlium 500 ml 1486 s. tibc kit(100 tests),consumable 1487 s. total protein(each),consumable 1488 s. transferin(100 tests),consumable 1489 strip for albumin urine and suger 1490 strip for malaria antigen, p vivex, p falciparum (50 tests) 1491 stromatolyser 4dl for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 5000 ml),consumable 1492 sulfolyser for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 5000 ml),consumable 1493 sulfur powder 1494 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder(5 kg packet (mfg by zenith chemicals allied industries)),consumable 1495 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder((5kg packet)),powder 1496 surgical blade, size 15 (100/pkt) 1497 surgical blade, size 24 (50/pkt) 1498 suter(8/0 (01 box)),consumable 1499 sutureless dural graft substitute(1x3),consumable 1500 sutureless dural graft substitute(2x2),consumable 1501 sutureless dural graft substitute(3x3),consumable 1502 sutureless dural graft substitute(4x5),consumable 1503 suture mersilk 8 0 (12 foil) 1504 s.vitamin d3(100 tests),consumable 1505 tannic acid with glycerine (gum paint) 80% + 20% 10 ml vial(10 ml),lotion 1506 macroporus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber (6 0) and poliglecaprone 25 monofilament fiber (5 0) with pore size 2.7 mm having a weight of 39 g/m2 and containing blue orientation stripes of polypropylene. 15cmx15cm 1507 thrombin time kit(10x3 ml),consumable 1508 thyroxine(t4),consumable 1509 tmt graph paper a4 size, 100 piece/pkt 1510 tracheostomy tube (pvc) sterile single use (adult)(size 4 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1511 tracheostomy tube (pvc) sterile single use (adult)(size 5 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1512 tracheostomy tube (pvc) sterile single use (adult)(size 7 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1513 tracheostomy tube (pvc) sterile single use (adult)(size 8 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1514 triple lumen jugular catheter 12 x 16 1515 triple lumen jugular catheter kit(size 12f, 16+/ 1cm),consumable 1516 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 15cm 1517 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 20cm 1518 triple lumen polyurethane cvp catheter 7 to 7.5fr(g 14 16x18x18, length 16 20 cm),consumable 1519 triple lumen polyurethane cvp catheter 7 to 7.5 fr(g 14 16x18x18x18, length 15 16cm),consumable 1520 trisodium citrate 3.8%(mfg precious life care pvt ltd)(500 ml bottle),consumable 1521 trisodium citrate analar/gr/ar (1x500 gm = 500gm),consumable 1522 troponin 1 kit(10 test per pack),consumable 1523 troponin t (ctn t) card test(50 test),consumable 1524 trucut biopsy needle 18 g length 15 cm 1525 typhoid test card. 1526 umblical cotton tape length 75cm. 1527 urea/bun ã¢â€â“ uv 600 ml(model ba 400 system (mfg bybio system)),consumable 1528 urea uv gloh 5x20ml 1529 uric acid 600 ml(model ba 400 system (mfg bybio system)),consumable 1530 uric acid biosystem 1531 uric acid(mfg pathogyme diagnostics)(50 ml (2 x 25 ml)),consumable 1532 uric acid(autospan)(50 ml (2 x 25 ml)),consumable 1533 uric acid(erba)(50 ml (2 x 25 ml)),consumable 1534 urine albumin & suger test kit 1*100 pkt 1535 urine culture pot 30 ml. 1536 urine (multi stripe),consumable 1537 urine strip 2 parameter (sd biolab) 1538 urine strip 2 parameter (tulip) 1539 urine strip 10 parameter (sd biolab) 1540 urine strip 10 parameter (tulip) 1541 uri stix 100 test 1542 urosticks(50/pkt),consumable 1543 usg gel(250 ml bottle),consumable 1544 vaseline white/yellow 1/2kg 1545 vdrl kit (strip) (mfg by alere)(50 test/kit),consumable 1546 vdrl (rpr) 1x100 sd strip (sd biolab) 1547 vdrl tedt kit (liquid) span 1548 v.p shunt high pressure (venticular peritonial shunt, (venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet)(each),consumable 1549 v.p.shunt(low pressur),consumable 1550 v.p.shunt(medium pressur),consumable 1551 whitacre pencil point spinal needle 25 g with introducer 1552 white petrollium jelly 500 gm 1553 widal 2x2 sera slide kit 1554 widal 2x2 tube test kit 1555 widal 4x5 ml 1556 wound suction no 18 1557 xro catheter with ptfe material, i.v. safety cannula, with luer lock(g 18),consumable 1558 xro catheter with ptfe material, i.v. safety cannula, with luer lock(g 20),consumable 1559 xro catheter with ptfe material, i.v. safety cannula, with luer lock(g 22),consumable 1560 adhesive tape 7.5cm x10 mtr/roll 1561 alcohol dispensor 1562 all out 1563 blood bag with acd/cpd solution (disposable sterilised) with needle(100 ml),bag hll 1564 blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag (hll) triple 1565 cleanser m52 1 lit 1566 coagulater 1567 diff lyse m52 500 ml 1568 disposable sterile gloves size 6 inches consumable 1569 disposable sterile gloves size 61/2 inches consumable 1570 disposable sterile gloves size 7,1/2 inches consumable 1571 disposable sterile gloves size 7inches consumable 1572 glucometer with strip 1573 i.v. cannula with injection valve(size 24 g),consumable 1574 iv cannula size 24g with inj.valve (port) 1575 iv cannula size with inj.valve (port)(22g ),consumable 1576 latex based baloon capacity (30 50ml) foleys catheter(size 16 2 way),consumable 1577 bleaching power gr ii (25kg) bags consumable 1578 a.v fistula needle 17 g 1579 a.v. blood line (post haemodialysis tubing) high quality 1580 a v blood lines with av pressure transducer(acceptable for fitting to all standard dialyzers ) with side tubing (for heparinization and av pressure monitoring) ce and iso certificate essential with protector for all machines types and dialysers(medical grade pvc like of fresenius bain (dora), dialife ,nipro, b raun browndone,biolight or equivalent post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality),consumable 1581 a v blood lines with av pressure transducer protector for all machines types and dialysers (acceptable for fitting to all standard dialysers), set 1582 giemsa stain 1583 glass beaker 200 ml 1584 glass conical flask 100 ml 1585 glass conical flask 200 ml 1586 glass tube plain 4” 1587 glass tube plain 6” 1588 group confermation card+ solution matrix gel system 1589 prolin no 1 1590 prolin no 2 0 1591 rub in hand solution 100ml/500ml 1592 surgical scalpel blade with handle 1593 t3, reagent (mini vidas)/biomerieux 1594 t4 reagent (mini vidas)biomerieux 1595 test tube glass 10 ml 1596 tsh reagent (mini vidas)biomerieux 1597 wiper big 1598 wiper medium 1599 wiper small 1600 utility gloves for large latex 1601 utility gloves for medium of latex 1602 baby vest the baby vest should be a double breasted upper garment & single jersey knit (100% cotton) 150 160 gsm. size should be: length 9”, chest size should be 9”, sleeve length should be 1¾” & width 6”. piping is must & the piping made of cotton cambric. it should have side wise stretching. (specs attached seperately) {for all new born} 1603 b. b. silk size 2/0 , 110 cm with 1/2 cr cutting needle 1604 mackintosh sheet rubber makintosh double colour rubber sheeting, high polymer (55% grade a) water proof colour (green, blue, red), thickness 0.4mm, width 90cm roll of 30 mtr compliant to is 4135 (1974) {for labour table ot & maternity beds} 1605 synthetic absorbable suture with 1/2 circle round body needle 40 mm length 90 cm polyglycolic acid 1606 nylon no .1, 1/2 circle needle 40 mm, 110 cm, nonabsorblr suture 1607 vicryl no.1 2347 d ,40mm 1/2 circle cut,tapper, heavy,double needle, 180 cm, pga absorble,suture 1608 inj. myopyrolate 5ml ampule 1609 inj. pheneramine malate 1610 paracetamol suppository 400 mg 1611 inj. voluven 1612 endotrachial tube 3.5; ( uncuffed) 1613 endotrachial tube 4; ( uncuffed) 1614 endotrachial tube 4.5; ( uncuffed) 1615 endotrachial tube 5; ( uncuffed) 1616 endotrachial tube 5.5; ( uncuffed) 1617 endotrachial tube 5.5; 1618 endotrachial tube 6.5; 