Department of Higher Education - Madhya Pradesh

34965557 bids are invited for sl. no. item title item description 1 1 containers 2 2 sauce pan with lid 3 3 fry pan 4 4 tava roti/ tava dosa 5 5 parrat 6 6 grater(multipurpose) 7 7 patila with lid 8 8 kadchhi 9 9 knife all types 10 10 peeler/ chamcha/ chimta/jhara/ masala dabba 11 11 cutlery set 12 12 chakla belan 13 13 kadahi with lid 14 14 dinner set (steel) 15 15 bucket/ dustbin/ tub 16 16 pressure cooker 17 17 lighter 18 18 tray 19 19 crockeries (tea set borosil glasses) 20 20 namak daniset 21 21 stiching material—needle box 22 22 gas chula with cylinder/ chimini 23 23 indection 24 24 paper napkins/ cloth napkin/ table mat 25 25 model parts of flower/ kidney/brain/heart/human eye& ear 26 26 weighting machine digital 27 27 sonometer sccale 28 28 scale electronice 29 29 weight sclae 6kg 30 30 calcium oxide 31 31 clycerol 32 32 iodine solution 33 33 phenol 34 34 glacial acetic acid 35 35 safferemine 36 36 potassium mydroxide 37 37 canada balson 38 38 fehling solution 39 39 calcium chloride 40 40 acid accumulator 41 41 cylender noggel/ regulator/rubber set 42 42 bottele opener 43 43 sweing machine 44 44 washing machine 45 45 fabric colour set 46 46 bad sheet 47 47 soffa set cover 48 48 dinning table cover 49 49 vacume cleaner 50 50 hair cap/ aprin 51 51 microwave 52 52 phillips otg 53 53 toster 54 54 grill sandwich maker 55 55 hand grinder 56 56 steel bartan set 57 57 coffe maker 58 58 mixer /grider/ juicer 59 59 all types seaser 60 60 water coler 20 l 61 61 aquagurd 62 62 modular kitchen 63 63 autoclave portable 21l 64 64 autoclave portable50l 65 65 dissecting microscope 66 66 binocular microscope 67 67 deep freezer 68 68 compoundmicroscope 69 69 high defination microscope 70 70 microscopic eye pic 71 71 triangular microscope 72 72 ganong respirometer 73 73 hot air oven 14x14x14 74 74 magnetic stirrer with hot plate 75 75 maximum minimum thermometer 76 76 micro pipette variable 1 5ml 77 77 uv chromatographic chamber 78 78 ph meter ( digital ) with elctrodes 79 79 thin layer chromatography apparatus 80 80 water bath double wall ( 12 holes) ss 81 81 bod incubator 82 82 digital colony counter 83 83 digital tds meter 84 84 flame photometer 85 85 interactive led panel 86 86 digital thermometer 87 87 projection microscope 88 88 betological incubator stainless steel 89 89 laminar air flow horizontal 90 90 hair dryer 91 91 homogenizer 92 92 distillation apparatus doubledistillation 93 93 micro kjeldahl & distillation apparatus 94 94 soxhlet extraction unit 95 95 vortex shaker 96 96 auxanometer 97 97 computer system with licenced operating system internet facility 98 98 farmer potometer / ganog potometer 99 99 water and soil analysis testing kit (digital ) 100 100 tissue culture rack ( caster rack ) 101 101 blackman apparatus 102 102 gel electrophoresis unit with power supply 103 103 heating mantle with regulator cap 1 litre 104 104 occular micrometer/ stage micrometer 105 105 stem borer 106 106 cod analyzer multi parameter beanch 107 107 oxygen electrode 108 108 rotatory microtome 109 109 specimen 20pices 110 110 botany/zoology/physics/chemistry/home science map 111 111 digital spectrophotometer 112 112 blood pressure machine 113 113 plant collection net 114 114 centrifuge machine 115 115 glucometer 116 116 inverter 117 117 laboratory stirrer 118 118 insect collection net 119 119 chemical blance digital 0.01 to 600gm 120 120 chemical cabinet storage 121 121 rotary vane vaccume pump 122 122 oil free vacuum pump 123 123 muffle furnace 124 124 refrigerator 125 125 digital melting pint apparatus 126 126 karl fisher titrator 127 127 student polarimeter 128 128 digital conductivity meter 129 129 digital photo colorimeter 130 130 dissolved oxygen meter 131 131 flask shaker ( wrist action type ) 132 132 screw guage/ vernier calipers 133 133 ammeter dc/ac 134 134 stop watch digital / stop clock 135 135 analog multimeter /digital multi meter 136 136 voltmeter dc/ac / galvanometer 137 137 spectrometer prism ( crown/ flint glass) 138 138 thermometer different range 139 139 analog to digital converter power supply 140 140 rheostat ( various length ) 141 141 battery eliminator 142 142 apparatus to study specific resistance energy gap 143 143 apparatus to study characteristics tunnel 144 144 apparatus to study characteristics of zener diode 145 145 anderson/schering/hay/kelvin/maxwell 146 146 apparatus to study rc coupled amplifier power supply 147 147 audio frequency generator 148 148 laclanche cell 149 149 function generator 1 hz to 10 mhz 150 150 battery charger 2 to 12 volt 151 151 apparatus to study response curve for lcr 152 152 apparatus to draw b h curve of ferromagnetic 153 153 complete apparatus to determine the heating 154 154 potentiometer 155 155 mos fet/ fet characteristics apparatus 156 156 half adder /full adder/half subtractor 157 157 half wave and full wave rectifier apparatus 158 158 zener regulated power supply 159 159 8085/8086 microprocessor kit 160 160 photo diode characteristics apparatus 161 161 digital to analog converter with built in power 162 162 travelling microscope 163 163 series and parallel resonance circuit 164 164 solar cell characteristics apparatus 165 165 encoder and decoder circuit with built in power 166 166 cro dual trace 30/40 mhz 167 167 plancks constant using solar cell apparatus 168 168 function generator 0 3 to 30 mhz 169 169 vibration magnetometer 170 170 single stage and double stage r c couple 171 171 power amplifier ( trainer board) 172 172 variable regulated dc power supply 0 30v range 173 173 scr / ujt characteristics apparatus 174 174 horizontal torsion apparatus 175 175 multiplexers and demultiplexers with built in 176 176 stefan constant apparatus 177 177 regulated power supply trainer board 178 178 dielectric constant apparatus 179 179 thermistor characteristic apparatus 180 180 drill machine with all size bits (hammer) 181 181 bread board (trainer kit) 182 182 study of amplitude modulation and demodulation 183 183 digital ic trainer kit 184 184 study of crystal oscillator 185 185 four probe method 186 186 induction hot plate with induction ports 187 187 op amp as voltage follower trainer board 188 188 youngs modulus apparatus 189 189 frank hartz experiment setup using argon gas 190 190 thyratron characteristics apparatus 191 191 transistorized push pull amplifier 192 192 michelson interferometer apparatus 193 193 study of frequency modulation and demodulation 194 194 op amp as voltage to frequency/frequency to 195 195 study of active and passive filters 196 196 zeeman effect experiment 197 197 fresnel biprism diffraction apparatus 198 198 study of tdm pcm reciever/ transmitter 199 199 study of smps ...

