Department of Health Research - Madhya Pradesh

40776843 bids are invited for laboratory equipments laminar air flow , weighing balance analytical , horizontal gel electrophoresis unit with power pac , western blotting unit , tissuelyser or tissue homogenizer total quantity : 5...

Department of Higher Education - Madhya Pradesh

39526714 bids are invited for development analytical balance , chemical balance digital , analytical weight box , fractional weight box , physical balance , digital photoelectric colorimeter , digital ph meter with electrode lcd , digital potentiometer , digital conductometer , do meter , digital naphelo turbidity meter , polari meter half shade , melting point apparatus , digital melting point apparatus , tlc kit , centrifuge , distillation apparatus , vacuum pump oil free , mixer small , water bath cu , heating mantle with energy regulator , water bath rectangular single walled , water bath rectangular double wall , kjeldahl distillation unit , microwave oven , blower , sprayer , magnetic stirrer , hot plate rectangular with stainless , vaccum pump , autoclave vertical cap 50 litre , auxanometer , blackmans apparatus , compound microscope , digital balance , digital colony counter , digital tds meter , dissecting microscope , distillation apparatus double , farmer s potometer , ganong s potometer , ganong s respirometer , heating mentle with regulator , magnetic stirrer with hot plate , molls half leaf apparatus , micro pipette fixed 1 5 ml , micro pipette variable 1 5 ml , ocular micrometer , ph meter digital , rotatory microtome with , slide cabinet with 12 showcase , slide reader , thin layer chromatography , water analysers , water and soil testing analysis kit digital , water bath double wall 12 , wilmott s bubbler , wooden press for herbarium , quadrats , digital thermometer , normal chromatographic , binocular dissecting , aquarium kit , autoclave portable , automatic burette , blood cell calculator , chart cds related to syllabus , digital haemoglobinometer , digital ph meter , dissecting tray , glucometer , haemocytometer , heating mantle with regulator cap 1 litre , high speed centrifuge , homogenizer , hot plate , microtome rotary , models specimen, bones of ug and pg , newtons disc , permanent slides , slide cabinet with 6 showcases , slide warming table , sphygmomanometer , staining racks , syringe needle destroyer , thin layer chromatography apparatus , vortex shaker , water bath 06 holes , water bath 12 holes , electrophoresis with power , supply , monocular microscope , oven 125 litres , water distillation apparatus , fet charactrstics , photo diode characterstics app , solar cell characterstics , hartley and colpitts oscillators , series and parallel resonance circuit , impedance and power factor of lcr circuit , study of hybrid parameter of a , transistor , lee app to det.the hear conductivity , comp.setup to find the wavelength of sodium light , physical balance , weight box , vernier calliper , screw gauge total quantity : 140...

Department of Higher Education - Madhya Pradesh

39521914 bids are invited for development water bath double wall 12 , wilmott s bubbler , wooden press for herbarium , quadrats , digital thermometer , normal chromatographic , binocular dissecting , aquarium kit , autoclave portable , automatic burette , blood cell calculator , chart cds related to syllabus , digital haemoglobinometer , digital ph meter , dissecting tray , glucometer , haemocytometer , heating mantle with regulator cap 1 litre , high speed centrifuge , homogenizer , hot plate , microtome rotary , models specimen, bones of ug and pg , newtons disc , permanent slides , slide cabinet with 6 showcases , slide warming table , sphygmomanometer , staining racks , syringe needle destroyer , thin layer chromatography apparatus , vortex shaker , water bath 06 holes , water bath 12 holes , electrophoresis with power , supply , monocular microscope , oven 125 litres , water distillation apparatus , fet charactrstics , photo diode characterstics app , solar cell characterstics , hartley and colpitts oscillators , series and parallel resonance circuit , impedance and power factor of lcr circuit , study of hybrid parameter of a , transistor , lee app to det.the hear conductivity , comp.setup to find the wavelength of sodium light , physical balance , weight box , vernier calliper , screw gauge total quantity : 140...

Department of Higher Education - Madhya Pradesh

39462540 bids are invited for development analytical balance , chemical balance digital , analytical weight box , fractional weight box , physical balance , digital photoelectric colorimeter , digital ph meter with electrode lcd , digital potentiometer , digital conductometer , do meter , digital naphelo turbidity meter , polari meter half shade , melting point apparatus , digital melting point apparatus , tlc kit , centrifuge , distillation apparatus , vacuum pump oil free , mixer small , water bath cu , heating mantle with energy regulator , water bath rectangular single walled , water bath rectangular double wall , kjeldahl distillation unit , microwave oven , blower , sprayer , magnetic stirrer , hot plate rectangular with stainless , vaccum pump , autoclave vertical cap 50 litre , auxanometer , blackmans apparatus , compound microscope , digital balance , digital colony counter , digital tds meter , dissecting microscope , distillation apparatus double , farmer s potometer , ganong s potometer , ganong s respirometer , heating mentle with regulator , magnetic stirrer with hot plate , molls half leaf apparatus , micro pipette fixed 1 5 ml , micro pipette variable 1 5 ml , ocular micrometer , ph meter digital , rotatory microtome with , slide cabinet with 12 showcase , slide reader , thin layer chromatography , water analysers , water and soil testing analysis kit digital , water bath double wall 12 , wilmott s bubbler , wooden press for herbarium , quadrats , digital thermometer , normal chromatographic , binocular dissecting , aquarium kit , autoclave portable , automatic burette , blood cell calculator , chart cds related to syllabus , digital haemoglobinometer , digital ph meter , dissecting tray , glucometer , haemocytometer , heating mantle with regulator cap 1 litre , high speed centrifuge , homogenizer , hot plate , microtome rotary , models specimen, bones of ug and pg , newtons disc , permanent slides , slide cabinet with 6 showcases , slide warming table , sphygmomanometer , staining racks , syringe needle destroyer , thin layer chromatography apparatus , vortex shaker , water bath 06 holes , water bath 12 holes , electrophoresis with power , supply , monocular microscope , oven 125 litres , water distillation apparatus , fet charactrstics , photo diode characterstics app , solar cell characterstics , hartley and colpitts oscillators , series and parallel resonance circuit , impedance and power factor of lcr circuit , study of hybrid parameter of a , transistor , lee app to det.the hear conductivity , comp.setup to find the wavelength of sodium light , physical balance , weight box , vernier calliper , screw gauge total quantity : 140...

Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

37911191 laboratory equipments for biology (botany and zoology) , laboratory equipments for biology (botany & zoology) , anemo meter , auto exhaust analyzer , autoclave portable , autoclave vertical cap. 50 liter , auxanometer , binocular dissecting microscope , binocular microscope , bio fermentar5 liter (borosilicate glass) , blackman’s apparatus , bod incubator , bomb calorimeter (with oxygen cylinder) , bomb calorimeter (without oxygen cylinder) , camera leucida with filter (micro type) , camera leucida with filter (prism type) , centrifuge machine (cooling) maximum speed 24000 rpm , centrifuge machine 3500rpm , cod analyzer , compound microscope , deep freezer , digital balance (0.1 mg) , digital colony counter , digital tds meter (microcontroller based conductivity tds meter) , digital thermometer , dissecting microscope , distillation apparatus double distillation capacity 5 liter , distillation apparatus single distillation capacity 5 liter , dslr camera , electronic digital balance (read ability 0.01 mg) , farmer’s potometer , flame photometer , ganong’s potometer (borosilicate glass) , ganong’s respirometer (borosilicate glass) , gel documentation , gel electrophoresis unit with power supply (horizontal) , gramen gps , hair dryer , heating mental with regulator cap 1 liter , high volume air sampler , homogenizer , hot air oven (with digital controller) size 455 x 455 x 455 mm , hot air oven (with digital controller) size 605 x 605 x 605 mm , hplc (binary system) , image projection system (mips) , incubator stainless steel (with digital controller) , laminar air flow horizontal , magnetic stirrer with hot plate , maximum minimum thermometer , micro keldahal & distillation apparatus , micro pipette (fixed 1 5 ?l) , micro pipette (variable 1 5 ?l) , microscopic camera (digital eyepiece camera 10mp, with measuring software) , moll’s half leaf apparatus , noise level meter (digital sound & noise level meter) , normal chromatographic chamber , ocular micrometer , pcr machine (gradient thermal cycler pcr) , ph meter (digital) (microcontroller based ph meter with electrode & temp. probe) , portable air sampler unit , quadrats , rotatory microtome with accessories , slide cabinet with 12 showcase , soxhlet extraction unit (borosilicate glass) , stage micrometer , stem borer , thin layer chromatography apparatus , tissue culture rack (caster rack) , ultracentrifuge , uv trans illuminator , uv vis spectrophotometer (double beam) variable bandwidth , uv vis spectrophotometer (single beam) micro controller based , visualizer (visual presenter/ teletop camera) , vortex shaker , water & soil testing (analysis) kit , water bath double wall (12 holes) stainless steel , wilmott’s bubbler , wooden press for herbarium , aquarium kit , automatic burette , blood cell calculator , bones , biological charts as per ug & pg syllabus/ requirement , biological models as per ug & pg syllabus/ requirement , digital haemoglobinometer , dissecting tray , haemocytometer kit , induction hot plate with induction pots , permanent slides , specimens , water bath double wall stainless steel , western blotting system...

Department of Higher Education - Madhya Pradesh

37257786 bids are invited for lab equipment 2 117 analytical balance , analytical weight box , fractional weight box , physical balance , digital balance , single pan digital balance , digital photoelectric colorimeter , digital potentiometer , digital conductometer , d o meter , digital , naphelo turbidity meter , polarimeter half shade , melting point apparatus , digital melting point apparatus , abbe refracto meter , tlc kit , centrifuge , corkboring machine , distillation apparatus , oven hot air , voltage stabilizer , vertex shaker , vacuum pumpoil free , mixers mall , water bath cu , heating mantle with energy , regulator , single crucible heater , muffle furnace , water bath rectangularsingle walled , water bath rectangular , kjeldahldistillation unit , microwave oven , soleextraction unit apparatus , blower , sprayer , magneticstirrer , wateranalyser , compound microscope , dissecting microscope , distillation apparatusdouble , ganongs potometer , ganongs , slidecabinetwith 12 showcase , wilmottsbubbler , woodenpressfor herbarium , quadrats , digital thermometer , binocular dissecting , microscope , slide box for 50 slides , binocular microscope , side readar , water and soil testing analysis kit , ph meter , digital balance , analyticalbalance , aquariumkit , autoclaveportable , automaticburette , bloodcellcalculator , bodincubator , chart and cdsrelatedto syllabus , digital haemoglobinometer , digitalphmeter , digitalsinglepan balance , digital spectrophotometer , digitalthermometer , digitalturbiditymeter , dissectingmicroscope , dissecting tray electronic digital balance , electronic digital balance , electrophoresis with power supply , glucometer , haemocytometer complete box , heating mantle with regulatorcap1litre , highspeedcentrifuge , homogenizer , hotplate , laboratoryhotairoven , laminarairflow horizontal , magneticstirrerwithhot plate , medicocentrifuge machine , micropipette , microtome rotary , mips 1 117machine , micropipette , microtome rotary , mips photodiode characterstics app , solarcell characterstics , phtottransisitor characterstics app , hartleyandcolpittsoscillators , transistorized regulator powersupply , series and parallel resonance circuit , battery chrger 2to12volt , callendorandbarneapptodet the value of me chanical equivalent of heat , lee app to det thehear conductivity , physical balance , weight box , vernier calliper , screw gauge , stop watch digital , ammeter dc ac , voltmeter dc ac , photo conductivity experiments , to study the v icharactrsticsofthesolarcell , ldr charactrstics app , bending of beam , measurement of low resistance by carey foster , potentiometer , app to study responsecurve for lc circuit , zener diode asvoltageregulatorpowersupplyset , newtons ringapp with travelling microscope power , spectrometer prism , inertiatable , compound pendulum , cantilevertodeter mine young , horizontaltorson app , app to verify newtons lawof , searle apparatus to determine the coefficient of thermal , transformer sodium vapour lamp , mercury lamp , transformer of mercury lamp , comp app to determine resolving power of telescope , audio frequency generator , app for measurement of capacitance and inductanceusong , study of lissajousfiguretrainer with , cro rectifierandfiltercharactrstics , crosingletrace 10mhz , dielectricconstant , half wave and full waverectifier kit , network theorem kit , resonance wave on lcr , study of regulatedpower supply using transistor , readingtele scope , analogmultimeter , leadaccumulator , battery eliminator , resistance box , hybrid solar andwind energy trainer , frankhartzexp , thermistor charactrstics app , slotted weights hanger , rheostate various length , galvanometer , miliammeter milivolmeter microammeter , plug key one way two way , reversing key , four way key , moarse key , digital multimeter , slodering iron , travelling microscope , bar pendulum , sodium vapor lamp , use of vibration magnetometer to study a field , apparatus to determine the value of planks constant complete , jarib and lace survey set jarib lace truck compass guniya ranging rod aero , plain table survey set plain table tripod stand lace truck compass sprit lavel sahul aero renging rod , prijmetic compass survey set prijmetic compass tripod stand lace truck compass sprit lavel truck compass ranging rod aero , glob , map phycsical world political climate physical india political physical mp political climate , petrological projector , sepcimen fossils minerals crystal wooden glass , ore minerals and rocks samples , topo sheet , slides of rocks and mineral , clinometer compass total quantity : 875...

Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

36930696 tender for supply of laboratory equipments for biology ( botany & zoology ) 2 anemo meter 3 auto exhaust analyzer 4 autoclave portable 5 autoclave vertical cap. 50 liter 6 auxanometer 7 binocular dissecting microscope 8 binocular microscope 9 bio fermentar5 liter (borosilicate glass) 10 blackman’s apparatus 11 bod incubator 12 bomb calorimeter (with oxygen cylinder) 13 bomb calorimeter (without oxygen cylinder) 14 camera leucida with filter (micro type) 15 camera leucida with filter (prism type) 16 centrifuge machine (cooling) maximum speed 24000 rpm 17 centrifuge machine 3500rpm 18 cod analyzer 19 compound microscope 20 deep freezer 21 digital balance (0.1 mg) 22 digital colony counter 23 digital tds meter (microcontroller based conductivity tds meter) 24 digital thermometer 25 dissecting microscope 26 distillation apparatus double distillation capacity 5 liter 27 distillation apparatus single distillation capacity 5 liter 28 dslr camera 29 electronic digital balance (read ability 0.01 mg) 30 farmer’s potometer 31 flame photometer 32 ganong’s potometer (borosilicate glass) 33 ganong’s respirometer (borosilicate glass) 34 gel documentation 35 gel electrophoresis unit with power supply (horizontal) 36 gramen gps 37 hair dryer 38 heating mental with regulator cap 1 liter 39 high volume air sampler 40 homogenizer 41 hot air oven (with digital controller) size 455 x 455 x 455 mm 42 hot air oven (with digital controller) size 605 x 605 x 605 mm 43 hplc (binary system) 44 image projection system (mips) 45 incubator stainless steel (with digital controller) 46 laminar air flow horizontal 47 magnetic stirrer with hot plate 48 maximum minimum thermometer 49 micro keldahal & distillation apparatus 50 micro pipette (fixed 1 5 µl) 51 micro pipette (variable 1 5 µl) 52 microscopic camera (digital eyepiece camera 10mp, with measuring software) 53 moll’s half leaf apparatus 54 noise level meter (digital sound & noise level meter) 55 normal chromatographic chamber 56 ocular micrometer 57 pcr machine (gradient thermal cycler pcr) 58 ph meter (digital) (microcontroller based ph meter with electrode & temp. probe) 59 portable air sampler unit 60 quadrats 61 rotatory microtome with accessories 62 slide cabinet with 12 showcase 63 soxhlet extraction unit (borosilicate glass) 64 stage micrometer 65 stem borer 66 thin layer chromatography apparatus 67 tissue culture rack (caster rack) 68 ultracentrifuge 69 uv trans illuminator 70 uv vis spectrophotometer (double beam) variable bandwidth 71 uv vis spectrophotometer (single beam) micro controller based 72 visualizer (visual presenter/ teletop camera) 73 vortex shaker 74 water & soil testing (analysis) kit 75 water bath double wall (12 holes) stainless steel 76 wilmott’s bubbler 77 wooden press for herbarium 78 aquarium kit 79 automatic burette 80 blood cell calculator 81 bones 82 biological charts as per ug & pg syllabus/ requirement 83 biological models as per ug & pg syllabus/ requirement 84 digital haemoglobinometer 85 dissecting tray 86 haemocytometer kit 87 induction hot plate with induction pots 88 permanent slides 89 specimens 90 water bath double wall stainless steel 91 western blotting system ...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

36432396 supply of homogenizer and compressor spares ( one time supply basis ) supply of homogenizer and compressor spares ( one time supply basis ) ref. no.13 / 2023 , technical specification of spares parts , bronzina bearing brass ( 1 set of 4 pcs ) , piston piston ( drum ) , spiniotto pin , stelo piston piston shaft , morsetto clamp , vite screw , c.h. gasket ( 1 set of 4 ring ) , gasket , out led head , impect ring , gasket , impect head , spring , gasket , gasket , seeger ring , gasket , guide band , gasket , seat valve , ball valve , gasket , gasket , gasket , oil cartridge , seeger ring , gasket , coolent filter , oil separator , air filter , ultra coolant oil...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

36417847 supply of homogenizer and air compressore spares 1 bronzina bearing brass (1 set of 4 pcs) 2 pistone pistone (drum) 3 spinotto pin 4 stelo pistone piston shaft 5 morsetto clamp 6 vite screw 7 c.h. gasket (1 set of 4 ring) 8 gasket 9 out led head 10 impact ring 11 gasket 12 impact head 13 spring 14 gasket 15 gasket 16 seeger ring 17 gasket 18 guide band 19 gasket 20 seat valve 21 ball valve 22 gasket 23 gasket 24 gasket 25 oil cartridge 26 seeger ring 27 gasket 1. coolant filter 2. oil separator 3. air filter 4. ultra coolant oil...

Directorate Of Medical Education - Madhya Pradesh

36184405 tender for supply of chemical and reagents for mdru dep , item name , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , floor cleaner phenyl 1 l * 5 , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Department of Higher Education - Madhya Pradesh

35380761 bids are invited for procurement articles 1 auto clave 2 do meter digital 3 digital meter counductivity meter and temp meter 4 digital photoelectric colorimeter 5lit 5 digital app double distilation cap ss 6 electronic blance0.01mg to 220g 7 flame photometer digital 8 heating metel 5lit 9 heating metal 2 lit 500w 10 hotplate with energy regulator 11 centrifuge machine 12 laboratory mixer 13 magnetic stirrer with hot plate 14 muffle furness 9x4x4 15 shaking machine with wrist action 16 bod incubator 17 uv b3chromatrographic chamber 18 vortex mixer 19 digital colony counter 4 digit 20 digital turbidity meter 3.5 digit 21 tds meter digital 22 test tube stand 23 test tube mid 24 test tube big 25 beaker100ml 26 beaker 50ml 27 volumetric flask 100ml 28 volumetric flask 50ml 29 water bath double 12 holes 30 water soil analysis kit 7 para meter 31 shaking machine 32 petri disk 4” 33 rotatory flask shaker 34 rotatory light vacuum pump 25 lit /per min 35 ph meter with electrodes 36 burett 50ml 37 measuring cylinder100ml 38 flask 250ml 39 flask 100 40 polorimeter half shaade 41 flask 50ml 42 hot air oven 43 melting point apparatus digital 44 micropipette variable 45 compound microscope 46 dissecting microscope with bull lences 47 binocular microscope 48 betrological oven 49 rotatory microtome with accessories 50 plant collection set 51 digital spectrophotometer 52 ph meter 53 homogenizer 54 gel electroproshish with power supply(vertical) 55 laminar air flow horizontal 56 tissu culture rack 57 human plastic skeleton imported 58 blood pressure machine 59 insect collection net 60 parmanent slide sample 10pices set 61 fet characteristic apparatus 62 mosfet characteristic app 63 ujt characteristic app 64 s.c.r characteristic app 65 thermistor characteristic app 66 diac and tiac characteristic app 67 photo diode characteristic app 68 photo transistor characteristic app 69 power amplifier 70 hartley and colpitts oscillator 71 study of hybrid parameters circuits 72 zanier regulated power supply 73 newton ring app complete with travelling microscope power supply 74 series and parailal resonrnce circuits 75 study of multivibrators using omamp 76 clipping and clamping circuits using operational amplifire 77 spectrometer 6/7 78 die electric constant apparatus 79 screw gauge electronic 80 verniear calipers electronics 81 bi prism assembly 82 ac ammeter 83 dc voltmeter 84 pnp/npn tranistor dual 4 meter 85 boyle law app heavey metal 86 torsion pendulum 87 reading telescop 88 jeager apparatus 89 milimeter/milivplter 90 daniel cell 91 digital multimeter 92 travelling microscope 93 spectrometer prism(crown/flint glass) 94 galvanometer 95 apparatus to study cheracteristic tunnel diode 96 ldr charecterritics app 97 study of smps 98 four probe methods 99 solar cell characteristic apparatus 100 single stage double stage rc coupled amplifife 101 transistorized differential amplifire 102 f e t amplifire 103 study of schmitt trigger circuits 104 8056 microprocessor with smps 105 cro digital 30 mhz/40mhz 106 multiplexer and demultiplexer built in power supply 107 professional large formate display ...