1619 endotrachial tube 7; 1620 endotrachial tube 7.5; 1621 endotrachial tube 8; 1622 endotrachial tube 8.5; 1623 glycine 1.5% 3 litre bottle 1624 normal saline 0.45% 3 litre bottle 1625 inj. carboprost / prostodin 1626 inj. methergin 0.24 1627 inj. pitocin 1628 inj.human chorionic ganadotraphin 5000u, 2000u 1629 tab. cabergoline 1630 tab. bromocriptine 50 mg, 25 mg 1631 tab. letrozole 2.5 mg 1632 tab. pyridoxine 25 mg 1633 tab. perinorm 1634 inj . methotrexate 1635 tab. methotrexate 1636 acetic acid 1 % 1637 lugol’s lodine 1638 tolmdine blue 1639 formalin solution 5 lit. 1640 sodium hypochlorite solution or bleaching power 1641 inj. vitamin k 1642 xylocaine 2 % multidose vial for labour room 1643 inj. tranexa 1644 inj. buscopan 1645 inj. drotaverine 1646 inj. mgso4 1647 inj. largactil 1648 inj. phenargan 1649 inj. duvadilon ( lsoxsuprine) 1650 inj. labetolol 1651 tab. labetolol 1652 inj. hydrallazine 1653 inj. phenytoin sodium 1654 tab. medroxy progesteione acetrate 10 mg 1655 ear buds 1656 ear speculum (set) 1657 flying cacher 1658 foreign body spud ear 1659 foreign body spud nasal/ 1660 franulum retractor 1661 fumigator 1662 liquid soap 500ml 1663 oxyagen flow meter (rotometer) 1664 oxygen cylender key 1665 thermometer 40 digree 1666 scissor encleation (medium) 1667 scissors big (tailor type) 1668 shoe rack affordable, stackable 6 tier storage shoe rack holds up to 24 shoes, made from metal and plastic 34w x 11d x 41h 1669 sonography jelly 500 ml 1670 sonography jelly 5 lit. 1671 steel bowel 10 1672 steel bowel 4 1673 steel bowel 8 1674 steel container for general use 2 lit with led 1675 steel container for general use 5 lit with led 1676 steel container for general use 10 lit with led 1677 steel container for general use 20e lit with led 1678 steel/iron rack four selves 1679 strecher trolley deluxe 1680 three bucket trolly for cleaning/moping 1681 vein spy equipment 1682 walker non folding 1683 walker folding 1684 walking stick 3/4 base 1685 walking stick double grig 1686 walking stick single base 1687 walking stick single grip 1688 ward linen trolly 1689 new born sheet 1690 alcoho; based hand rub 70% 1691 sensorcaine vial 1692 vintolin injection 500 mcg 1693 low molecular weight heparin 40 mg 1694 low molecular weight heparin 60 mg 1695 p.t.inr test kit (beccon) 1696 pap smear kit 1697 stethoscope 1698 formalin solution per litres 1699 glycerine per litre 1700 distilled water per litre 1701 phenol per litre 1702 histology slides for histology lab set of 60 slide 1703 benedict’s reagent per litres 1704 acetic acid 10% per litres 1705 litmus paper 1706 ammonium sulphate 1707 sodium nitroprusside 1708 liquor ammonia per litres 1709 sulphur powder (fine) 1710 wbc diluting fluid per litres 1711 rbc diluting fluid per litres 1712 leishmann stain per litres 1713 dextrose powder per pack 1714 xylene per litres 1715 paraffin wax per kg 1716 nitric acid per litres 1717 haematoxylin& eosin stain per litres 1718 dpx mount pre bottle 1719 egg albumin pre bottle 1720 ethanol (absolute) per litres 1721 rapid pap stain pre bottle 1722 may grunwald giemsa stain (mgg)per litres 1723 ziehl neelsen stain( zn stain) pre bottle 1724 glass slides (sunbeam–frosted) 1725 cover slip (glass) 22 x 40 1726 cover slip (glass) 22 x 60 1727 field stain pre bottle 1728 filter paper per pack 1729 bloating paper per pack 1730 distilled water per litres 1731 reticulocyte solution (new methylene blue) pre bottle 1732 fitefaraco stain per litres 1733 grocott’smethamine silver (gms) stain pre bottle 1734 india ink per litres 1735 sodium metabisulphite pre bottle 1736 liquid paraffin pre bottle 1737 pas (periodic acid schiff) stain pre bottle 1738 edta vacutainer (purple top) per piece 1739 sodium citrate vacutainer (light blue top) 1740 multistix 10 sg (10 parameter urine analysis strip) 1741 glucose per pack of 100 test god pod 1742 urea per pack of 100 test gldh 1743 creatinine per pack of 100 test modified jaffe’s 1744 billirubin (total and direct) per pack of 100 test diazo 1745 sgpt per pack of 100 test nadh oxidation 1746 sgot per pack of 100 testnadh oxidation 1747 alp per pack of 100 test nitrophenyl phosphate 1748 total protein per pack of 100 test biuret 1749 albumin per pack of 100 test bcg 1750 total cholesterol per pack of 100 test chod pod 1751 triglyceride per pack of 100 test trinder 1752 hdl per pack of 100 test direct 1753 ldl per pack of 100 test direct 1754 uric acid per pack of 100 test uricase pod 1755 uristix ( strips for qualitative urine ketone bodies and protein detection)1/100 1756 troponin i qualitative kit 1/100 1757 troponin t qualitative kit 1/100 1758 ck mb per pack of 100 testnadp reduction 1759 t3 per pack of 100 testimmunoturbidimetry (biomerieux) 1760 t4 per pack of 100 testimmunoturbidimetry (biomerieux) 1761 tshimmunoturbidimetry (biomerieux) 1762 amylase per pack of 100 test for semiautomated biochemistry analyser 1763 lipase per pack of 100 test for semiautomated biochemistry analyser 1764 ldh per pack of 100 test for semiautomated biochemistry analyser 1765 sodium per pack of 100 test for semiautomated biochemistry analyser 1766 potassium per pack of 100 test for semiautomated biochemistry analyser 1767 distilled water per litres 1768 vacutainer (plain) red coloured cap 1/100 1769 vacutainer (fluoride) grey coloured cap 1/100 1770 sterilium per litres 1771 microtips (10 200 µl)1/100 1772 microtips (100 1000 µl)1/100 1773 micro and macro tips stand1/100 1774 micro pipettes (10 100 µl) per piece 1775 micro pipettes (20 200 µl) per piece 1776 micro pipettes (100 1000 µl)per piece 1777 micro pipettes (0.5 50 µl)per piece 1778 micro pipettes standper piece 1779 glass tubes small 5ml 1780 rubber pipette bulb (25 ml)per piece 1781 rubber pipette bulb (60 ml size)per piece 1782 pipette fillersper piece 1783 bottle top dispenserper piece 1784 acetone2.5 litre x 1 1785 acetic acid 2.5 litre x 1 1786 liquid ammonia500 ml x 1 1787 ammonium chloride 500 gm x1 1788 100 gm x 1 1789 alpha naphthol 100 gm x 1 1790 ammonium molybdate 500 gm x1 100 gm x 1 1791 ammonium oxalate 500 gm x1 1792 agar powder 500 gm x1 1793 barium chloride 500 gm x1 1794 benzoic acid 500 gm x1 1795 benzidine powder 100 gm x 1 1796 bovine albumin 5 gm x1 1797 benedicts reagent 5 litre x 1 1798 barfoeds reagent 125 ml x 1;500 ml x 1 1799 bromine water 500 ml x 1 1800 bile salt 500 gm x1 1801 boric acid 500 gm x1 1802 butanol 500 ml x 1 1803 copper sulphate 500 gm x1 1804 calcium carbonate 500 gm x1 1805 calcium chloride 500 gm x1 1806 citric acid500 gm x1 1807 chloroform 500 gm x1 1808 carbolic acid/ phenol 500 gm x1 1809 cupric acetate 500 gm x1 1810 disodium hydrogen phosphate 500 gm x1 1811 dipotassium hydrogen phosohate 500 gm x1 1812 dextrose 500 gm x1 1813 dextrin 500 gm x1 1814 ethanol 500 ml x 1 1815 esbachs reagent 125 ml x 1 1816 egg albumin powder 1817 d fructose250 gm x 1 1818 formaldehyde solution 500 ml x 1 1819 formic acid 500 ml x 1 1820 fehlings solution a 500 ml x 1 1821 fehlings solution b 500 ml x 1 1822 ferric chloride 500 gm x1 1823 ferric ammonium sulphate 500 gm x1 1824 fouchets reagent 125 ml x 1 1825 gelatin 500 gm x 1 1826 hydrochloric acid(hcl) 2.5 litre x 1 1827 hydrogen peroxide 500 ml x 1 1828 iodine crystals 100 gm x 1 1829 lead acetate trihydrate 500 gm x1 1830 lactose 500 gm x1 1831 mercuric chloride 100 gm x 1 1832 mercuric nitrate 100 gm x 1 1833 methyl red 25 gm x 1 1834 methylene blue 125 ml x 1; 100 ml x 1 1835 magnesium sulphate 500 gm x1 1836 methanol 500 ml x 1 1837 mercuric sulphate100 gm x 1 1838 molischs reagent500 ml x 1 1839 maltose 250 gm x 1 1840 millons reagent500 ml x 1 100 ml x 1 1841 ninhydrin 10 gm x 1 1842 ninhydrin reagent 500 ml x 1 1843 ortho toludine 100 gm x 1 1844 potassium hydroxide 500 gm x1 1845 potassium dichromate 500 gm x1 1846 potassium