Department of Higher Education - Madhya Pradesh

34700671 bids are invited for laboratory equipment 1 mosfet chara cteristics apparatus 2 photo transistor char apparatus 3 e m by milikans oil drop method 4 constent deviation spectrograph 5 ujt char apparatus 6 hartely and colpitts apparatus 7 cro dual trace 30 mhz 8 zener regulated power supply 9 compound microscope 10 dissecting microscope 11 binocular microscope 12 slide reader 13 water bath double wall 14 water and soil testing kit 15 ph meter 16 electronic digital balance 17 oven 18 tissue culture rack 19 thin layer chromatography 20 chrometographic chamber 21 oven 22 electronic digital balance 23 tds meter digital 24 microprocessor water soil testing kit 25 chemical balance 26 water and soil testing kit 27 thin layer chromatography 28 rotary microtome tih accessories 29 binocular microscope 30 research microscope 31 flame photometer 32 digital tds meter 33 ph meter 34 heating mental with regular cap 35 compound microscope 36 hot air oven ss 37 vortex shaker 38 image projection system total quantity : 137...

Department of Higher Education - Madhya Pradesh

34588406 bids are invited for lab item compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , electronic digital balance 0.01mg , deonizer with digital meter , d o meter digital , melting point apparatus digital , heating mentle 7 ltrs , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , sodium vapor lamp , ph meter digital , paper chromatography testing kit , chemical balance , chromatrographic chamber , digital balance accuracy 0.001 200grm , microprocessor flame photometer , thin layer chromatography kit , oven , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , apparatus to study charging and discharging of a capacitor , e m by milikans oil drop , zener diode characteristics apparatus with built in power supply , weight box , compound pendulum bar pendulum , jaegers apparatus to determine the surface tension , spectrometer 6 7 inches , transformer of mercury lamp , transformer for sodium vapor lamp , transistorized push pull amplifier , power amplifier , study of schmitt trigger circuit , study of hall effect compl1ete setup , ionization potential of lithium complete setup , fiber optics trainer , 8086 microprocessor with smps , complete apparatuses to determine e by milikons method , mosfet characteristic apparatus , lees apparatus to determine the hear conductivity of bad conductors of different geometry , complete apparatus to determine elm using thomsons method , dielectric constant apparatus , photo diode characteristic apparatus , inertia table , travelling microscope , vernier callipers , stop watch digital , newtons rings apparatus complete complete with travelling microscope power supply and sodium lamp , transistorized differential amplifier , study of amplitude modulation and demodulation trainer , apparatus to study response curve for lcr circuits and to determine the resonance frequency , battery charger 2 to 12 volt , potentiometer , single stage and double stage r.c. coupled amplifier feed back amplifier , solar cell characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , physical balance , thermister characteristic apparatus , voltmeter dc ac required range , zener regulated power supply , transistorized regulated power supply , rheostate various length , diac and triac characteristic apparatus , fet characteristic apparatus , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , hartley and colpitts oscillator...

Department of Higher Education - Madhya Pradesh

34514561 bids are invited for lab development autoclave portable , binocular microscope , bod incubator , centrifuge machine 3500 rpm , chemical balance , choromotography chamber , compound micrscope , conductivity meter with cell , cork boring machine , digital balance accuracy 0.001 200 , digital colony counter , digital ph meter conductivity , digital tds meter , digital turbidity meter , dissecting micro scope , distillation appratus 5 ltr , electronic balance 0.1 600 grm , flame photo meter digital , gel electrophoresis , heating mentle 7 ltr , heating mentle regular 1000ml , heating mentle regular 500 ml , hot air oven 14 x 14 , hot air oven stainless steel , image projection system , incubator stainless steel , kjeldal digestion 6 test, kjeldl digesition unit 6 test , laminar air flow horizontal, magnetic strirrer , melting point apparatus digital ,micro pippette fixed 1 5 ml , micro pippette variable, micropipette variable 1 5 ml , micro water and soil kit, oven , oven universal , paper choromotgraphytesting kit , ph meter , ph meter digital with electrodes ,potentio meter digital , rotary microtome withaccessories , single pan balance 0.01 300gr , slide box100 slide , slide box 50 slide , spectrophotometer340 900 , tds meter digital , thin layer chromatographykit , vortex shaker , water and soil testing , waterbath 12 holes , water bath 12 holes ss , water bath6 holes ss total quantity : 64...

Department of Higher Education - Madhya Pradesh

34435002 bids are invited for 1 auto clave 2 bod incubator 3 cromatographic chamber 4 spectrophotometer 5 do meter digital 6 counductivity meter digital with cell 7 digital ph metr conductivity meter and temperature meter 8 digital photoelectric colorimeter 5lit 9 double distilation apperatus cap4lit 10 electronic blance0.01mg to 600gm 11 flame photometer digital 12 heating metel 4lit 13 hotplate with energy regulator 1500w 25x40cm 14 laboratory stirer 15 melting point apparatus digital 16 muffle furness 9*4*4 17 ph meter digital with electrodes 18 potantiometer digital 19 rotatory flask shaker 20 vacuum pump 21 water bath double 12 holes 22 water soil analysis kit 7 para meter 23 conductivity meter digital 24 compound microscope 25 dissecting microscope with bull lences 26 slide box 50 slides 27 binocular microscope 28 image projection system projection microscope 29 water bath double wall 12holes 30 double distilation apperatus cap2lit 31 hot air oven stainless steel 32 heating mental with regulator 1 lit cap 33 magnetic strirrer with hot plate 34 vortex shaker 35 water and soil testing analysis kit 36 ph meter with electrodes 37 digital colony counter 38 rotatory microtome with accessories 39 centrifuge machine 3500 rpm 40 thin layer chromotograhic chamber 41 oven 42 gel electroproshish with power supply(vertical) 43 bod 44 compound microscope 45 dissecting microscope with bull lences 46 image projection system projection microscope 47 binocular microscope 48 digital colony counter 49 rotatory microtom with accessories 50 bod incubator ss steel 51 ph meter...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Department of Higher Education - Madhya Pradesh

34338126 bids are invited for boq bid autoclave , chromatrographic chamber , cod digestion apparatus , distillation apparatus double distillation borosilicate glass cap 5 liter , electronic balance 0 1 grm to 600 grm , heating mentle 2 lit 500 w , hot air oven 14 14 , melting point apparatus digital , paper chromatographytesting kit , rotary microtome with accessories ,soxhlet extraction apparatus with glass part , tdsmeter digital , thin layer chromatography kit ,water bath 6 holes total quantity : 34...