Department of Higher Education - Madhya Pradesh

34965557 bids are invited for sl. no. item title item description 1 1 containers 2 2 sauce pan with lid 3 3 fry pan 4 4 tava roti/ tava dosa 5 5 parrat 6 6 grater(multipurpose) 7 7 patila with lid 8 8 kadchhi 9 9 knife all types 10 10 peeler/ chamcha/ chimta/jhara/ masala dabba 11 11 cutlery set 12 12 chakla belan 13 13 kadahi with lid 14 14 dinner set (steel) 15 15 bucket/ dustbin/ tub 16 16 pressure cooker 17 17 lighter 18 18 tray 19 19 crockeries (tea set borosil glasses) 20 20 namak daniset 21 21 stiching material—needle box 22 22 gas chula with cylinder/ chimini 23 23 indection 24 24 paper napkins/ cloth napkin/ table mat 25 25 model parts of flower/ kidney/brain/heart/human eye& ear 26 26 weighting machine digital 27 27 sonometer sccale 28 28 scale electronice 29 29 weight sclae 6kg 30 30 calcium oxide 31 31 clycerol 32 32 iodine solution 33 33 phenol 34 34 glacial acetic acid 35 35 safferemine 36 36 potassium mydroxide 37 37 canada balson 38 38 fehling solution 39 39 calcium chloride 40 40 acid accumulator 41 41 cylender noggel/ regulator/rubber set 42 42 bottele opener 43 43 sweing machine 44 44 washing machine 45 45 fabric colour set 46 46 bad sheet 47 47 soffa set cover 48 48 dinning table cover 49 49 vacume cleaner 50 50 hair cap/ aprin 51 51 microwave 52 52 phillips otg 53 53 toster 54 54 grill sandwich maker 55 55 hand grinder 56 56 steel bartan set 57 57 coffe maker 58 58 mixer /grider/ juicer 59 59 all types seaser 60 60 water coler 20 l 61 61 aquagurd 62 62 modular kitchen 63 63 autoclave portable 21l 64 64 autoclave portable50l 65 65 dissecting microscope 66 66 binocular microscope 67 67 deep freezer 68 68 compoundmicroscope 69 69 high defination microscope 70 70 microscopic eye pic 71 71 triangular microscope 72 72 ganong respirometer 73 73 hot air oven 14x14x14 74 74 magnetic stirrer with hot plate 75 75 maximum minimum thermometer 76 76 micro pipette variable 1 5ml 77 77 uv chromatographic chamber 78 78 ph meter ( digital ) with elctrodes 79 79 thin layer chromatography apparatus 80 80 water bath double wall ( 12 holes) ss 81 81 bod incubator 82 82 digital colony counter 83 83 digital tds meter 84 84 flame photometer 85 85 interactive led panel 86 86 digital thermometer 87 87 projection microscope 88 88 betological incubator stainless steel 89 89 laminar air flow horizontal 90 90 hair dryer 91 91 homogenizer 92 92 distillation apparatus doubledistillation 93 93 micro kjeldahl & distillation apparatus 94 94 soxhlet extraction unit 95 95 vortex shaker 96 96 auxanometer 97 97 computer system with licenced operating system internet facility 98 98 farmer potometer / ganog potometer 99 99 water and soil analysis testing kit (digital ) 100 100 tissue culture rack ( caster rack ) 101 101 blackman apparatus 102 102 gel electrophoresis unit with power supply 103 103 heating mantle with regulator cap 1 litre 104 104 occular micrometer/ stage micrometer 105 105 stem borer 106 106 cod analyzer multi parameter beanch 107 107 oxygen electrode 108 108 rotatory microtome 109 109 specimen 20pices 110 110 botany/zoology/physics/chemistry/home science map 111 111 digital spectrophotometer 112 112 blood pressure machine 113 113 plant collection net 114 114 centrifuge machine 115 115 glucometer 116 116 inverter 117 117 laboratory stirrer 118 118 insect collection net 119 119 chemical blance digital 0.01 to 600gm 120 120 chemical cabinet storage 121 121 rotary vane vaccume pump 122 122 oil free vacuum pump 123 123 muffle furnace 124 124 refrigerator 125 125 digital melting pint apparatus 126 126 karl fisher titrator 127 127 student polarimeter 128 128 digital conductivity meter 129 129 digital photo colorimeter 130 130 dissolved oxygen meter 131 131 flask shaker ( wrist action type ) 132 132 screw guage/ vernier calipers 133 133 ammeter dc/ac 134 134 stop watch digital / stop clock 135 135 analog multimeter /digital multi meter 136 136 voltmeter dc/ac / galvanometer 137 137 spectrometer prism ( crown/ flint glass) 138 138 thermometer different range 139 139 analog to digital converter power supply 140 140 rheostat ( various length ) 141 141 battery eliminator 142 142 apparatus to study specific resistance energy gap 143 143 apparatus to study characteristics tunnel 144 144 apparatus to study characteristics of zener diode 145 145 anderson/schering/hay/kelvin/maxwell 146 146 apparatus to study rc coupled amplifier power supply 147 147 audio frequency generator 148 148 laclanche cell 149 149 function generator 1 hz to 10 mhz 150 150 battery charger 2 to 12 volt 151 151 apparatus to study response curve for lcr 152 152 apparatus to draw b h curve of ferromagnetic 153 153 complete apparatus to determine the heating 154 154 potentiometer 155 155 mos fet/ fet characteristics apparatus 156 156 half adder /full adder/half subtractor 157 157 half wave and full wave rectifier apparatus 158 158 zener regulated power supply 159 159 8085/8086 microprocessor kit 160 160 photo diode characteristics apparatus 161 161 digital to analog converter with built in power 162 162 travelling microscope 163 163 series and parallel resonance circuit 164 164 solar cell characteristics apparatus 165 165 encoder and decoder circuit with built in power 166 166 cro dual trace 30/40 mhz 167 167 plancks constant using solar cell apparatus 168 168 function generator 0 3 to 30 mhz 169 169 vibration magnetometer 170 170 single stage and double stage r c couple 171 171 power amplifier ( trainer board) 172 172 variable regulated dc power supply 0 30v range 173 173 scr / ujt characteristics apparatus 174 174 horizontal torsion apparatus 175 175 multiplexers and demultiplexers with built in 176 176 stefan constant apparatus 177 177 regulated power supply trainer board 178 178 dielectric constant apparatus 179 179 thermistor characteristic apparatus 180 180 drill machine with all size bits (hammer) 181 181 bread board (trainer kit) 182 182 study of amplitude modulation and demodulation 183 183 digital ic trainer kit 184 184 study of crystal oscillator 185 185 four probe method 186 186 induction hot plate with induction ports 187 187 op amp as voltage follower trainer board 188 188 youngs modulus apparatus 189 189 frank hartz experiment setup using argon gas 190 190 thyratron characteristics apparatus 191 191 transistorized push pull amplifier 192 192 michelson interferometer apparatus 193 193 study of frequency modulation and demodulation 194 194 op amp as voltage to frequency/frequency to 195 195 study of active and passive filters 196 196 zeeman effect experiment 197 197 fresnel biprism diffraction apparatus 198 198 study of tdm pcm reciever/ transmitter 199 199 study of smps ...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Mahatma Gandhi Chitrakoot Gramodaya Vishwayidyalaya - Madhya Pradesh