chromate 500 gm x1 1847 potassium iodide500 gm x1 250 gm x 1 1848 phenopthaleine indicator 100 ml x 1 1849 phenol red 100 ml x1 1850 potassium chloride 500 gm x1 1851 potassium dihdrogen phosphate 500 gm x1 1852 potassium ferricyanite 500 gm x1 1853 phenylhydrazine 250 gm x 1 1854 peptone 500 gm x1 1855 picric acid 500 gm x1 1856 resorcinol 500 gm x1 1857 sodium hydroxide 500 gm x1 1858 sucrose 500 gm x1 1859 sulphosalicylic acid 500 gm x1 1860 sodium dithionite 500 gm x1 1861 sodium nitrite 500 gm x1 1862 sodium nitrate 500 gm x1 1863 sodium acetate 500 gm x1 1864 sodium carbonate 500 gm x1 1865 sodium bicarbonate 500 gm x1 1866 starch 500 gm x1 1867 sodium chloride 500 gm x1 1868 sodium sulphate 500 gm x1 1869 silver nitrate100 gm x 1 1870 sodium hydrogen carbonate 500 gm x1 1871 sulphuric acid 2.5 litre x 1 1872 seliwanoffs reagent 125 ml x 1 1873 sodium citrate 500 gm x1 1874 sodium potassium tartarate 500 gm x1 1875 sodium nitroprusside 100 gm x 1 1876 trichloro acetic acid 500 gm x1 1877 zinc oxide 500 gm x1 1878 nitric acid 500 ml x 1 1879 phenylhydrazine hydrochloride 250 gm x 1 1880 bromophenol blue 125 ml x 1 1881 1 amino 2 naphthol 4 sulphonic acid 25 gm x 1 1882 2,4 dinitrophenyl hydrazine 100 gm x 1 1883 2 amino 2 methyl 1 propanol 500 ml x 1 1884 4 amino antipyrine 100 gm x 1 1885 8 hydroxyquinoline 100 gm x 1 1886 alpha ketoglutaric acid 25 gm x 1 1887 bromocresol green 5 gm x 1 1888 cholesterol 25 gm x 1 1889 creatinine 5 gm x 1 1890 diacetylmonoxime 25 gm x 1 1891 disodium phenyl phosphate 25 gm x 1 1892 ehrlich’s aldehyde reagent 100 ml x 1 1893 glycine 5 gm x 1 1894 l alanine 5 gm x 1 1895 l aspartic acid 5 gm x 1 1896 l leucine 10 gm x 1 1897 l proline 5 gm x 1 1898 nessler’s reagent 100ml x 1 1899 o cresolphthalein 25 gm x 1 1900 oxaloacetate 5 gm x 1 1901 ph indicator papers ph range 1 14 1 pack 1902 ph indicator papers ph range 3.5 6.0 1 pack 1903 ph indicator papers ph range 6.5 9.0 1 pack 1904 phosphotungstic acid 100 gm x 1 1905 potassium thiocyanate 500 gm x1 1906 sodium hypobromite solution 100 ml x 1 1907 sodium pyruvate 25 gm x 1 1908 sodium tungstate 100 gm x 1 1909 sulphanilic acid 100 gm x 1 1910 tartaric acid 100 gm x 1 1911 thiosemicarbazide 25 gm x 1 1912 unconjugated bilirubin 1 gm x 1 1913 urea 500 gm x1 1914 uric acid 25 gm x 1 1915 whatman paper no. 1 100 nos. x 1 1916 test tubes 12 × 100 mm (borosil) 1917 test tubes12 × 75 mm(borosil) 1918 test tubes18 × 150 mm(borosil) 1919 sterile, autoclavablepetriplates,optical clear) (gamma irradiated)100 mm × 15 mm pack of 20 plates(borosil) 1920 glass slide 75×25×1 mm(borosil) 1921 cover slip (microscope cover glass)22x22 mm(borosil) 1922 conical flask (flat bottam)2000 cc(borosil) 1923 conical flask (flat bottam)1000 cc(borosil) 1924 conical flask (flat bottam)500 cc(borosil) 1925 conical flask (flat bottam)250 cc(borosil) 1926 conical flask (flat bottam)100 cc(borosil) 1927 conical flask (flat bottam)50 cc(borosil) 1928 glass rod 1929 measuring jar500 ml(borosil) 1930 measuring jar100 ml(borosil) 1931 glass volumetric pipette1 ml(borosil) 1932 glass volumetric pipette5 ml(borosil) 1933 petri plates (glass) (pack of 10 plates)100 x 15 mm(borosil) 1934 tuberculin syringe 1/100 pack 1935 sterile cotton swab in screw capped plastic tubes himedia75mm packed in 12 mm tube per piece 1936 sterile cotton swab sticks himedia pack 1937 urine container 1/100(30 ml) 1938 stool container 1/100(50 ml) 1939 micropipette tips (nucleases autoclavable polystyrene free (500 µl 1000 µl) 1 / 1000 tips 1940 micropipette tips (nucleases autoclavable polystyrene free) (1µl 500 µl)1/1000 1941 dropping bottle (plastic) per p 1942 filter paper (46×57 cm) 1/50big sheet 1943 forcep (pointed) 1944 teasing needle 1945 metal loop holder (w/o loop) any size of nichrome wire can be inserted 1×24pack 1946 antibiotic zonescale per psize 370 mm×65 mm 1947 cleaning brush for test tubes nylon material 1948 spatula128 1949 concavity slide (1 cavity) 1950 spirit lamp 1951 filter paper (watsmen no 6) pack 1952 cotton bundle roll 1953 plastic tray 24x18x6 1954 test tube racks for 12 × 100 mm tubes 1955 test tube racks for 12 × 75 mm tubes 1956 test tube racks for 18 × 150 mm tubes 1957 steam indicatortape 1 no 1958 serum vials 1 pack of 500 vials 2ml 1959 screw capped plastic tubes 1 pack of 500 vials 1960 serum vial stand (for 2 ml vials) 1961 durham’s tube 1 pack of 500 1962 multichannel pipette (50 ul 300 ul) 1963 micropipette tip stand(1µl 500 µl 1964 micropipette tips stand (500 µl 1000 µl) 1965 acetone 500 ml 1966 alberts metachromatic stain kit (stain a &b) 500 ml 1967 barium chloride 500 gm 1968 carbol fuchsin 25gm 1969 phenol (crystal) 500 gm 1970 cedar wood oil 30ml. 30ml 1971 distilled water 5 ltr 1972 ethanol absolute , 500 ml 5lit 1973 crystal violet 125 ml 1974 methylene blue solution 25 gm 1975 ph paper range 2 10.5 1976 saffranin 125 ml 1977 spirit 500 ml 1978 sulphuric acid conc. 5 ltr 1979 gram stain kit 1980 liquid paraffin 500ml 1981 tissue paper / laboratory paper 50 role 1982 xylene 500 ml 1983 hydrogen peroxide 3% 1 lit 1984 lactophenol cotton blue stain 100 ml 1985 hydrochloric acid conc. 500 ml 1986 india ink stain 100 ml 1987 potassium hydroxide pellets 500 gm 1988 sodium hydroxide 500 gm 1989 nichrome wire loop 2mm 1990 nichrome wire loop 4mm 1991 aluminium foil roll 500 gm 1992 kovacs reagent (for indole test) 100 ml 1993 grams iodine 125 ml 1994 blood culture bottle (adult) (hi media) 70 ml 1995 blood culture bottle (pediatric) (himedia) 20 ml 1996 sodium hypochlorite solution 5 lit 1997 haem test kit ( stool for occult blood test) 1 pack of 200 test 1998 rapid afb stain kit (ba1523, 2x100ml (biolab) 100 ml 1999 lugol’s iodine 125 ml/ bottle 2000 golves (7.5 no) 50 pairs/ pack 2001 liquid soap 500 ml 2002 hand sanitizer 2003 vaccutainers (plain) red coloured cap 100 /pack 2004 triple sugar iron agar 500 gm mo21 500g, hi media 2005 peptone 500 gm rm667 500g, hi media 2006 agar agar powder 500 gm rm026 500 g, hi media 2007 bile esculin agar (mv972) 100 gm m340 100 g, hi media 2008 cooked meat medium 500 gm m149 500g, hi media 2009 fluid thioglycolate medium 500 gm mm009 500g, hi media 2010 deoxycholate citrate agar 500 gm m065 500 g,hi media 2011 mac conkey agar 500 gm m081 500g, hi media 2012 mannitol salt agar base 100gm m118 100 g,hi media 2013 sabouroudcyclohexamide agar 500 gm m063 500 g, hi media 2014 simmons citrate agar 500 gm m0009 500 g, hi media 2015 tcbs agar 500 gm m189 500 g, hi media 2016 urea 40% fd048 10 ml hi media 2017 urea agar base 500 gm m112 500g, hi media 2018 ready water testing kit k015 hi media 2019 tuberculin p.p.d 1 tu hi media 2020 nutrient agar 500 gm m877 500g, hi media 2021 meuller hinton agar 500 gm m1084 500 gm 2022 brain heart infusion broth 500gm 10210 500g 2023 spore strips 25 strips/pack dd032 1pk 2024 glucose broth 500 gm pack himedia m 860 2025 l j media 10 bottles/ box himedia sl 001 10sl 2026 field stain kit 1 himediak 011l 2027 ferric chloride 500 gm himedia rm1379 2028 mr vp broth 100 gm himedia m070 2029 methyl red indcator 125 ml bottle himedia 1007 2030 glucose 500 gm himedia 2031 lactose 500 gm 2032 sucrose 500 gm himedia 2033 mannitol disk 1 vial dd006 1vl 2034 corn meal agar 100 gm himedia m146 100g 2035 moeller decarboxylase broth lysine 100 gm m687 100g 2036 moeller decarboxylase broth ornithine 100 gm m688 100g 2037 moeller decarboxylase broth arginine 100 gm m689 100g 2038 phenol red broth base 500 gm m054 500g 2039 sodium chloride 500 gm rm853 500g 2040 beef extract powder 500 gm rm669 500g 2041 glucose phosphate broth 100 gm m070 100g 2042 barritt reagent a 100 ml r029 100 ml 2043 barritt reagent a 100 ml r030 100 ml 2044 macconkey double strength broth 500 gm hi media 2045 amikacin antibiotic disc 30mcg sd035 5vl himedia 2046 amoxyclav antibiotic 