Directorate Of Medical Education - Madhya Pradesh

34145016 supply of medicine / surgical / iv fluid / surgical suture / surgical stapler / chemical kits aceborophylline 100 mg amantadine 100mg capsule apripitant capsule 125mg & 80mg calcitrol 0.25 mg cap calcitrol 0.5mg capsule calcitrol calcium carbonate and zinc capsule chloramphenicol 250mg capsule chloramphenicol 500mg capsule crizotinib 250mg capsule cyclosporine 100 mg cyclosporine 50 mg deferiprone 500 mg cap. imatinib mesylate 100 mg oseltamivir ( 45mg ) , capsule palbociclib 100 mg cap palbociclib 75 mg cap sildenafil 20mg tetracycline capsules 250 mg tetracycline capsules 500 mg ulipristal acetate capsules 5mg acyclovir 3% ear drop beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5% 5 ml ear drop fluromethanol eye drop gentamycin eye drop homatropine hydrobromide eye drop ip 5ml sterile lignocaine hcl 4% eye drop natamycin eye drop polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml polyvinyl alcohol 1.4% 5 ml prednisolone eye / drop. proparacaine hydrochloride 0.5% eye drops 5ml sodium chloride opthalmic solution 5% eye drop acyclovir 3% eye oint.5 gm tube atropine eye oint. 3gm tube chloramphenicol eye ointment 5 gm tube ciprofloxacin eye ointment 5 gm tube hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment tobramycin eye oint.3gm tube benzocain gel chlorhexadine gel choline salicyclic gel triamadone accetate gel sterile collogen granules nephro steril ( alanine 6.3 gm+l arginine 4.9 gm+l histidine 4.3 gm+l isoleucine 5.1 mg+l leucine 10.3 mg+l lysine 10.01 gm+l phenylalanine 3.8 gm+l threonine 4.8 gm+l valine 6.2 gm+methionine 2.8 gm+n acetylcarnosine 0.5 gm+proline 4.3 gm+serine 4.5 gm+tryptophan 1.9 gm ) 250ml infusion normal saline 1.6% 500 ml bottle parenteral nutrition two chamber bags without lipid ornidazole iv infusion 100ml bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle desflurane 240ml bottle solution usp inhalation anaesthetic adalimumab 20mg / 0.4ml inj adalimumab 40mg / 0.8ml inj adenosine 3 mg / ml 2 ml amp ado trastuzumab emtansine 100 mg inj alteplase 50mg inj amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle aminophylline 25 mg / ml 10 ml vial ampicillin+sulbactum 1.5 mg inj anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d anti human thymocyte immunoglobulin 25 mg anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj benzathine penicilline 12 lac iu / vial betamethasone sodium phosphate 4 mg / ml 1 ml amp biphasic insulin aspart ip penfill 100 iu inj 3 ml cartridge bortezomib 3 .5 mg / vial botalinin 100iu inj botalinin 200iu inj botulinum toxin type a injection buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj butorphanol 1mg / ml 1ml amp carboprost tromethamin 250 mcg / ml 1ml amp cefuroxime 1.5gm inj cefuroxime 500mg inj cetuximab 100mg 2mg / ml vial cetuximab 200mg 2mg / ml vial cetuximab 50mg 2mg / ml vial chloramphenicol 500mg inj chlorpromazine ip 25mg vial cholecalciferol 600000 iu / ml injection cis atracurium 2mg / ml vail cladribine 10 mg / 10ml inj clonidine hydrochloride 100 mcg / ml 10 ml vial contrast urograffin inj cytarabine 1000 mg iv cytarabine 100mg injection cytarabine 1gm inj daunorubicin 50 mg / vial dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) dextron 40 inj diatrizoate meglumine & diatrizoate sodium ( 37% ) vial diatrizoic acid 60% amp diatrizoic acid 65% amp diatrizoic acid 76% ( urographin dye ) injection diazepam 5 mg / ml 2 ml amp dicyclomine 10mg / ml 2 ml vial digoxin i.p. 0.5mg / 2 ml amp diltiazem 25mg / 5ml vial diphtheria antitoxin 1000 iu vial doxorubicin 500mg injection doxycyclin 100 mg injection edaravone 60 mg inj enalapril maleate inj 1.25 mg per ml 2ml vial ephedrine 30mg / ml 1ml inj esmolol / 40mg / ml 5 ml vial etanercept 25mg inj etanercept 50mg inj etomidate 2 mg / ml emulsion with mct 10ml vial fentanyl 100 microgran 2 ml amp fentanyl 50 microgran 2 ml amp fluorescein 20% 5 ml amp flupentixol 20 mg inj flupentixol 25 mg inj fluphenazine 25 mg / ml 1 ml amp ganciclovir 500 mg vial gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp gatifloxacin vial gentamycin 80mg / 2ml amp glutathion 600mg inj granulocyte colony stimulating factor ( gcsf ) inj haemocoagulase 1 iu inj haemophilus influenzae type b vaccine hepatitis b vaccine / 1ml hyaluronidase 1500 iu / 2ml amp ifosfamide + mesna 1gm inj infliximab 100mg inj insulin glargine injection iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle isobaric levobupivacaine 0.5% inj isoprenalin inj 1ml amp isoxsuprine hcl 5mg / ml 2ml amp ketamine hydrochloride 50 mg / ml 10 ml ketoprolac tromethamine 30 mg inj l aspiraginase 10000iu inj leuprolide 6.25mg inj levobupivacaine hyperbaric 0.5% lidocaine 4%, 5 ml vial lignocaine ( preservative free ) 2% 50 ml vial lignocaine 10% injection lignocaine 4% 30 ml vial lignocaine for spinal anaesthesia lignocaine 5% + destrose 7.5% 2 ml amp heavy lorazepam 2 mg / ml, 1 ml vial low molecular weight dextran 40000 vial mannicoccal acwy 0.5 ml inj meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial mephentermine 30 mg / ml 10 ml mesna 200mg injection methacarbamol 100 mg. / 10ml vial methotrexate 500mg injection metoprolol 5mg / ml 5ml vial micafungin 100 mg micronised progesterone 50mg / ml 2ml amp micronized progesterone 100mg / ml 2ml amp milrinone 1mg / ml solution for injection / infusion mitomycin c 40mg inj mitoxantrone 15 mg inj morphine sulphate 10mg / ml 1ml amp naloxone 0.4 mg / ml, 1 ml nikethamide amp nimodipine 10mg / 50ml injection nitrofurantoin injection olanzapine 10 mg inj olanzapine depot inj panitumumab 100mg / 5ml inj pembrolizumab 100mg / 4ml ( 25mg / ml ) penicillin v 125 mg inj pentoxiphylline 20 mg / ml pertuzumab 30mg / ml ( 420mg / 14ml ) phenobarbitone 100mg / ml 1ml amp. phenobarbitone 200mg / ml 1ml amp. pilocarpine 0.5 % / 1ml amp piperacillin 2 gm+tazobactam 250 mg placenta extract 2 ml injection pneumococcal vaccine 10 ml vial pregabalin inj progesterone b.p.100mg vial promethazine 2 ml / 2.5% vial protamine sulphate 1%, 10mg / 5ml amp quinine sulphate 300 mg / ml, 2 ml amp romiplostim 250 mg injection romiplostim 500 mg injection ropivacaine 0.5% 20 ml vial ropivacaine 0.75% 4ml amp ropivacaine 10mg / ml 2.5ml vial ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) sargramostim 500 mg inj soluble insulin penfill 3 ml injection surfactant ( porcine lung surfectant extract 80mg / ml ) terbutaline 0.5mg / ml aml amp teriparatide 600mcg 3 ml amp tetanus immunoglobulin usp 