34126775 supply of dairy technology machinery / equipments under aspire project ss 304 bulk milk cooler 300 liter , milk transfer centrifugal pump .05 hp , batch pasteurizer 100 ltr , ss inline filter, on line , milk homogenizer manual 100 lph , milk transfer centrifugal pump .05 hp , cooling tower , phe / milk chiller 200 lph , milk pouch filling machine 200 ml and 500 ml, normal speed, mechanically operated, pouch packing machine to pack milk in pouch production along with date coding and photocell unit , cream separator offline 165 lph , curd culture mixing tank 100 liter , curd incubator chamber 50 liter , paneer coagulation tank 100liter moc ss 304, single sheet of 1.5 mm thickness , paneer press cum hoops 10 kg , multipurpose khoya making / milk boiling machine 120 liter , mcc / control panel , on line ss pipe line & fittings moc ss 304, grade 304 required quantity of valves and fitting materials for connecting all supplied machines , ...

Department of Higher Education - Madhya Pradesh

33574677 bids are invited for boq1 autoclave portable , boq2 dissecting microscope , boq3 binocular microscope , boq4 cooling centrifuge , boq5 deep freezer , boq6 digital balance 0.1mg , boq7 compoundmicroscope , boq8 high defination microscope , boq9 microscopic eye pic , boq10 triangular microscope , boq11 ganong respirometer , boq12 hot air oven , boq13 magnetic stirrer with hot plate , boq14 maximum minimum thermometer , boq15 micro pipettevariable 1 5ml , boq16 uv chromatographic chamber , boq17 ph meter digital , boq18 slide cabinet with 12 showcase , boq19 thin layer chromatography apparatus , boq20 water bath double wall12 holes ss , boq21 wilmotts bubbler , boq22 bod incubator , boq23 digital colony counter , boq24 digital tds meter , boq25 flame photometer , boq26 interacticv led panel , boq27 compound microscope , boq28 digital thermometer , boq29 projection microscope , boq30 cetological incubator stainless steel , boq31 laminar air flow horizontal , boq32 rotary microtome , boq33 visualizervisual presenter teletop camera , boq34 autoclave vertical , boq35 hair dryer , boq36 homogenizer , boq37 distillation apparatus single distillation , boq38 distillation apparatus doubledistillation , boq39 micro kjeldahl & distillation apparatus , boq40 soxhlet extraction unit , boq41 vortex shaker , boq42 auxanometer , boq43 computer system with licenced operating system internet facility , boq44 farmer potometer , boq45 ganong potometer , boq46 water and soil analysis testing kit digital , boq47 wooden press for herbarium , boq48 tissue culture rackcaster rack , boq49 blackman apparatus , boq50 camera lucida with filter micro type , boq51 camera lucida with filterprism type , boq52 gel electrophoresis unit with power supply , boq53 heating mantle with regulator cap 1 litre , boq54 microscopic camera , boq55 noise level meter , boq56 occular micrometer , boq57 stage micrometer , boq58 stem borer , boq59 tisuue culture rackcaster rack , boq60 auxanometer , boq61 cod analyzer multi parameter beanch photometer , boq62 oxygen electrode , boq63 rotatory microtome , boq64 specimen 20pices , boq65 botany map , boq66 digital colony counter , boq67 digital flame photometer , boq68 digital spectrophotometer , boq69 blood pressure machine , boq70 plant collection net , boq71 centrifuge machine , boq72 electronic balance , boq73 electrophoresis unit total quantity : 240...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Madhya Pradesh Public Health Services Corporation Limited - Madhya Pradesh

33303554 online tender for the quantity fda equipments ( set 01 ) to be supplied and installed at various hospitals of government of madhya pradesh , fda equipments set 01 , conductivity meters & tds meter , multi tube vortexer , lab blender ( paddle type ) , flame photometer , gerber centrifuge , homogenizer , ph meters , elisa reader with plate washer , circulating cum shaking water bath , centrifuge ( high speed ) , sample shaker ( orbital shaker ) , laboratory grinding mill , analytical balance 4 digit ( 0.1mg ) , centrifuge ( refrigerated ) , 3 stages water purification system ( type 1 & 2 ) , full automatic fat analyser , karl fisher auto titrator , automated solid phase extraction system...