20+10mcg sd063 5vl himedia 2047 ampicillin antibiotic 10mcg sd002 5ct himedia 2048 aztreonam antibiotic disc 30mcg sd212 5ct himedia 2049 ampicillin + sulbactum antibiotic disc (10+10)mcg sd112 5ct himedia 2050 bacitracin 0.04 unit dd015 1vl himedia 2051 cefotaxime antibiotic disc 30mcg sd040 himedia 2052 cefoxitin antibiotic disc 30mcg sd041 himedia 2053 clindamicin antibiotic disc 2mcg sd051 5ct himedia 2054 cefotaxime + clavulanic acid antibiotic disc (30+10)mcg sd724 5ct himedia 2055 ceftazidime + clavulanic acid antibiotic disc (30+10)mcg sd207 5ct himedia 2056 cefalexin 30 mcg sd048–5ct himedia 2057 ceftriaxone antibiotic disc 30mcg sd065 – 5ct himedia 2058 cefazoline antibiotic disc 30mcg sd047 5ct himedia 2059 cefepime antibiotic disc 30mcg sd219 5vl himedia 2060 cefuroxime antibiotic disc 30mcg sd061 5ct himedia 2061 chloromphenicol antibiotic disc 30mcg sd006 5vl himedia 2062 ciprofloxacin antibiotic disc 5mcg sd060 5vl himedia 2063 cefixime 30mcg sd211 5ct himedia 2064 colistin e strip (0.5) 10mcg em020 30st himedia 2065 ceftazidime 30mcg sd062 5vl himedia 2066 co trimaxazole (1.25+23.75)mcg sd010 5vl himedia 2067 cefoperazone sulbactum 75/10mcg sd254 5ct hi media 2068 doxycycline 30mcg sd012 5vl himedia 2069 imipenam antibiotic disc 10mcg sd073 5vl himedia 2070 imipenam + edta antibiotic disc (10+750)mcg himedia 2071 ertapenem antibiotic disc 10mcg sd280 5vl himedia 2072 levofloxacin antibiotic disc 5mcg sd216 – 5vl himedia 2073 linezolid antibiotic disc 30mcg sd215 5ct himedia 2074 meropenam antibiotic disc 10mcg sd727 5vl himedia 2075 moxifloxacin 5mcg sd217 5ct himedia 2076 h.s gentamicin 120mcg sd195 1vl himedia 2077 netilmicin antibiotic disc30mcg sd085 5ct himedia 2078 nitrofurantoin antibiotic disc 300mcg sd023 5vl himedia 2079 norfloxacin antibiotic disc 10mcg sd057 5vl himedia 2080 nalidixic acid antibiotic disc 30mcg sd021 1vl himedia 2081 ofloxacin antibiotic disc 5mcg sd087 5ct himedia 2082 optochin antibiotic disc 5mcg dd009 1vl himedia 2083 oxidase disc antibiotic disc dd018 1vl himedia 2084 penicillin g antibiotic disc 10 units sd028 5ct himedia 2085 piperacillin antibiotic disc 100mcg sd066 5ct himedia 2086 piperacillin/tazobactum antibiotic disc (100+10)mcg sd210 5vl himedia 2087 polymyxin b e strip part a 240 .01mcg part b32 .001mcg/ml em043 30sthimedia 2088 polymyxin b 50mcg himedia 2089 tigecycline antibiotic disc 15mcg sd278 5ct himedia 2090 novobiocin 5mcg himedia 2091 gentamicin 10mcg sd016 5vl himedia 2092 teicoplanin antibiotic disc 30mcg sd213 5ct himedia 2093 tetracycline antibiotic disc 30mcg sd037 5vl himedia 2094 tobramycin antibiotic disc 10mcg sd044 5vl himedia 2095 vancomycin antibiotic disc 30mcg sd045 5ct himedia 2096 vancomycin e strip 256 .015mcg/ml em060 30st himedia 2097 fosfomycin 200mcg sd179 5vl himedia 2098 azithromycin 15mcg sd204 himedia 2099 erythromycin 15mcg sd013 5ct himedia 2100 hbsag test kit 10 tests/ kit 2101 hcv test kit 10 tests/ kit 2102 rpr test kit 25 tests (5 ml reagent)/ kit 2103 malaria ag (pv/pf) test kit 10 tests/ kit 2104 widal slide agglutination test kit 25 tests (5 ml reagent)/ kit 2105 dengue ns1 antigen elisa 96 tests/ kits 2106 ra factor test kit 25 tests (5 ml reagent)/ kit 2107 aso titre test 25 tests (5 ml reagent)/ kit 2108 crp test 25 tests (5 ml reagent)/ kit 2109 widal tube agglutination test 25 tests (5 ml reagent)/ kit 2110 torch elisa 1/96 test 2111 hbeag strip rapid card test 10 tests/ kit 2112 hepatitis a rapid card test 10 tests/ kit 2113 weil felix tube agglutionation test 25 tests (5 ml reagent)/ kit 2114 atcc strain enterococcus fecalis 29212 pack of 2 swabs himedia – 0366 p 2115 atcc strain e.coli 25922 pack of 2 swabs himedia 0335 p 2116 atcc strain e.coli 35218 pack of 2 swabs himedia – 0495 p 2117 atcc strain pseudomonas aeruginosa 27853 pack of 2 swabs himedia 0353 p 2118 atcc strain staphylococcus aureus 25923 pack of 2 swabs himedia 0360 p 2119 atcc strain staphylococcus aureus 29213 pack of 2 swabs himedia – 0365 p 2120 atcc klebsiella pack of 2 swabs himedia – 01005 p 2121 pneumoniae baa 1705 2122 atcc klebsiella pack of 2 swabs himedia 0784 p 2123 pneumoniae 700603 2124 atcc candida albicans 10231pack of 2 swabs himedia 0443 p 2125 atcc candida tropicalis 750 pack of 2 swabs himedia 0767 p 2126 antisera salmonella 1 set 2127 antisera – shigella dysenteriae 2128 antisera – shigella flexnari 2129 antisera – shigella sonnie 2130 antisera vibrio cholerae 1 set 2131 methylene blue stain 100ml 2132 carbol fuschin(strong) 100ml 2133 sulfuric acid(conc.) per liter 2134 ecg electrode (disposal) other 2135 electric setlizier 10*5 other 2136 electric setlizier 14*5 other 2137 electric setlizier 16*5 other 2138 electric setlizier 18*5 other 2139 electric setlizier 20*5 other 2140 reusable preformed supraglotic airway device with sizes 1, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2141 reusable preformed supraglotic airway device with sizes 1.5, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2142 reusable preformed supraglotic airway device with sizes 2, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2143 reusable preformed supraglotic airway device with sizes 2.5, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2144 reusable preformed supraglotic airway device with sizes 3, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2145 reusable preformed supraglotic airway device with sizes 4, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2146 reusable preformed supraglotic airway device with sizes 5, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2147 reusable preformed supraglotic airway device with sizes 6, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2148 supraglotic airway device with integrated gastric access and intubation : 2149 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 1 usfda ce & iso certified 2150 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 1.5 usfda ce & iso certified 2151 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 2 usfda ce & iso certified 2152 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 2.5 usfda ce & iso certified 2153 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 3 usfda ce & iso certified 2154 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 4 usfda ce & iso certified 2155 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 5 usfda ce & iso certified 2156 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 6 usfda ce & iso certified 2157 manual resuscitators with built in pressure limitation – adult withface mask of size 3/4 & 5,o2 tidal volume 1300 ml, reservoir volume 1500 ml; 100% latex free & double layered. built in pressure limitation, single shutter valve, integrated hand strap, autoclavable, provision to attach peep valve. usfda ,ce & iso certified 2158 manual resuscitators with built in pressure limitation – paediatric/neonatewith face mask of size 0 & 2 max. tidal volume 300 ml; volume of o2 reservoir 1500 ml/volume 100% latex free outer cover & double layered. single shutter valve, integrated hand strap, autoclavable ,pressure limiting valve ,provision to attach pressure manometer, usfda ,ce & iso certified 2159 ecg electrodes with offset connector. highly conductive wet gel , combination of instant and long term adhesives ,breathable micro porous material ,special soft spongeoffset connector concept, high quality ag/ agcl sensor 2160 fibreless video scope, available with three optional sizes of inner diameter 1.2mm, 2.2mm & 2.8 mm, should have suction port & oxygen delivery port, should be usfdashould be compatible with a view monitor of size 8.5 inches with 8 gb memory. 