500 iu / vial thiamine 400mg inj thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) thiopentone sodium 0.5gm powder / vial, 20 ml vial tobramycine 80 mg vial tocilizumab 400 mg inj torsemide inj 2ml amp trypan blue opthalmic solution 0.06% pre filled syringe ulinastatin 100000iu injection urokinase 500000 iu vial vasopressine 40 iu / ml amp verapamil hydrochloride 2.5 mg / ml 2ml amp vinblastine 10 mg / 10 ml amp vinorolbine 50mg inj vit d3 injection vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj water for injection 10 ml amp zuclopenthixol acuphase 50 mg inj zuclopenthixol decanoate 200 mg inj acetic acid solution 3% 100ml acetone detection kit ada kit ae 1 / ae 3 aluminium ammonium sulphate powder 500gm amacr ana test kit anti a lactin 05ml anti ab sera 10ml anti d igg+ igm 10ml anti d igm 10ml anti h lactin 05ml anti her / erbb2 monoclonal anti human globulin ( ahg ) 05ml anti a sera 10 ml anti b sera 10 ml banded use in blood bank barium chloride 10 % 500 ml bcl 2 benedict reagent 5 lit cane bismark brown stain 100 gm blood culture media aerobic for adult ( bac t / alert pf plus blood culture media anaerobic for pediatric ( bac t / alert pf plus ) blotting paper 50 / pkt bovine albumin 22% 05ml buffer solution for hiv 50ml ca 125 calcium chloride 05ml / vail capillary tube cd34 combined spinal epidural ( cse ) kit couplin jar cover slips size 18x18mm cover slips size 22x22mm cox 2 csf protein kit cyclin d 1 cyto fix spray desmin disposable microtome blade ( 50 blades in one ) dpx mount 250ml ehlrich aldehyde reagent 125 ema estrogen receptor epi monoclonal filter paper 12.5 cm 0.1 micron ( 50 per pkt ) fouchet reagent 250ml glacial acetic acid 100 ml glial fibrillary acidic protein ( gfap ) h2so4 25 % 500 ml bottle haematoxylene 5gm haemoglobin strip hbv elisa test kit 4th generation 96 test hbv rapid test kit hpr polymerr kit with dab chromogen hydro chloride acid about 36.46% i.d. microtyping abd card i.d. microtyping gel card ahg immersion oil iso propyl alcohol ki67 / mib 1 06 ml antibody kit leishman stain 500 ml leucoreductionfilter ( bed side ) light green stain 100 gm liquid ammonia 500 ml liss diluent for gel card malaria parasite elisa test kit massons trichrome stain mercuri oxide 25gm methanol 2.5lit mgg 480ml multi parameter urine strips ( 100 in 1 box ) myogenin n / 10 hcl 500ml nfp nitric acid 500 ml nkx 3 1 p 53 pandys reagent 125ml pap pen papanicalou ea 125ml pea 030 papanicalou og 6 125ml pea 010 paraffin wax 58 60c pas stain pasture pipette poly l ltsin solution p8920 polythene gloves pricking lancet progestron receptor monoclonal retic stain 125ml s 100 sharp collection containers disposable 5 ltrs sharp collection containers disposable 1.5 ltrs single donor platelet kit make haemonotics / terumo penpol ( close system ) slide tray sma sodium chloride for analysis steel cassets for tissue processing sulpgar powder 500 gm sulpho salicylic acid 500ml synaptophysin tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) tissue paper roll titriplexiii pure ( edta ) tris buffer gr tween 20 for synthesis vdrl elisa test kit vimentin wafers cutting blade for tube welders xylene chlorhexidine mouthwash 0.2% 50 ml sterile haemocoagulase solution topical solution 0.2 cu nasal drop saline nasal gel 15 gm tube budesonide nasal spray 32mcg / spray methylcobalamin nasal spray 250 mcg saline nasal wash 3gm kit sodium chloride nasal wash betamethasone 0.5mg, gentamicin 1mg betamethasone valerate cream 0.05% 15gm betamethasone valerate ointment 0.1%, 15 gm tube centella asiatica extract based skin moisturization and antiscar gel 30gm clindamycin ointment 10gm fluconazole ointment 20 gm tube fusidic acid 2%, 15 gm heparin 20gm oint human placental extract ointment ketoconazole cream lidocaine zinc oxide ointment luliconazole cream la magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm papain urea and silk protein based debriding ointment and cream 100 gm papain urea and silk protein based debriding ointment and cream 25 gm papain urea and silk protein based debriding ointment and cream 50 gm papain urea 15 gm tube povidone iodine ointment 7.5%, 500 gm salicylic acid 2%, 30 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm silver sulphadiazine cream usp 1% w / w 250gm clotrimazole+beclomethasone oral paint triamcinolone oromucosal paste bp 0.1% ketocanazole oral paste triamcinolone acetonide dental paste usp 0.1% barium sulphate powder 250 gm clotrimazole powder neomycin sulphate+polymycin b powder polyethylene glycol + electrolyte powder protein powder silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial n acetylcysteine solution for inhalation respules tiotropium ( 18 mcg ) + formoterol ( 12 mcg ) fostomycin sachet 3gm orodispersible probiotic sachet acyclovir lotion beclomethasone lotion citric acid 500 ml bottle compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml feracrylum solution 1% 100 ml gention violet l / a glycerine 15% and sodium chloride 15% enema 20ml sodium hypochloride solution 5% 5 ltr topical heparin solution 5ml vial benzocaine +cetramide spray lignocaine spray 10% absorbable 2 0 endo suture cartridge 48 length advance rf energy hand instrument of 5 mm shaft diameter for laproscopic procedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm disposable circular stapler 31mm diameter disposable circular stapler – 32mm diameter disposable circular stapler 33mm diameter disposable circular stapler iii rows disposable circular stapler 25 / 26mm diameter disposable circular stapler 28 / 29mm diameter disposable clip applier medium 10mm with 20 clips disposable clip applier medium 5mm with 16 clips disposable curved cutter stapler disposable hemorrhoidal stapler iiirows disposable hemorrhoidal stapler with detachable anvil. disposable linear stapler with fixed staple height 75mm 90mm size disposable linear stapler with fixed staple height 55mm 60mm size disposable trocar 05mm disposable trocar 10mm disposable trocar 12mm disposable trocar 15mm distal tip closure titanium ligation clip large size distal tip closure titanium ligation clip medium size distal tip closure titanium ligation clip small size endoscopic cutter & stapler 60mm long length endoscopic cutter & stapler 60mm regular length endosuturing device 10mm with toggle lever handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh handpiece ( transducer ) compatible with ultrasonic vessel sealing dissector installed in myh hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc locking clip cartridge medium / large mesh fixation device with non absorbable titatinum tacks 20 multifire clip applier long size 15 clip multifire clip applier small size 20 clip non absorbable 2 0 endo suture cartridge 48 length open clip applicator 100 20cm length open clip applicator 200 20cm length open clip applicator 300 open clip applicator 400 open disposable clip applier for medium clip size 9.75 having 20 clips open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length plastic locking clip applicator medium / large polycearbonte bladeless trocar with reducer seal 10mm polycearbonte bladeless trocar with reducer seal 12mm polycearbonte bladeless trocar with reducer seal 5mm polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm reload 55 60mm for medium thick tissue blue compatible with linear cutter. reload 55 60mm for thin / vascular tissue white compatible with linear cutter. reload 75 80mm for medium thick tissue blue compatible with linear cutter. reload 75 80mm for thick tissue green compatible with linear cutter. reload compatible with curved cutter reload endoscopic cutter & stapler 45mm purple reload endoscopic cutter & stapler 60mm purple reload endoscopic cutter & staplter 45mm blue reload endoscopic cutter & staplter 45mm green reload endoscopic cutter & staplter 60mm / black reload endoscopic cutter & staplter 60mm blue reload endoscopic cutter & staplter 60mm gold reload endoscopic cutter & staplter 60mm green reload endoscopic cutter & staplter 60mm white reload for linear stapler with fixed staple height 35mm 45mm size blue reload for linear stapler with fixed staple height 35mm 45mm size green reload for linear stapler with fixed staple height 55mm 60mm size blue reload for linear stapler with fixed staple height 55mm 60mm size green reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly reusable laparoscopic clip applicator for large titanium clips. reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly reusable linear cutter 55 60mm with 200 firing reusable linear cutter 75 80mm with 200 firing single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip suture locking autolock titanium clip 100 titanium clip 400 universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. paracetamol suppository abdominal drain no 8 abdominal drain bag accessory spikes amorphous hydrogel with colloidal silver antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm antimicrobial incise drape 3 meter antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm arterial pressure bag 1000ml arterial pressure bag 500ml ash brace m size barium sulphate liquid 1 liter bionet connector biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered bipolar forceps cable bis monitor electrode black monofilament 2 / 0 rc loop black thread ( stitching ) big bleaching powder gr ii 25 kg bag blood bag double 350 ml cpd solu blood bag double 350 ml with sagam blood bag quadruple 350 ml top bottom with cpd sagam solu blood bag quadruple 450 ml top bottom with cpd sagam solu blood bag single 350 ml blood bag transfer 350 ml blood bag triple 350 ml blood bag triple 350 ml sagam blood culture bottles bone marrow aspiration needles ( 14 ) bone marrow aspiration needles ( 15 ) bone marrow aspiration needles ( 16 ) bone marrow aspiration needles 13 g bone marrow biopsy needle bp cuff adult & pediatric carbolic acid 500 ml cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) catheter single lumen 6.6 no catheter single lumen 7.7 no cautery patient plate disposable central venous line 4f cerebral catheter reservoir 12mm dia chamber cerebral catheter reservoir 18mm dia chamber cervical soft collar chlorhexidine gluconate dressing material chlorinated lime with boric acid solution 400ml cling drape 15x500cm closed suction trachostomy suction tube with pro s collegen patch collogen sheet 10x10 collogen sheet 15x15 colostomy kit condom catheter small, meadium, large conjugated drain craniotomy cutter blade cresol with soap solution 5ltr jar cvp manometer cylinder connection nut dermatome blade disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 dj stent 6 / 26 double monitoring pressure transducer dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. dura guide for neuro surgery ecg paper 80mmx20 mtr roll ecg paper computerized triple channel 20m elastomeric pump for post operative analgesia endo stich lap suturing device 10 mm endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm extra ventricular drain ( evd ) fibrin & tissue glue fluorescein strips pkt foam sclerotherapy fibre fogartis catheter 4 fr gasket for vaccume jar 1000 ml gasket for vaccume jar 600 ml gasket for humidifier bottel guide wire m 0.89mm, 150cm halogen bulb holder ( heavy duty ) hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) hip u drape humbys knife disposable blade hydrocephalus shunt medium pressur ( vp shunt ) hydrogen peroxide 21% w / w, paracetic acid 4% w / w, acetic acid 10% w / w ( cold st disinfectant for dialysis ) icd bag implantable pain port with epidural catheter for long term pain management impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml intraocular lens 14 30d dioptre intravenous drip set pediatric size introducer sheath 0.97mm 6fr, ( 2.0mm ) , 11 cm introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm j r c bag 1 ltr j r c bag 1.5 ltr j r c bag 1 / 2 ltr 500ml kehr t tube laser radial fibre 600 micron and 400 micron liga clip 200mm, 300mm, 400mm liver biopsy gun long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm mackintosh double colour water proof roll ( 20 meter per roll ) malecot rubber catheter no 12 malecot rubber catheter no 16 malecot rubber catheter no 20 malecot rubber catheter no 22 malecot rubber catheter no 24 medical dry imaging film 10x12 medical dry imaging film 14x17 medical dry imaging film 8x10 methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 microlaryngeal surgery tube no 5 monopolar cautry wire disposable neonatal urine collection and measurement bag 100 ml omaya reservoir large size oxygen adaptor 5 type oxygen catheter oxygen connection with flow meter for central line oxygen connection with flow meter for cylinder oxygen high pressure hose pipe oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) oxygen regulator for control penal board ( oxygen pipe line ) oxygen tailpipe ( flexible metalic ) pacing leads 6 fr paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, paraffin gauze dressing material 10x10cm