Department of Higher Education - Madhya Pradesh

32465961 bids are invited for 1 auto clave 2 do meter digital 3 digital meter counductivity meter and temp meter 4 digital photoelectric colorimeter 5lit 5 digital app double distilation cap 6 electronic blance0.01mg to 220g 7 flame photometer digital 8 heating metel 7lit 9 heating metal 2 lit 500w 10 humidity chamber 11 hotplate with energy regulator 500w 12 centrifuge machine 13 laboratory mixer 14 magnetic stirrer with hot plate 15 muffle furness 9*4*4 16 shaking machine with wrist action 17 bod incubator 18 uv b3chromatrographic chamber 19 vortex mixer 20 digital colony counter 4 digit 21 digital turbidity meter 3.5 digit 22 tds meter digital 23 test tube stand 24 test tube mid 25 test tube big 26 beaker100ml 27 beaker 50ml 28 volumetric flask 100ml 29 volumetric flask 50ml 30 water bath double 12 holes 31 water soil analysis kit 7 para meter 32 ph blance b56 33 hot plate 34 shaking machine 35 petri disk 4” 36 rotatory flask shaker 37 rotatory light vacuum pump 25 lit / per min 38 ph meter with electrodes 39 burett 50ml 40 measuring cylinder100ml 41 bursan burner 42 flask 250ml 43 flask 100 44 polorimeter half shaade 45 vacuum dessicator 46 flask 50ml 47 hot air oven 48 compuetr for chemistry 49 melting point apparatus digital 50 micropipette variable 1 compound microscope 2 dissecting microscope with bull lences 3 binocular microscope 4 research microscope with digital eye computer i31 tb 21.5 5 betrological oven 6 thin layer chromotograhic chamber 7 magnetic stirrers with hot plate digital 8 water and soil testing analysis kit 9 digital colony counter 10 rotatory microtome with accessories 11 plant collection set 12 digital spectrophotometer 13 ph meter 14 homogenizer 15 colorimeter 16 gel electroproshish with power supply ( vertical ) 17 hot air oven stainless steel 18 bod incubulator 19 map botany 20 heating mental with regulator cap 1lit 21 magnetic stirrers with hot plate 22 speciman of botany 23 water bath double wall 6 holes stainless stell 24 digital tds meter 1 compound microscope 2 dissecting microscope with bull lences 3 water bath double wall 4 water and soil testing analysis kit 5 heating mantel with regulator cap 1 6 spectrophotometer 7 digital colony counter 8 rotatory microtom with accessories 9 centrifuge machine3500 rpm 10 research microscope with digital eye computer 11 binocular microscope 12 dna model 3d 13 human plastic skeleton 14 blood pressure machine 15 insect collection net 16 parmanent slide sample 10pices set 17 zoology map 18 eupletella models 19 hylonema models 20 euspongia models 21 obelia models 22 velella models+b128 23 aurelia 24 pennatula 25 faciola 26 teniasolium 27 earthworm 28 octopus 29 starfish 30 autoclave portable 31 colony counter digital 32 endo skeleton of rabbit 33 silde ( parmanent slide ) hydra 34 chik embryo wm of 16 hrs incubation 35 ls of 18 hrs embryo 36 whole mount of toys embryo 37 double appratus single ditilation+b19 38 bod incubator 39 laminar air flow horizontal 40 tissu culture rack 41 autoclave portable 1 fet characteristic apparatus 2 mosfet characteristic app 3 ujt characteristic app 4 s.c.r characteristic app 5 thermistor characteristic app 6 diac and tiac characteristic app 7 photo diode characteristic app 8 photo transistor characteristic app 9 power amplifier 10 hartley and colpitts oscillator 11 study of hybrid parameters circuits 12 zanier regulated power supply 13 newton ring app complete with travelling microscope power 14 series and parailal resonrnce circuits 15 study of multivibrators using omamp 16 clipping and clamping circuits using operational amplifire 17 spectrometer 6 / 7 18 die electric constant apparatus 19 screw gauge electronic 20 verniear calipers electronics 21 bi prism assembly 22 ac ammeter 23 dc voltmeter 24 pnp / npn tranistor dual 4 meter 25 boyle law app heavey metal 26 torsion pendulum 27 reading telescop 28 jeager apparatus 29 milimeter / milivplter 30 daniel cell 31 digital multimeter 32 travelling microscope 33 spectrometer prism ( crown / flint glass ) 34 galvanometer 35 apparatus to study cheracteristic tunnel diode 36 ldr charecterritics app 37 study of smps 38 four probe methods 39 solar cell characteristic apparatus 40 single stage double stage rc coupled amplifife 41 transistorized differential amplifire 42 f e t amplifire 43 study of schmitt trigger circuits 44 rectifier and filter characteristic app 45 8056 microprocessor with smps 46 cro digital 30 mhz / 40mhz 47 study of hybrid parameters resonces circuits 48 study of transission line 49 digitalto analog converter with power supply 50 multiplexer and demultiplexer built in power supply 51 bcd to seven segment decoderr with built in power supply 52 pulse width pluse position modulation and demodulation 53 computer for physics lab 54 sodium lamp with smaps 55 mercury lamp with smps total quantity : 883...

Directorate Of Medical Education - Madhya Pradesh

32061822 tender for purchase of chemical and reagent for mdru dep tender for purchase of chemical and reagent for mdru dep , supply of chemicals and reagents for mdru , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 5 od , r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 5 od , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , tips i. 0.2 20 ?l tips pack size of 1000 each , tips ii. 20 200 ?l tips pack size of 1000 each , tips iii. 200 1000 ?l tips pack size of 1000 each , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tips , filter tips pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tips , filter tips pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tips , mct variable tubes , i. 20 200?l tubes pack size of 1000 psc. , ii. 200 600 ?l tubes each , iii. 500 2000 ?l tubes , nitrile autodextorous gloves pack size of 1000 psc. , mctstands for variable tubes sizes pack size of 1000 psc. each , i. 20 200?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , ii. 200 600 ?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , iii. 500 2000 ?l tubes stand , filter tip boxes pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000ml 05each , graduated beakers50, 100, 500, 1000ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , total rna mini kit ( human skin tissue ) pack size for 100 reaction , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , chloroform 500 ml , phenol 500 ml , isoamyl alcohol 500 ml , hno3 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , cholin cleaner 500 ml , sterilium 500 ml , hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , brown paper for autoclaving 10 rolls , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side 1 psc. each , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen 5ltrpkt. , liquid nitrogen sample handling gloves 5 sets of gloves , phosphate buffer saline 500 ml , formalin 500 ml , slide tray / rack pack of 2 psc. , paraffin wax ( 58 60c ) 250 gm , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 2 psc. , whatman filter paper grade 1 & 2 pack size of 50 psc. , harri’s hematoxylin powder 50 gm , yellow eosin powder 50 gm , coverslip 18x18 ( microscopic ) 100 psc. , dpx mount 50 ml , xylene 250 ml , glycerol 100 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , ammonia 250 ml , hot plate 1 psc. , methanol 250 ml. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , acrylamide / bis ar 500 gm , 10x tbe buffer 100 ml , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100ug , human pai 1 elisa kit pack size of 96 reactions , diethyl pyrocorbonate 5 ml , pbs 500ml , mortar and pestle homogenizers...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

31144223 tender for design supply and labour job fok installation testing commissioning and successful trial run of paneer whey condencing unit milk pasteuriser cream separator milk homogenizer automated cip system at jabalpur sahakari dugdh sangh mydt tender for design supply and labour job fok installation testing commissioning and successful trial run of paneer whey condencing unit milk pasteuriser cream separator milk homogenizer automated cip system at jabalpur sahakari dugdh sangh mydt , design and supply , whey condensing unit 1000 lph capacity , design and supply of paneer whey condensing unit complete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure: cement, sand, reinforcement, steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supporting evaporator and for man movement for processingoperations as per the design of the plant offered by bidder in consideration of static and dynamic loads. , milk pasteurizationplant 10, 000 lph with steam hot water generation / battery system ( skid mounted ) . , design and supply of milk pasteurizercomplete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure: cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation of required strength as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , homogeniser10, 000 lph ( high pressure , design and supply of homogenizer complete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , centrifuge tripurpose 10, 000lph , design and supply ofcentrifuge tripurpose 10, 000lph complete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structurecement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , automated double circuits cip system. , design and supply of automated double circuits cip system complete with all equipment and accessories as detailed in technical specifications and work scope , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations, trenches and mild steel for fabrication of structure, platforms and staircase for supports, piping, electrical cabling, covers over trenches and for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , labour job for civil construction, ms structure and support work, plant and equipment installation, testing, commissioning and training , whey condensing unit 1000 lph capacity , mechanicalthe above equipment shall be mechanically / electrically installed , commissioned, put into operationas per the diagram submitted by bidder and approved by jsds. the plant will be tested and after trial & trainingto be given to jsds staff as mentioned in mechanical and electrical installation clauses of the tender. , civil construction work and ms structure, platforms, stair case to support evaporator and for operation purpose:the location of evaporative unit to be installed is just adjoining to the paneer plant building, the bidder should visit the site at jds dairy plant in order to explore use of one side existing columns and wall of paneer plant building and shall construct rest requirednew civil structure for fabrication of ms structure, platforms and staircase to install the evaporative unit. use of existing civil structure of paneer plant building will easeaccessbetween these two plant building for operational convenience. bidder to construct civil structure and fabricate all others as required for self supporting ms structure considering the static and dynamic loads for installation of whey evaporating plant as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , milk pasteurizer 10000 lph , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc.bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , milk homogenizer 10000 lph , mechanical: complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. , cream separator 10000 lph , mechanical: complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc: bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , automated double circuited automated cip system , mechanical: complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cab ling etc bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , other dairy dairy equipment , cream tank 5000 liters , machenical: complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. , butter churn 5000 l , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, supports to be grouted for piping and cabling etc: bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. . , butter trolley with shovel 500 kgs each , mechanical: complete installation of all equipment and access ories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. , cooling tower of suitable capacity for 2000 lph cream pasteuriser , mechanical: complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc: bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. . , hot water generation system / battery for 10000 liters capacity milk pasteuriser , mechanical: complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc : bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms.. , note: 1. above price bid are in two part, ie. part 1 for main plant and equipment to and part 2 for other dairy equipment. 2. in part 1 the l 1 rate will be on the basis of lowest aggregate total of the offered price / cost of all the items under this part. 3. rates offered under part 2 will be taken for l 1 consideration only when price / cost offered for individual dairy equipment, not on aggregate total amount basis....