2161 airway visualization system (adult): display monitor with video output capability. work on aaa consumable batteries & runs continuously upto 90 mints. can work on reusable batteries too if required, anti fog lens with white led light source, supplied with 3pcs of size 3 channelled and 1 pc of size 3 non channelled blades, 510 k , iso & ce certified 2162 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 18, 2163 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 20, 2164 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 22, 2165 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 24, 2166 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 26, 2167 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 28, 2168 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 30, 2169 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 32, 2170 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 34, 2171 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 36, 2172 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 38, 2173 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 40, 2174 broad spectrum antimicrobial/ antibacterial/ double lumen polyurethane cvc catheter kit, catheter and extension line along with hub should be impregnated. kit should contain fr 7, g 14x18, l 16cm.with j guide wire, rollerson, syringe, dilator, scalpel. needle free cannula transduction probe, catheter stabilization device. 2175 broad spectrum antimicrobial/antibacterial triple lumen polyurethane cvc catheter, catheter and extension line along with hub should be impregnated. kit should contain fr 7, g 16x18x18, l 16cm. with j guide wire, rollerson, syringe, hub stopper impregnated with 70% isopropyl alcohol swab dilator, scalpel. needle free cannula, transduction probe, catheter stabilization device 2176 broad spectrum antimicrobial/antibacterial double lumen polyurethane hd catheter, catheter lumen and extension line along with hub should be impregnated. kit should contain fr 12, l 13cm. with j guide wire, rollerson syringe with dilator, scalpel. needle free cannula, transduction probe, catheter stabilization device. 2177 broad spectrum antibacterial /antifungal triple lumen polyurethane hd catheter, catheter and extension line along with hub should be impregnated. kit should contain fr 12, l 16cm. with j guide wire, rollerson syringe, dilator, scalpel. needle free cannula, transduction probe,catheter stabilization device. 2178 hydrocolloid scar free nasal pads to prevent cpcp, bipap, and oxy mask, to avoid pressure ulcers or bruises on the nose. sizes s/l. ce certified. 2179 hemostatic dressing in sponge/ pad from made of 100% natural biopolymer with a net positive charge, gama sterilized and moisture proof. usfda approved. sizes 5*5, 2180 hemostatic dressing in sponge/ pad from made of 100% natural biopolymer with a net positive charge, gama sterilized and moisture proof. usfda approved. sizes 8*8 2181 urethral catheter made up of soft color less,clear, breathable, odorless, 2182 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 8, should be us fda approved. 2183 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 12, should be us fda approved. 2184 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 14, should be us fda approved. 2185 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 16, should be us fda approved. 2186 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 18, should be us fda approved. 2187 non absorbable polymer locking clips provide cool secure ligation; clip locks onto the vessel. clip sizes medium, medium large, large and extra large. the non absorbable polymer clip is inert, nonconductive, radiolucent, and does not interfere with ct or x ray diagnostics. fda approved 2188 multifunctional mask with the multiple integrated attachment of nebulizer mask, venture mask, oxygen mask, with 7” double oxygen tube. should have oxygen outlet diverter and fenestration opening slits on both sides. fda approved 2189 polymer ligation device with locking mechanism, sterile, radiolucent property, usfda approved. cartridges should have self adhesive backing.sizes a medium large polymer ligation device. 2190 polymer ligation device with locking mechanism, sterile, radiolucent property, usfda approved. cartridges should have self adhesive backing. sizes b medium large polymer ligation device. 2191 polymer ligation device with locking mechanism, sterile, radiolucent property, usfda approved. cartridges should have self adhesive backing.sizes c medium large polymer ligation device. 2192 sizes a 8 inch in size with curved for ml/ l/ xl. 2193 b 11 inch in size with right angle 70° 2194 endo applicator matt finishing stainless steel applier, with us fda approvedsizes a 32.5cm for ml/ l/ xl 2195 endo applicator matt finishing stainless steel applier, with us fda approvedsizes b 45cm for ml/ l/ xl 2196 micro titanium ligation device with locking mechanism, sterile, usfda approved. cartridges should have self adhesive backing. 2197 sizes 6” and 8” 2198 postpartum hemorrhage balloon silicon catheter for control of obstetrical bleeding or management of pph. size 24fr, length 54cm,balloon capacity 500ml, fda approved 2199 cervical ripering balloon for mechanical dilation l 40cm. fr. 18, balloon capacity 80ml. 2200 pur catheter non shrinkable iv line with prefilled 70% isopropyl alcohol cap for peripheral veins. xro, and with non return valve 2201 short iv catheter for neonates with straight guide wire. g 22, l 10, 12cm 2202 arterial catheter with floswitch and straight guide wire, g 18, l 6/13cm 2203 short ptfe material emergency catheter with floswitch and stabilising device. g 14, l 13 16mm. 2204 reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. 2205 suture free securement hydrocolloid device s 2206 suture free securement hydrocolloid device m 2207 suture free securement hydrocolloid device l 2208 medicated catheter stabilization device with medical grade pvc clamp should have id tag s 2209 medicated catheter stabilization device with medical grade pvc clamp should have id tag m 2210 medicated catheter stabilization device with medical grade pvc clamp should have id tag l 2211 vascular haemostatic pad to stop external bleeding and catheterization site bleeding , should be 100% chitosin material, size 2”x2” single pack. sterilized. 2212 paracain eye drop 0.5% 2213 trypan blue dye 0.4% 2214 plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete 2215 spectacles fornschool childremna. frame material ployflex unbreakable frame with all different sizes suitable for children(from 8 20 yrs).nb. lenses cr hardcoated lenses (fiber) of prescribed case plastic case printed as followos nname of the district.......nnpcb & vi, nmadhya pradeshnnot for salend. accessiores ni. dori, nii. cleaning cloth(slevet),niii. prescription card,n 2216 screening and free spectacles for near work to old personna. frame material ployflex unbreakable frame with all different sizes suitable for old personnb. lenses cr hardcoated lenses (fiber) of prescribed case plastic case printed as followos nname of the district.......nnpcb & vi, nmadhya pradeshnnot for salend. accessiores ni. dori, nii. cleaning cloth(slevet),niii. prescription card,n 2217 spectacles after cataract surgery (where bifocal lens will be needed) na. frame material ployflex unbreakable frame with all different sizes suitable for cataract patient.nb.lenses cr hardcoated lenses (fiber) of prescribed case plastic case printed as followos nname of the district.......nnpcb & vi, nmadhya pradeshnnot for salend.accessiores ni. dori, nii. cleaning cloth(slevet),niii. prescription card,n 2218 gastro intestinal anastomotic stapler 60 mm with dual firing knob and inbuilt knife in every cartridge,gia6038s,gia6048s,gia6025s 2219 gastro intestinal anastomotic stapler 80 mm with dual firing knob and inbuilt knife in every cartridge,gia8038s,gia8048s 2220 gastro intestinal anastomotic stapler 100 mm with dual firing knob and