pediatric diapers peritonial dialysis catheter 200mm pediatric peritonial dialysis catheter 280mm adult peritonial dialysis fluid 1ltr. pigtail catheter 6 fr ( 150 cm ) pigtail catheter with needle 6 fr ( 30 cm ) plaster of paris powder ip 1 kg pkt plastic nozel cap post exposure prophylaxis kits ( pep kits ) pressure regulated v p shunt for peadtric probe for oxygen radiopaque polyurethane catheter with fixation wings and integral extension tube 2f, 5f ( leader flex ) rectified sprit 4.5 ltr. scrotals support short pencil point spinal needle g 25 / 22, l 38mm. sics kit ( small incision cataract surgery ) silicon / double nasal prong with universal connector. all sizes silicon cautery plate silicon folyes catheter 14 fr silicon folyes catheter no 12 silicon tubing set for endoflaton silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm silk protein based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein based sterile surgical pu foam dressing 20cmx20cm silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilized sizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr soda lime for anesthesia workstation 5kg spatula for papsmear sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. sterile post‐operative surgical dressing surgical kit drape gown t.piece circuit with oxygen tubing set ( complete set ) tear test strip ( 100 strips in box ) terrimo guide wire thomas splint tmt graph paper tommy syringe tounge depresser wooden tracheostomy filter transducer set for invasive b.p. triway folyes catheter no 22 turp set ureteric catheter urine collecting bag with urometer 1 ltr. vaccum adaptor 5 type vaccum pump belt vaccum pump oil vaccum regulator ventilator circuit ( heated wire ) ventilator mask water bed wipes wound protector extra small incision size 2 4 cm wound protector large incision size 9 14 cm wound protector large incision size 9 14 cm with retraction ring wound protector medium incision size 5 9 cm wound protector small incision size 2.5 6 cm x ray casset 12x15 x ray casset 10x12 x ray casset 8x10 x ray developer 22.5 lit. x ray films size 10x12 50film per pkt blue sensitive x ray films size 12x15 50film per pkt blue sensitive x ray films size 8x10 50film per pkt blue sensitive x ray fixer 22.5 lit x ray hangers ( clip type ) 10x12 x ray hangers ( clip type ) 12x15 x ray hangers ( clip type ) 8x10 x ray screen high speed 12x15 x ray screen high speed 8x10 x rayscreen high speed 10x12 180 absorbable polyglyconate knotless wound closure device with unidirectional 0 30cm , green 37mm 1 / 2 circle taper point 180 absorbable polyglyconate knotless wound closure device with unidirectional 2 0 30cm , green 37mm 1 / 2 circle taper point 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved absorbable unidirectional barbed device polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm black braided silk 2 0 rb 5333 suture 17mm 1 / 2c taper black braided silk 3 0 rb suture 17mm 1 / 2c taper black braided silk 5 0 rb suture 17mm 1 / 2c taper black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. knotless wound closure device with unidirectional 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting knotless wound closure device with unidirectional 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm monofilament glycomer 0, 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 1 , 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 2 0 , 75cm , violet 27mm 1 / 2 circle taper point monofilament glycomer 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting monofilament glycomer 3 0 75cm , violet 22mm 1 / 2 circle taper point patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or and us fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. perforator 14mm pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system polydioxanone 122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. polydioxanone barbed suture 1 0 polydioxanone suture voilet monofilament 17mm 1 / 2c taper no 4 0 90cm polydioxanone suture voilet monofilament 40mm 1 / 2c blunt point 1 240cm polydioxanone suture voilet monofilament double armed trocar point 2 0 70cm polydioxanone suture clear monofilament 36mm 1 / 2c taper 3 0 70cm polydioxanone suture voilet monofilament 17mm 1 / 2c 5 0 70cm polyglactin 4 0suture undyed braided 1 / 2c reverse cutting polyglactin 910 with triclosan no. 0 x 90 36mm hc rb polyglactin 910 with triclosan no. 1 x 100 55mm hc rb polyglactin 910 with triclosan no. 1 x 90 36mm hc tc progrip self fixating mesh 12*08cm progrip self fixating mesh 14*9cm progrip self fixating mesh 15*15cm progrip self fixating mesh 20*15cm progrip self fixating mesh 30*15cm protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved sterilised surgical needled suture 8mm 1 / 4 spatulated micropoint double 5 0 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system v shape clip applicators large v shape clip applicators medium v shape clip applicators small v shape ligation clip large v shape ligation clip medium v shape ligation clip small aciclovir 200mg / 5ml oral suspension 100ml bottle albendazole suspension 200 mg / 5ml bottle baclofen oral solution ip 1mg / ml syp calcium phosphate, 2:1 ratio, 100 ml bottle carbamazepine oral suspension usp 100ml syp chloramphenicol palmitate oral suspension ip 125mg / ml 100ml syp chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle ciprofloxacin 125mg / 5ml syp 60 ml bottle co trimoxazole 30 ml cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml cyclosporine oral solution usp 100mg / ml 50ml syrup cyproheptadine + lycine and vitamins 200ml syp cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle domperidon suspension 1mg / ml 30 ml bottle etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle ibuprofen oral suspension bp 100mg / 5ml 100ml syp iron+zinc syp metronidazole 200mg / 5ml suspension 60ml bottle nitazoxanide 100mg / 5ml 30 ml bottle norfloxacine suspension ( 30 ml bottle ) oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle paracetamol oral solution 150mg / ml 15 ml bottle with dropper paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) phenobarbitone syp 30ml. 20mg / 5ml. phenytoin sodium suspension 30mg / 5ml 100 ml bottle prednisolone sodium phosphate solution 5mg / 5ml 60ml syp salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle sodium valporate oral solution 100ml syp sorbitol 7.15 gm+tricholine citrate 0.55 gm sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle trypsin bromelain & rutoside