Department of Higher Education - Madhya Pradesh

30917338 bids are invited for hall effect apparatus , semiconductor diode characterstics apparatus , dielectric constant of solid & liquid , four probe method , optical bench , planks constant apparatus , newtons ring microscope , magnetic field measurement apparatus , lees disc apparatus , plant growth chamber , blood cell counter 8key , digital hemoglobinometer , digital ph meter , room thermometer for laboratory , digital turbidity meter ,document camera , electronic digital balance , fireextinguisher , glucometer , haemocytometer (completebox) , homogenizer , inverter , microscope image projectionsystem (mips) , sphygmomanometer , computer tablet ,voltage stabilizer , digital conductivity meter , doubledistillation , electronic balance , viscometer , colorimeterboq title boq bid total quantity : 125...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

30916563 design, supply and labour job for installation, testing, commissioning and successful trial run of paneer whey condensing unit, milk pasteuriser, cream separator , milk homogenizer, automated cip system in jabalpur sahakari dugdh sangh mydt jabalpur b ) design supply and labour jobs for installation testing commissioning and successful trial run of paneer whey condensing unit milk pasteurizer cream separator milk homogenizer automated cip system at jabalpur dugdh sangh b ) design supply and labour jobs for installation testing commissioning and successful trial run of paneer whey condensing unit milk pasteurizer cream separator milk homogenizer automated cip system at jabalpur dugdh sangh , design and supply , paneer whey condensing unit , design and supply of paneer whey condensing unit complete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supporting evaporator and for man movement for processingoperations as per the design of the plant offered by bidder in consideration of static and dynamic loads. , milk pasteurizationplant 10, 000 lph with steam hot water generation / battery system ( skid mounted ) . , design and supply of milk pasteurizercomplete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation of required strength as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , homogeniser10, 000 lph ( high pressure , design and supply of homogenizer complete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , centrifuge tripurpose 10, 000lph , design and supply ofcentrifuge tripurpose 10, 000lph complete with all equipment and accessories as detailed in technical specifications and work scope... , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , automated double circuits cip system. , design and supply of automated double circuits cip system complete with all equipment and accessories as detailed in technical specifications and work scope , supply of materials for civil constructionand ms structure cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations, trenches and mild steel for fabrication of structure, platforms and staircase for supports, piping, electrical cabling, covers over trenches and for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , cream storage tank 5000 liters , design and supply of cream storage tankcomplete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , butter churn 5000 liters , design and supply ofbutter churn 5000 liters capacity complete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure:cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , butter trolley with shovel 500 kgs each , design and supply ofcomplete with all equipment and accessories as detailed in technical specifications and work scope.. , cooling tower of suitable capacity for 2000 lph cream pasteuriser , design and supply of cooling tower of suitable capacity for 2000 lph cream pasteurizercomplete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure: cement, sandreinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , hot water generation system / battery for 10000 lph milk pasteuriser. , design and supply of hot water generation system / battery for 10000 lph capacity milk pasteurizer complete with all equipment and accessories as detailed in technical specifications and work scope.. , supply of materials for civil constructionand ms structure cement, sand, reinforcement steel, sand, murram etc for construction of civil structure, foundations and mild steel for fabrication of structure, platforms and staircase for supportingand for man movement foroperation as per the design requirement of the plant offered by bidder in consideration of static and dynamic loads. , labour job for civil construction, ms structure and support work, plant and equipment installation, testing, commissioning and training. , paneer whey condensing unit , mechanical the above equipment shall be mechanically / electrically installed , commissioned, put into operationas per the diagram submitted by bidder and approved by jsds. the plant will be tested and after trial & trainingto be given to jsds staff as mentioned in mechanical and electrical installation clauses of the tender. , civil construction work and ms structure, platforms, stair case to support evaporator and for operation purpose. the location of evaporative unit to be installed is just adjoining to the paneer plant building, the bidder should visit the site at jds dairy plant in order to explore use of one side existing columns and wall of paneer plant building and shall construct rest requirednew civil structure for fabrication of ms structure, platforms and staircase to install the evaporative unit. use of existing civil structure of paneer plant building will easeaccessbetween these two plant building for operational convenience. bidder to construct civil structure and fabricate all others as required for self supporting ms structure considering the static and dynamic loads for installation of whey evaporating plant as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms , milk pasteurizer 10000 lph , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , milk homogenizer 10000 lph , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , cream separator 10000 lph , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , automated double circuited automated cip system , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , cream tank 5000 liters , machenical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , butter churn 5000 l , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. , butter trolley with shovel 600 kgs each , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. , cooling tower of suitable capacity for 2000 lph cream pasteuriser , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms. . , hot water generation system / battery for 10000 liters capacity milk pasteuriser , mechanical complete installation of all equipment and accessories along withutility services, testing, commissioning, trial run and training as detailed in mechanical and electrical installation clauses of the tender. , civil construction workfor any requirement offoundations, suppotrs to be grouted for piping and cabling etc. bidder to construct civil foundations and ms supports etc. as per the design requirement of the plant offered in bidand as per the design requirement of the plant offered in bid, mp pwd / civil engineering / specifications / norms....

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

30310778 design supply and labour job for installation testing commissioning and successful trial run of paneer whey condensing unit milk pasteuriser cream separator milk homogenizer automated cip system at jabalpur dudgh sangh mydt , design and supply , whey condensing unit 1000 lph , milk pasteurizer 10000 lph , milk homogenizer 10000 lph , cream separator 10000 lph , double circuited automated cip system. , labour job for installation, testing, commissioning and training , whey condensing unit 1000 lph , milk pasteurizer 10000 lph , milk homogenizer 10000 lph , cream separator 10000 lph , double circuited automated cip system....

Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

30209276 tender for supply of laboratory equipments for biology ( botany and zoology ) laboratory equipments for biology ( botany and zoology ) anemo meter ( as per specification ) , auto exhaust analyzer ( as per specification ) , bio fermentar5 liter ( borosilicate glass ) ( as per specification ) , blackman’s apparatus ( as per specification ) , centrifuge machine ( cooling ) maximum speed 24000 rpm ( as per specification ) , cod analyzer ( as per specification ) , digital thermometer ( as per specification ) , dissecting microscope ( as per specification ) , dslr camera ( as per specification ) , electronic digital balance ( read ability 0.01 mg ) ( as per specification ) , ganong’srespirometer ( borosilicate glass ) ( as per specification ) , gel documentation ( as per specification ) , gel electrophoresis unit with power supply ( horizontal ) ( as per specification ) , gramen gps ( as per specification ) , hair dryer ( as per specification ) , heating mental with regulator cap 1 liter ( as per specification ) , high volume air sampler ( as per specification ) , homogenizer ( as per specification ) , hplc ( binary system ) ( as per specification ) , image projection system ( mips ) ( as per specification ) , microscopic camera ( digital eyepiece camera 10mp, with measuring software ) ( as per specification ) , noise level meter ( digital sound & noise level meter ) ( as per specification ) , pcr machine ( gradient thermal cycler pcr ) ( as per specification ) , portable air sampler unit ( as per specification ) , stem borer ( as per specification ) , ultracentrifuge ( as per specification ) , visualizer ( visual presenter / teletop camera ) ( as per specification ) , aquarium kit ( as per specification ) , bones ( as per specification ) , biological models as per ug & pg syllabus / requirement ( as per specification ) , induction hot plate with induction pots ( as per specification ) , permanent slides ( as per specification ) , specimens ( as per specification ) , western blotting system ( as per specification ) ...

College Of Agriculture - Madhya Pradesh

30085148 providing 1. gel documentation system 2. gradient thermal cycler 3. tissue lyser cum homogenizer 4. herbarium storage racks/cabinet 5. seed germinator 6. empanelment for running tissue culture laboratory, green house/polyhouses facilities at biotechnology centre under rajmata vijayaraje scindia agricultural university, gwalior (m.p) for production, marketing and sale of plants for revenue generation second call 7. refrigerated high speed micro centrifuge 8. shaker water bath (water bath and chillier circulating water bath) 9. election microscope (field emission scanning electron microscope (fesem) complete unit first call 10. pots...

Madhya Pradesh Laghu Udyog Nigam Limited - Madhya Pradesh

26355901 supply of laboratory equipments for biology ( botany and zoology ) 2 anemo meter 3 auto exhaust analyzer 4 autoclave portable 5 autoclave vertical cap. 50 liter 6 auxanometer 7 binocular dissecting microscope 8 binocular microscope 9 bio fermentar5 liter ( borosilicate glass ) 10 blackman’s apparatus 11 bod incubator 12 bomb calorimeter ( with oxygen cylinder ) 13 bomb calorimeter ( without oxygen cylinder ) 14 camera leucida with filter ( micro type ) 15 camera leucida with filter ( prism type ) 16 centrifuge machine ( cooling ) maximum speed 24000 rpm 17 centrifuge machine 3500rpm 18 cod analyzer 19 compound microscope 20 deep freezer 21 digital balance ( 0.1 mg ) 22 digital colony counter 23 digital tds meter ( microcontroller based conductivity tds meter ) 24 digital thermometer 25 dissecting microscope 26 distillation apparatus double distillation capacity 5 liter 27 distillation apparatus single distillation capacity 5 liter 28 dslr camera 29 electronic digital balance ( read ability 0.01 mg ) 30 farmer’s potometer 31 flame photometer 32 ganong’s potometer ( borosilicate glass ) 33 ganong’s respirometer ( borosilicate glass ) 34 gel documentation 35 gel electrophoresis unit with power supply ( horizontal ) 36 gramen gps 37 hair dryer 38 heating mental with regulator cap 1 liter 39 high volume air sampler 40 homogenizer 41 hot air oven ( with digital controller ) size 455 x 455 x 455 mm 42 hot air oven ( with digital controller ) size 605 x 605 x 605 mm 43 hplc ( binary system ) 44 image projection system ( mips ) 45 incubator stainless steel ( with digital controller ) 46 laminar air flow horizontal 47 magnetic stirrer with hot plate 48 maximum minimum thermometer 49 micro keldahal & distillation apparatus 50 micro pipette ( fixed 1 5 μl ) 51 micro pipette ( variable 1 5 μl ) 52 microscopic camera ( digital eyepiece camera 10mp, with measuring software ) 53 moll’s half leaf apparatus 54 noise level meter ( digital sound & noise level meter ) 55 normal chromatographic chamber 56 ocular micrometer 57 pcr machine ( gradient thermal cycler pcr ) 58 ph meter ( digital ) ( microcontroller based ph meter with electrode & temp. probe ) 59 portable air sampler unit 60 quadrats 61 rotatory microtome with accessories 62 slide cabinet with 12 showcase 63 soxhlet extraction unit ( borosilicate glass ) 64 stage micrometer 65 stem borer 66 thin layer chromatography apparatus 67 tissue culture rack ( caster rack ) 68 ultracentrifuge 69 uv trans illuminator 70 uv vis spectrophotometer ( double beam ) variable bandwidth 71 uv vis spectrophotometer ( single beam ) micro controller based 72 visualizer ( visual presenter / teletop camera ) 73 vortex shaker 74 water & soil testing ( analysis ) kit 75 water bath double wall ( 12 holes ) stainless steel 76 wilmott’s bubbler 77 wooden press for herbarium 78 aquarium kit 79 automatic burette 80 blood cell calculator 81 bones 82 biological charts as per ug & pg syllabus / requirement 83 biological models as per ug & pg syllabus / requirement 84 digital haemoglobinometer 85 dissecting tray 86 haemocytometer kit 87 induction hot plate with induction pots 88 permanent slides 89 specimens 90 water bath double wall stainless steel 91 western blotting system...

Jiwaji University - Madhya Pradesh

25010186 supply of various instruments of sos in pharmacy , equipment , bod incubator , humidity oven , automated hematology analyzer , tissue homogenizer , plethysmometer , animal simulator software...

College Of Agriculture - Madhya Pradesh

24860588 purchase of laboratory equipments/ structures: 1. bench top lyophilizer (freez dryer) second call 2. dna sequencer ( ngs) 3. fragment analyzer (advanced capillary electrophoresis system) 4. cryotome 5. bioreactor system 6. flow cytometer 7. horizontal laminar air flow cabinet 8. genomics softwares first call 9. ultra pure water purification system 10. cold room for short term storage units for germplasm/biological materials storage 11. gel documentation system 12. bod incubator 13. gradient thermal cycler 14. hot air oven 15. automated system for protein, nucleic acid extraction and cell separation ( automatic dna extraction system) 16. tissue lyser cum homogenizer 17. manual cup filler to pack soil in bag 18. tissue culture media mixing, automatic filling and capping equipment 19. herbarium storage racks/cabinet 20. seed germinator 21. bod (walk in type) 22. seed packing machine 23. liquid nitrogen generator 24. micropipettes 25. attachment for existing multimode (synergy htx) reader for nano sample reading 26. empanelment for running tissue culture laboratory, green house/polyhouses facilities at biotechnology centre under rajmata vijayaraje scindia agricultural university, gwalior (m.p) for production, marketing and sale of plants for revenue generation...