inbuilt knife in every cartridge,gia10038s,gia10048s 2221 gastro intestinal anastomotic 60 mm cartridge with fresh knife white/blue/green,gia6025l,gia6038l,gia6048l 2222 gastro intestinal anastomotic 80 mm cartridge with fresh knife white/blue/green,gia8038l,gia8048l 2223 gastro intestinal anastomotic 100 mm cartridge with fresh knife white/blue/green,gia10038l,gia10048l 2224 reusable gastro intestinal anastomotic stapler 60 mm with dual firing knob and inbuilt knife in every cartridge,gia60rs 2225 reusable gastro intestinal anastomotic stapler 80 mm with dual firing knob and inbuilt knife in every cartridge,gia80rs 2226 gastro intestinal anastomotic 60 mm cartridge with fresh knife white/blue/green for reusable stapler,gia6025rl,gia38rl,gia6048rl 2227 gastro intestinal anastomotic 80 mm cartridge with fresh knife white/blue/green for reusable stapler,gia8038rl,gia8048rl 2228 curved end to end anastomotic stapler 25 mm with tilt top anvil 2229 curved end to end anastomotic stapler 28 mm with tilt top anvil 2230 curved end to end anastomotic stapler 31 mm with tilt top anvil,eea31 circular stapler 2231 curved end to end anastomotic stapler 33 mm with tilt top anvil,eea33 circular stapler 2232 endo gastro intestinal anastomotic universal stapler can accommodate all sizes of cartridges also both straight and roticulator cartridges 2233 bladeless trocar 5mm/11mm/ 12mm,nonb12sts,nonb5stf 2234 optical bladeless trocars 5 mm / 11mm/12mm/15mm,onb12sts,onb5stf 2235 hemorrhoid stapler 33 mm diametre with detachable anvil and staple height 3.5 mm,hem3335 2236 hemorrhoid stapler 33 mm diametre with detachable anvil and staple height 4.8 mm,hem3348 2237 appose ulc skin stapler with 35 wide staples 2238 premium single use skin stapler remover 2239 med wound protector 5 9cm,wpsmd509 2240 sml wound protector 2.5 6cm,wpsm256 2241 premium surgiclip iii 9.0 2242 3x6 endobag specimen retrieval 2243 5 x 8 endobag specimen retriev 2244 endo clip* ii med/lrg applier 2245 premium surgiclip* ii m 9.75 2246 premium surgiclip* ii m 11.5 2247 fred anti fog kit 2248 monofilament glycomer 631* 3 0 75cm , undyed 24mm 3/8 circle reverse cutting 2249 monofilament glycomer 631* 0 75cm , undyed 37mm 1/2 circle reverse cutting 2250 monofilament glycomer 631* 2 0 75cm , undyed 37mm 1/2 circle reverse cutting 2251 monofilament glycomer 631* 0 ,150cm loop , violet 40mm 1/2 circle taper point 2252 monofilament glycomer 631* 1 ,90cm , violet 40mm 1/2 circle taper point 2253 monofilament glycomer 631* 2 0 75cm , violet 26mm 1/2 circle taper point 2254 monofilament polyglyconate* 3 0 75cm , green 20mm 1/2 circle taper point 2255 monofilament polyglyconate* 1, 150cm loop, green 40mm 1/2 circle taper point 2256 monofilament polyglyconate* 1 90cm , green 48mm 1/2 circle taper point 2257 monofilament polyamide * 1 150cm , loop , black 48mm 1/2 circle taper point 2258 coated,braided lactomer 91* 3 0 75cm , undyed 24mm 3/8 circle reverse cutting 2259 coated,braided lactomer 91* 3 0 75cm , violet 22mm 1/2 circle taper point 2260 coated,braided lactomer 91* 0 90cm , violet 37mm 1/2 circle reverse cutting 2261 coated,braided lactomer 91* 2 0 90cm , violet 37mm 1/2 circle reverse cutting 2262 coated,braided lactomer 91* 0 90cm , violet 40mm 1/2 circle reverse cutting 2263 coated,braided lactomer 91* 1 90cm , violet 40mm 1/2 circle reverse cutting 2264 180 absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry * 0 45cm , green 37mm 1/2 circle taper point 2265 180 absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry * 2 0 30cm , green 37mm 1/2 circle taper point 2266 90 glycomer 631 knotless wound closure device with unidirectional & dual angled cut barbs geometry 3 0 58cm , undyed 24mm 3/8 circle reverse cutting 2267 90 glycomer 631 knotless wound closure device with unidirectional & dual angled cut barbs geometry 3 0 45cm , undyed 24mm 3/8 circle reverse cutting 2268 polybutester with polytribolate coating knotless wound closure device with unidirectional & dual angled cut barbs geometry 1 45cm , blue 37mm 1/2 circle taper point 2269 polyester self gripping mesh for open inguinal hernia repair, size 14x9cm l&r 2270 polyester self gripping mesh for open incisional hernia repair, size 20x15cm 2271 polyester self gripping mesh for open incisional hernia repair, size 15x15cm 2272 macroporus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber (6 0) and poliglecaprone 25 monofilament fiber (5 0) with pore size 2.7 mm having a weight of 39 g/m2 and containing blue orientation stripes of polypropylene. 15cmx15cm 2273 purified lyophilized rabies antigen derived from rabies virus ( l.pasteur 2061/vero strain propagated in vero cells ) inactivated.2.5 i.u 2274 aceclofenac 100mg+paracetamol 325mg+chlorzoxazone 250mg tab(250mg),tablet 2275 aceclofenac 10 x 10 mg tab(10 x 10 ),tablet 2276 aceclofenac 100mg+paracetamol 500mg tab 2277 aceclofenac(100mg),tablet 2278 aceclofenac + paracetamol + chlorzoxazone 100 mg + 500 mg + 500 mg tab 2279 acetazolamide tab(250mg),tablet 2280 aciclovir cream 5% (5g tube) 2281 acyclovir(800mg),tablet 2282 acyclovir inj 250 mg/vial 2283 acyclovir inj 500mg/vial 2284 acyclovir intervenous infusion i.p 500mg/vial 2285 acyclovir suspension 400mg/5ml(100 ml bottle),suspension 2286 acyclovir tab 400 mg(400 mg),tablet 2287 acyclovir tab. ip 200mg 2288 adrenaline(1 mg / ml (1 ml amp)),injection 2289 aggs(anti gas gangrene serum)l/30000 ou/ml inj. 2290 albendazole suspension 200mg/5ml(10 ml bottle),syrup 2291 albendazole tab(200 mg),tablet 2292 albendazole tablets ip 400mg 2293 alpha beta arteether(150mg/2ml),injection 2294 alpha beta arteether inj 75 mg / 2 ml 2295 alpha beta arteether inj 75 mg /ml 1ml 1ml amp( ),injection 2296 alprazolam(0.5mg),tablet 2297 alprazolam tab. 0.25mg tab 2298 altracurium (10mg/ml,2.5ml vial),injection 2299 inj amphotericin b 500mg for injection 2300 cap amphotericin b 10mg 2301 amikacin(100mg / 2ml vial),injection 2302 amikacin(250mg/2ml),injection 2303 amikacin(500mg/2ml (2ml vial)),injection 2304 amiodarone inj. 50mg/ml (3ml vial) 2305 amiodarone tab 100mg 2306 amitriptyline(10 mg),tablet 2307 amitriptyline sugar coated tab. ip 25 mg 2308 amitryptiline 75 mg tab 2309 amitryptiline tab(50 mg),tablet 2310 amlodipine(10mg),tablet 2311 amlodipine(2.5mg),tablet 2312 amlodipin tab(5mg),tablet 2313 amoxicillin(125 ml/5ml (30 ml bottle)),suspension 2314 amoxicillin 250mg + clavulanic acid 50mg inj vial 2315 amoxicillin 250 mg / vial vial 2316 amoxicillin cap. 250 mg. 2317 amoxicillin + clavulanic acid (125 mg + 25 mg) / vial vial 2318 amoxicillin + clavulanic acid(200 mg + 28.5 mg),tablet 2319 amoxicillin trihydrate dispersible 125 mg tab(125 mg),tablet 2320 amoxycillin and clavulanic acid i.p.(200+28.5mg (30 ml bottle)),suspension 2321 amoxycillin and clavulanic acid i.p.(500mg + 125mg),tablet 2322 amoxycillin and potassium clavulanate i.p.