trihydrate tablets 6 mercaptopurine , 50mg acarbose 25 mg aceclofenac 100mg+paracetamol 500mg , tablet aceclofenac+thiocolchicoside 100mg+4mg tablet aceclofenace 100mg+serratiopeptidase 15mg tab acenocoumarol 2 mg tab acenocoumarol 1mg acyclovir 200mg tab ademetionine 100mg tab afatinib 40 mg agomelantine 025 mg tab alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg ambroxol hydrochloride 30mg tab amitriptyline 10 mg amlodipine ( 5 mg ) + metoprolol ( 50 mg ) artemether 80mg tab artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab aspirin 75 mg aspirin 150 mg aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg aspirin 75 mg+prasugrel 10 mg atorvastatin 10 mg+aspirin 75 mg. baclofen 5mg tab benfothiamin 150mg betahistine 4mg tab betamethasone 0.5 mg bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg bisoprolol 5 mg+amlodipine 5 mg bosentan 62.5 mg tab brivaracetam 50mg tab bromocriptine 2.5mg tab buprinorphine 4mg buprinorphine 8 mg bupropion 300 cabargolin 0.25 mg cefadroxil 500 mg chlorthalidon 50 mg tab cilostazole 50mg tab cilostazole100mg tab cinnarizine 20 mg and dimenhydrinate 40 mg citicoline 500mg tab clopidogrel 75 mg+aspirin 75 mg clopidogrel 75 mg+atorvastatin 20 mg clotrimazole 400mg tab co trimoxazole tab cyclophosphamide 50 mg tab cyclosporine 300mg tab cynocobalmin + folic acid tab dapagliflozin 5mg tab dapsone 100 mg tab deferasirox dispersible 500mg tab deflazacort 6mg tab desmopressin 0.5mg tab dexamethasone 4 mg tab diphenylhydramine 50 mg domperidone+ranitidine 150mg tab drotaverine 40 mg tab drotaverine 80mg duloxetine 40mg dydrogesterone 10mg eltrombopag olamine 150mg tab empagliflozin 25mg tablet entecavir 0.5mg tab entecavir 1mg tab eplerenone 25mg erlotinib tablets ip 100mg escitalopram 10 mg tab esomeprazole 40mg ethambutol hydrochloride 400mg tab ethambutol hydrochloride 800mg tab etizolam+propranolol 20mg tab etophylline 77 mg+ theophyllin 23 mg etoposide 50 mg etoricoxib 90mg farmalin 1gm tab ( 100 tab per box ) fenofibrate 160mg tab ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) fludrocortisone 0.1mg tab folic acid 800 mcg fungal diastase 100 mg+papain 60 mg gabapentin 400 mg+nortriptyline 10 mg ganciclovir 1000mg tab glibenclamide 2.5mg tab gliclazide 60mg glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg glimepiride 2 mg+metformin 500 glipizide 5 mg+metformin 500 mg glucagon 0.1mg tablet glyceryl trinitrate 0.5 mg sublingual tab hydrocortisone 10 mg hydrocortisone 20mg tab hydroxyzine 10 mg tab hyoscine butylbromide tab 10mg ibuprofen 400 mg indapamide hemihydrate 1.5mg isoniazid 200 mg tab isosorbide 5 mononitrate 20 mg isosorbide mononitrate 30 mg itopride 150mg itopride hydrochloride 25 mg tab itopride hydrochloride 50 mg tab l carnosine 200mg tablet lactobacillus 120 lamotrigine 25mg tab lansoprazole 15mg tab lapatinib 250 mg levetiracetam 750mg tab levodopa + carbidopa 100+25mg levofloxacin 750mg tab loperamide 8 mg tab lorcaserine 10 mg tab losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) lurasidone 20 magnesium oxide 200 mg magnesium valproate 400 mg mebendazole 100 mg tab meclizine hydrochloride 25 mg mefenamic acid 250mg+dicyclomine 10mg tab megestrol acetate 40mg melatonin 3mg melatonin 6mg mercaptopurine 50mg tab mesalamine ( 5 aminosalicylic acid ) 400 mg tab metaclopramide 10 mg tab metformin ( 1000 mg ) + vildagliptin ( 50 mg ) metformin 500 mg+voglibose 0.3 mg methimazole 10 mg tab methocarbamol 500 mg. methotrexate 10 mg methotrexate 5 mg tab methylcobalamin +folic acid tab methylcobalamin 1500mg tab methyldopa 250 mg tab methylphenidate 10 mg methylphenidate 20 mg methylphenidate 5 mg metoclopramide 05 mg metoprolol 12.5 mg metoprolol 50 mg+ramipril 5 mg misoprostol 200 mg modafinil 200mg tab morphine sulphate 10mg tablet moxonidine 0.3 mg multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) mycophenolate mofetil, 500 mg n acetylcysteine 300mg tab naproxen 250 mg tab naproxen 500mg + domperidone 10mg tab naproxen 500mg tab nebivolol 5mg nicorandil 5 mg tab nicotinamide 250mg tab nicoumalone 1 mg nimesulide 100 mg nimodipine 30mg tablet nitazoxanide 200 mg nitazoxanide 500mg tab nitrocontin 2.6 nitroglycerin 2.5 mg ofloxacin 200mg +tinidazole 600mg tab ofloxacin 400mg tab olmesartan 10 mg olmesartan 20mg olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg olmesartan medoxomil 40 mg+amlodipine 5 mg oxcarbazepine 150 mg tab oxcarbazepine 300 mg tab oxybutynin 2.5mg tab pancreatic enzyme 1000mg tab pancreatic enzyme 2000mg tab pancreatic enzyme 500mg tab pantoprazole 40 mg+domperidone 30 mg paracetamol, chlorpheniramine maleate, phenylephrine hydrochloride & caffeine tablets pazopanib 200mg / 400mg penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) pentoxifylline 400mg perampanel 4mg phenobarbitone 30 mg. pramipexol 0.26 sr pramipexol 0.50mg prazosin 10mg tab propranolol hydrochloride 40mg+flunarizine 10mg tab propylthiouracil 50mg prucalopride 2mg tab quetiapine 50mg tab racecadotril 100mg ranolazine sustained release 500mg tab rifaximin 550 mg tablet rivaroxaban 10mg tab rivaroxaban 15mg tab rivaroxaban 5mg tab rosuvastatin 20 mg sacubitril 24 mg+valsartan 26 mg secnidazole 500 mg tab sevelamer carbonate 400mg tab sevelamer carbonate 800mg tab sildenafil 25 mg silodosin 8mg tab sitagliptin 50 mg+metformin 500 mg sodamint tab solifenacin 5mg tab sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab sulfasalazine 500mg tab sunitinib 50 mg tapentadol 50mg tab telmisartan 40 mg+amlodipine 5 mg telmisartan 80 mg+amlodipine 5 mg telmisartan 80 mg+hydrochlorothiazide 12.5 mg teneligliptin 20 mg tenofovir disoproxil 300mg tab terbutaline sulphate 2.5mg tab tetrabenazine 12.5mg tab tetrabenazine 20 mg tab tetrabenazine 25mg tab thiamine 200mg tab thiamine 75mg thyroxine sodium 137 mcg thyroxine sodium 62.5 mcg thyroxine sodium 12.5 mcg thyroxine sodium 150 mcg thyroxine sodium 125 mcg thyroxine sodium 88mcg tablet tianeptine 12.5 mg tolperisone hydrochloride 150 mg tab tolvaptan 15 mg topotecan 1 mg torsemide 10 mg+spironolactone 50 mg tramadol 37.5mg and acetaminophen 325mg tablet valganciclovir 450mg tab valganciclovir 500mg tab valganciclovir 900mg tab valsartan 40 mg venlafaxine 75 verapamil 120mg tab vidagliptin 100mg tab vidagliptin 80mg vilazodon 20mg vilazodon 40mg voriconazole 100mg tab voriconazole 150mg tab voriconazole 200 mg voriconazole 50mg tab vortioxetine 20mg vortioxetine 10mg vortioxetine 5 mg warfarin sodium 5 mg tab zonisamide 100 mg tab zonisamide 50 mg tab...