(1 gm + 0.2 gm /10 ml vial),injection 2323 amoxycillin +clavulanic acid inj (amoxycillin 500 + clavulanic acid 100 mg)/vial 2324 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin(250mg),tablet 2325 amoxycilline(500mg),capsule 2326 ampicillin(1 gm vial),injection 2327 ampicillin 250 mg cap 2328 ampicilline 125mg/30ml syrup 2329 ampicillin inj. 250 mg/vial 2330 ampicillin syrup (125 mg / 5 ml 30 ml bottle),syrup 2331 antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp 2332 anticold (paracetamol 300mg+cetirizine hcl 5mg tablet 2333 anti d immunoglobulin for iv/im use (monoclonal) inj. 150mcg (1ml vial) 2334 anti hemophilic factor viii(250iu vial),injection 2335 anti rabies immunoglobulin inj 300 iu per 2ml (2ml vial)(300 iu per 2ml),injection solution for 2336 anti snake venom polyvalent inj 10ml (lyophilized)(10 ml vial),injection 2337 aripiprazole 5 mg tab 2338 artemether inj 80mg/ml (1 ml amp) 2339 artemether+lumefantrine 20mg+120mg tab 2340 artesunate inj 60 mg /vial 2341 artesunate + sulphadoxine + pyrimethamine (age group between 1 4 year)(50 mg (3 tab) + 500 mg (1 tab) + 25 mg (1 tab)),combi blister pack 2342 artesunate + sulphadoxine + pyrimethamine ip (age group 15 or above)(200 mg (3tab) + 750 mg (2tab) + 37.5 mg (1tab)),combi blister pack 2343 artesunate + sulphadoxine + pyrimethamine ip age group between 5 to 8 years(100 mg(3tab) + 750mg + 37.5mg (1tab)),combi blister pack 2344 artesunate tablets 150mg(3tab) + sulphadoxine (500mg+500mg) pyrimethamine 25mg +25mg tab ip (2tab) (age group 9 to 14 years) 2345 artesunate tablets 25mg(3tab) + sulphadoxine 125mg pyrimethamine 6.25mg tablets ip(1tab) (age group of less than 1year) 2346 ascorbic acid (vitamin c) tab. 500 mg. 2347 aspirin low dose 75mg tab 2348 aspirin low dose tab 150mg 2349 atenolol(25 mg),tablet 2350 atenolol tab. 100mg 10 x 14 tab 2351 atenolol tab 50mg. 2352 atorvastatin(10 mg),tablet 2353 atorvastatin(20mg),tablet 2354 atracurium besylate(10mg/ml inj amp),injection 2355 atropine sulphate 0.6 mg/ml sc/im/iv(2ml amp),injection 2356 atropine sulphate eye drops 1% (5 ml vial)(5 ml vial),eye drops/ ointment 2357 atropine sulphate eye ointment 1% (3 gm tube) 2358 azithromycin(100mg/5ml (15 ml bottle)),suspension 2359 azithromycin 1gm tab + cefixime 400mg tab 2360 azithromycin(200mg/5ml (15 ml bottle)),suspension 2361 azithromycin(250mg),tablet 2362 azithromycin(500 mg/5ml inj ),vial 2363 azithromycin 500mg tab 2364 balance salt solution for irrigation 500 ml ffs bottle(500ml bottle),eye applicap 2365 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol(0.025% + 1% + 0.5% + 0.1% w/w (5gm tube)),ointment or cream 2366 beclomethasone inhalation i.p 200 mcg per dose(200 metered dose container),inhaler 2367 benzathine penicilline 12 lac iu / vial vial 2368 benzathine penicillin powder for inj ip 6 lakh iu/vial 2369 benzyl benzoate lotion(25%),bottle 2370 benzyl penicillin 10lac/vial(penicillin g),injection 2371 betahistine(16 mg),tablet 2372 betahistine 8 mg tab 2373 betamethasone dipropionate ointment 0.05% (15gm) tube 2374 betamethasone tab 0.5 mg 2375 biphasic isophane insulin(30/70 40iu/ml (10 ml vial)),injection( mixtured ) 2376 insuline regular/ soulable (40iu/ml10mlvail) 2377 bisacodyl(5 mg),suppository 2378 bisacodyl tab 5mg 2379 botropase injection (haemocoagulase 1cu) 1ml 2380 bromhexine hydrochloride 4mg/5ml syrup (50ml bottle) 2381 budesonide nebulising suspension containing budesonide 0.25mg/ml 2ml amp 2382 budesonide respules 0.25mg/2ml inhalation(2ml amp/respule),inhaler 2383 bupivacaine hcl for spinal anaesthesia 0.5%(heavy)amp 4 ml amp 2384 bupivacaine hydrochloride inj. 0.5% (20 ml vial) 2385 bupivacaine hydrochloride inj. 0.5% 20ml vial (not for spinal use) 2386 bupivacaine hydrochloride inj. 4ml amp (not for spinal use)(0.5%),vial 2387 buppivacaine 5 mg, dextrose80 mg / ml, 4 ml inj injection 2388 caffeine citrate inj. 20mg/ml (3 ml vial)(20mg/ml 3 ml vial),injection 2389 calamine lotion ip (contains per 1000 ml: calamine 150 gm,zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml) 50 ml bottle 2390 calcium carbonate 500 mg tab 2391 calcium carbonate derived from oyester shell equivalent to elemental calcium 500mg and vitamin d3 250 iu( ),tablet 2392 calcium gluconate injection i.p. 10%w/v (10ml amp) 2393 carbamazepine (sr) 100 mg tab 2394 carboprost tromethamine injection i.p.(15 methyl pgf2a)inj 250mcg/1ml 2395 carboxymethylcellulose sodium eye drop 0.5%(10ml),eye drop 2396 cefadroxil 250 mg tab 2397 cefadroxil 500 mg tab 2398 cefadroxil syrup(125 mg / 5 ml 30 ml bottle),syrup 2399 cefixime 200 mg tab 2400 cefixime 50 mg dt tab( ),tablet 2401 cefixime oral suspension(100 mg / 5 ml (30 ml bottle)),suspension 2402 cefixime tab ip 100mg tab 2403 cefoperazone 500mg + sulbactam 500mg(vial),injection 2404 cefotaxime + sulbactam 1000 mg + 500 mg vial 2405 cefpodoxime 100 mg( ),tablet 2406 cefpodoxime 200 mg tab 2407 cefpodoxime(50 mg),tablet 2408 ceftriaxone 1000mg + sulbactam 500mg(vial),injection 2409 ceftriaxone inj 250mg vial 2410 ceftriaxone+tazobactum(500mg+62.5mg vial),injection 2411 cefuroxime 250 mg,tablet 2412 cefuroxime 500 mg,tablet 2413 cephalexin 100 mg/ml 10 ml with dropper 2414 cephalexin dispersible tablet 125 mg 2415 cephalexine cap. 250mg capsule 2416 cephalexine cap. 500mg 2417 cephalexine(each 5ml contains 125mg (30ml bottle)),syrup 2418 cerumenolytic(for ear wax)each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% 10 ml vial [110341] 2419 cetirizine syp 5mg/5ml 60 ml bottle syrup 2420 cetirizine tab. 10 mg 2421 chloramphenicol(1% (5 ml vial)),eye drop 2422 chloramphenicol ear drop 5% (5 ml vial) 2423 chloramphenicol eye applicaps 1% 100 applicaps per bottle 2424 chloraxozone + paracetamol 250 mg + 500 mg tab 2425 chlordiazepoxide 10 mg tab 2426 chlordiazepoxide 20 mg tab 2427 chlordiazepoxide(25 mg),tablet 2428 chlorhexidine 0.2% mouth gargle 100 ml 2429 chlorhexidine gluconate mouthwash 0.2% w/v solution(50ml bottle ),solution 2430 chlorhexidine gluconate solution 4% i.p. (antiseptic) 500 ml bottle 2431 chlorine based compound (sodium dicholoroiso cyanurate)nadcc tablets 75 mg with available chloroine 45 mg bis(45 mg),tablet 2432 chloroquine phosphate inj 40mg/ml (5 ml amp) 2433 chloroquine phosphate suspension equivalent to chloroquine(50mg/5ml (60 ml bottle)),suspension 2434 chloroquine phosphate tab. 250mg 2435 chlorpheniramine maleate 10mg/ml inj 10 ml vial 2436 chlorpheniramine maleate tab. 4mg 2437 chlorpromazine hydrochloride 100 mg sugar coated tab 2438 chlorpromazine hydrochloride(25 mg),tablet 2439 chlorpromazine inj ip 25mg/ml (2ml amp) 2440 chlorpromazine tab 100 mg 2441 cholecalciferol concentrate (powder form) ph.eur. 60000iu/gm 2442 cinnarizine(25 mg),tablet 2443 ciprofloxacin 0.3% + dexamethosone eye drop 0.1% 2444 ciprofloxacin 125 mg / 5 ml 60 ml bottle 2445 ciprofloxacin eye ointment 0.3% ( 3gm tube) 2446 ciprofloxacin inj 2 mg/ml inj 100ml glass bottle( ),injection solution for 2447 ciprofloxacin tab 250mg 2448 ciprofloxacin tab 500mg 2449 clindamycin(1% w/w 10 gm),gel 2450 clindamycin 300 mg/ml inj(1 each),injection 2451 clobazam(10 mg),tablet 2452 clobazam 5 mg tab 2453 clobetasol propionate 0.05% 15 gm tube 2454 clomiphene citrate 100 mg tab 2455 clomiphene citrate 50 mg tab 2456 clomipramine 25 mg tab 2457 clomipramine 50 mg tab 2458 clomipramine 75 mg tab 2459 clonazepam 0.25 mg tab 2460 clonazepam(1 mg),tablet 2461 clonazepam 2mg tab 2462 clonidine 100 mcg tab tablet 2463 clonidine injection, 10ml vial (1mg) 2464 clopidogrel + aspirin 150mg cap 2465 clopidogrel + aspirin(75 mg + 150 mg),capsule 2466 clopidogrel tab. 75 mg 2467 clotrimazole i.p. 2%w/w(15gm tube),cream 2468 clotrimazole + lignocaine ear drop 1%(5ml vial),drop 2469 clotrimazole suspension i.p 50mg/5ml 2470 clotrimazole vaginal pessary tab 100mg 14 x 10 tab 2471 tab clotrimazole 100mg 2472 clozapine 100 mg tab 2473 clozapine(50 mg),tablet 2474 colistin sulphate(12.5 mg / 5 ml 30 ml bottle),suspension 2475 compound benzoic acid ointment 2476 compound tincture benzoin ip 2477 co trimoxazole oral suspension ip(5 ml each trimethoprim 40 mg sulphamethoxazole 200 mg),bottle 2478 deferasirox dispersible(250mg),tablet 2479 deferasirox dispersible(500mg),tablet 2480 deferasirox dispersible tab. 100mg 2481 dexamethasone(4 mg),tablet 2482 dexamethasone sodium 0.5 mg, tab tablet 2483 dexamethasone sodium phosphate inj 8mg/2ml (2ml vial) 2484 dexamethasone tab(0.5mg),tablet 2485 dextran 70 injectable sol inj 500ml (solution) 2486 dextromethorphan 10mg/5ml syrup(60ml bottle) 2487 dextrose 10% inj 500ml ffs/bfs bottle( ),injection solution for 2488 dextrose 25% inj 500ml bfs bottle( ),injection solution for 2489 dextrose 5% 500ml bfs bottle( ),injection 2490 dextrose, d 25 0.25 25 ml(25 ml),injection 2491 dextrose, d 50 0.5 25 ml(25 ml),injection 2492 dextrose with saline 5% + 0.9% inj 500ml bfs bottle 2493 diazepam inj. 5 mg/ml (2 ml amp) 2494 diazepam tab 5 mg 2495 diclofenac 50mg +paracetamol 325mg+chlorzoxazone 500mg tab 2496 diclofenac 50mg +seratopeptidase 10mg tab(10mg),tablet 2497 diclofenac gel 1% 30gm tube 2498 dicyclomine(10mg/ml (2 ml amp)),injection 2499 dicyclomine 20mg tab 2500 dicyclomine hydrochloride oral solution 10 mg / ml 30 ml bottle(10 mg),solution 2501 dicyclomine + paracetamol tab 20 mg + 500 mg 2502 dicyclomine tab. 10mg 2503 diethylcarbamazine tab(100mg),tablet 2504 digoxin inj. 250mcg/ml 2505 digoxin tab 0.25mg(25x10),tablet 2506 dilitiazem tab 60mg 2507 dilitiazem tablets i.p. 30 mg 2508 diphenhydramine sg cap 25mg capsule 2509 diphenhydramine syrup(12.5mg/5ml (100 ml bottle)),syrup 2510 divalproex sodium 500 mg tab 2511 divalproex sodium 750 mg tab 2512 dobutamine hcl 50 mg / ml inj (5ml amp) 2513 domperidone(10mg),tablet 2514 domperidone suspension 1mg/ml (30ml bottle) 2515 dopamine hcl 40 mg/ml inj (5 ml amp) 2516 doxycycline cap 100 mg 2517 drotaverine(40 mg),tablet 2518 drotaverine inj. 40ml/2ml (2ml amp)(40ml/2ml 2ml amp),injection solution for 2519 electrolyte e(multiple electrolytes and dextrose inj type v ip)i/v fluid[each 100ml contains inj dextrose 5g, sod.acetate 0.64g, sod.chloride 0.50g,sodium citrate 0.075g,kcl 0.075g,ccl 0.035g,magnesium chloride 0.031g](500ml ffs bottle) 2520 electrolyte g(multi electrolyte with 5% dextrose iv injection type iv ip)intravenous fluid[each 100ml contains: anhydrous dextrose 5 gm,sod.chloride 0.37g,potassium chloride 0.13g,ammonium chloride 0.37g](500ml ffs bottle)(500 ml),bottle 2521 electrolyte m inj 500ml bfs bottle( ),injection solution for 2522 electrolyte p inj 500ml ffs/bfs bottle( ),injection solution for 2523 tab econazole 150 mg 2524 econazole nitrate 1% crem 15 gm 2525 enalapril maleate tab 5mg 2526 erythomycin stearate(250mg),tablet 2527 erythromycin stearate(500 mg),tablet 2528 escitalopram 10 mg tab 2529 escitalopram(20 mg),tablet 2530 escitalopram(5 mg),tablet 2531 etiophylline (77 mg) + theophylline (23 mg) tab 2532 etiophylline and theophylline(220 mg/2ml),injection 2533 etiophylline and theophylline paediatric syrup. 2534 etiophylline theophylline sr tab. 300mg( ),tablet 2535 etiophylline +theophylline syrup (46.5+14)mg / 5ml (100 ml bottle)( ),bottle 2536 favipiravir tab 200mg 2537 favipiravir tab 400 mg 2538 favipiravir tab 800mg 2539 ferrous ascorbate 100mg (elemental iron)+folic acid 1.5mg tablet 2540 fluconazole 0.3%(5 ml),eye drop 2541 fluconazole(150 mg),tablet 2542 fluconazole gel usp 0.5% 15 grm tube 2543 fluconazole iv(2mg/ml (100ml bottle)),injection 2544 flunarizine 5 mg tab 2545 fluoxamine(100 mg),tablet 2546 fluoxetine cap 10 mg 2547 fluoxetine cap. bp 20 mg 2548 folic acid tab(400 mcg),tablet 2549 folic acid tab ip 5 mg 2550 framycetin sulphate 1% cream(30 gm tube),cream 2551 frusemide inj. 10 mg/ml (2 ml amp) 2552 frusemide tab. 40mg 2553 furazolidone(25mg/5ml (60 ml bottle)),suspension 2554 furazolidone tab 100mg. 2555 fusidic acid 0.02 15 gm cream 2556 gamma benzene hexachloride solution 1% (100 ml bottle)(100 ml bottle),fluid 2557 gatifloxacin eye drop 0.3% 5ml 2558 gentamicin + betamethasone 0.3% w/v + 0.1% w/v 5 ml inj 2559 gentamicin inj. 40 mg/ml, 2ml amp 2560 gentamicin inj(80 mg/ml (2 ml amp)),injection 2561 gentamycin 0.3% eye/ear drops(5ml ffs squeeze vial),eye drop 2562 glibenclamide tab 5 mg 2563 gliclazide tab. 80 mg 2564 glimepiride 1 mg tab 2565 glimepiride 2 mg tab 2566 gluteraldehyde solution 2%(5 litre can),solution 2567 glycerine ip solution (100ml bottle) 2568 glyceryl trinitrate 0.5mg (sublingual) tab 2569 glyceryl trinitrate 5mg/ml inj 10ml vial (nitroglycerine)(5mg/ml),injection solution 2570 glycopyrolate 0.5% 5ml and neostigmin 2.5 mg/5 ml injection(each),injection 2571 haloperidol(5mg),tablet 2572 haloperidol inj 5mg/ml (1 ml amp) 2573 haloperidol tab 10mg 2574 halothane bp 250ml solution 2575 heparin(1000iu/ml 5ml vial),injection 2576 heparin inj(5000iu/ml 5ml vial),injection 2577 homatropine 2% 1 ml vial inj 2578 human albumin solution i.p. 20%w/v (100 ml vial),injection 2579 hyaluronidase 1500 iu/ 2 ml(2 ml amp/vial),injection 2580 hydralazine hydrochloride 20mg/ml injection (1 ml amp/vial) 2581 hydrochlorothiazide tab 25 mg 2582 hydrochlorthiazide(12.5 mg),tablet 2583 hydrocortisone sodium succinate(100 mg/vial),injection 2584 hydrogen peroxide sol 6%v 400 ml bottle 2585 hyoscine butylbromide tab 10mg. 2586 hyoscine butyl bromind 1 ml mg(amp),injection 2587 ibuprofen 200 mg,tablet 2588 ibuprofen 400mg+ paracetamol 325mg tablet( ),tablet 2589 ibuprofen(400mg),tablet 2590 ibuprofen syrup 100mg/5ml (60 ml bottle)(60 ml bottle),syrup 2591 imipramine 75 mg tab 2592 inj. pantaprazole (40mg) 2593 ipratropium bromide inhaler 20mcg per puff 200dose 2594 iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg (blue tablet) 2595 iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip (pink color) wifs junior 2596 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules (red tablet)( ),tablet 2597 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals(if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. (as per attached specification) (50ml bottle with auto dispenser)),syrup 2598 iron sucrose inj usp 100 mg/5 ml (5 ml amp) 2599 isosorbide 5 mononitrate(tab.20 mg),tablet 2600 isosorbide dinitrate tab ip 5 mg 2601 isosorbide mononitrate tab. 20mg 2602 isoxsuprine(10mg),tablet 2603 isoxsuprine hydrochloride inj. 5mg/ml (2 ml amp)(2 ml),injection 2604 ivermectin tab usp 6mg 2605 ivermectin tab usp 12mg 2606 isavuconazonium sulphate injection 372mg 2607 isavuconazole100 cap 2608 iv human immunoglobin 5mg/100ml(1 each),injection 2609 ketamine hydrochloride inj. 10mg/ml (10ml vial) 2610 ketoconazole ointment 2% 15gm tube(15 gm),ointment 2611 labetalol 100 mg tab 2612 lactobacillus tab (lactobacillus 60 million spores) . 2613 levetiracetam 250 mg tab 2614 levetiracetam 500 mg tab 2615 levocetirizine + monteleukast((2.5 mg + 4 mg) / 5 ml, 30 ml bottle),suspension 2616 levocetirizine + monteleukast 5 mg + 10 mg tab 2617 levocetirizine tab 5mg 2618 levofloxacin(250mg),tablet 2619 levofloxacin 500mg inj 100ml ffs/bfs bottle( ),injection solution 2620 levofloxacin 500mg tablet 2621 lignocaine 2 %(21.3 mg / ml (30 ml vial)),injection 2622 lignocaine 2% + adrenaline 5 mcg/ml(30 ml ),vial inj 2623 lignocaine hydrochloride eye drops 4% (5 ml vial) 2624 lignocaine hydrochloride for spinal anaesthesia(heavy) 0.05 2 ml amp 2625 lignocaine hydrochloride gel 2% w/v (30 gm tube) 2626 liquid paraffin ip 500 ml solution 2627 lithium carbonate 400 mg tab 2628 lmwh low molecular weight heparin inj 4000iu/ml.( ),injection solution 2629 lmwh low molecular weight heparin inj. 6000niu/ml( ),injectn solution 2630 lorazepam 1 mg tab 2631 lorazepam 2 mg / ml 2 ml vial 2632 lorazepam 2 mg tab 2633 losartan potassium, hydrochlorthiazide(50 mg + 12.5 mg),tablet 2634 losartan tab 50 mg 2635 lysol ip (cresol with soap solution) ( 5ltr jar) 2636 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg/ 5 ml 170 ml bottle(syrup),syrup 2637 magnesium suplhate injection i.p.50 % w/v (1 ml amp)(1 ml amp),ampoule 2638 mannitol inj. 10% 350ml bottle( ),injection solution for 2639 mannitol injection i.p. 20% 100ml bottle( ),injection solution for 2640 mephentermine inj 30mg/ml(10 ml vial),injection 2641 meropenem inj 125mg/vial(each),injection 2642 mesalamine (5 aminosalicylic acid 400 mg) tab 2643 metformine 500mg + glibenclamide 5mg(tab),tablet 2644 metformin + glimepiride 500 mg + 2 mg tab 2645 methylcobalamin + alpha lipoic acid(1500 mcg + 100 mg ),capsule 2646 methylcobalamin inj(500 mcg/ml (10 ml vial)),injection 2647 methylcobalamin/mecobalamin(500 mcg),tablet 2648 methyldopa tab.