Department of Higher Education - Madhya Pradesh

33756753 bids are invited for binocular microscope , water and soil testing kit , rotary microtome , ph meter , image projection system , tlc kit , centrifuge , spectrophotmeter , bod incubator , colarimeter , autoclave , polarimeter , compound microscope , distillation 5ltr , flamephotometer , colony counter total quantity : 36...

Department of Higher Education - Madhya Pradesh

33579391 bids are invited for boq1 analytical blance ( chemical blance ) student lavel , boq2 autoclave portable , boq3 automatic burette ( karl fisher titrator , boq4 bod incubator 2c to 60c , boq5 digital haemoglobi nometer , boq6 digital ph meter , boq7 digital spectrophotometer , boq8 digital thermometer double beam , boq9 digital nephalo turbidity meter , boq10 dissecting microscope , boq11 electrophoresisi with power suply , boq12 fire extinguisher , boq13 interactive panel 65 inch , boq14 glucometer retraction of needle into , boq15 horizontal deep freezer , boq16 hotplate , boq17 inverter , boq18 laboratory hot air oven , boq19 micropipette , boq20 microwave oven , boq21 refregerator , boq22 sphygmomanometer ( student lavel ) , boq23 uv transilluminator , boq24 vortex shaker , boq25 compound microscope , boq26 binocular microscope , boq27 tringular microscope , boq28 water distillationapparatus ( double distillation unit ) , boq29 water distillationapparatus ( single distillation unit ) , boq30 thermostatic water bath , boq31 heating mantle , boq32 magnetic stirrer ( with hot plate ) , boq33 laboratory stirrer , boq34 water bath 12 holes , boq35 betrological incubator , boq36 centrifuge machine , boq37 electronic balance , boq38 electrophoresis unit , boq39 zoology models , boq40 human palstic skeleton , boq41 dna model , boq42 zoology map , boq43 digital colony counter , boq44 research microscope , boq45 water / soil testing kits , boq46 digital flame photometer , boq47 insects collection net , boq48 permanent slides sample 20pices , boq49 ph meter , boq50 rotatory microtome , boq51 projection microscopesystem , boq52 laminer air flow , boq53 tissue culture rack total quantity : 203...

Department of Higher Education - Madhya Pradesh

33574677 bids are invited for boq1 autoclave portable , boq2 dissecting microscope , boq3 binocular microscope , boq4 cooling centrifuge , boq5 deep freezer , boq6 digital balance 0.1mg , boq7 compoundmicroscope , boq8 high defination microscope , boq9 microscopic eye pic , boq10 triangular microscope , boq11 ganong respirometer , boq12 hot air oven , boq13 magnetic stirrer with hot plate , boq14 maximum minimum thermometer , boq15 micro pipettevariable 1 5ml , boq16 uv chromatographic chamber , boq17 ph meter digital , boq18 slide cabinet with 12 showcase , boq19 thin layer chromatography apparatus , boq20 water bath double wall12 holes ss , boq21 wilmotts bubbler , boq22 bod incubator , boq23 digital colony counter , boq24 digital tds meter , boq25 flame photometer , boq26 interacticv led panel , boq27 compound microscope , boq28 digital thermometer , boq29 projection microscope , boq30 cetological incubator stainless steel , boq31 laminar air flow horizontal , boq32 rotary microtome , boq33 visualizervisual presenter teletop camera , boq34 autoclave vertical , boq35 hair dryer , boq36 homogenizer , boq37 distillation apparatus single distillation , boq38 distillation apparatus doubledistillation , boq39 micro kjeldahl & distillation apparatus , boq40 soxhlet extraction unit , boq41 vortex shaker , boq42 auxanometer , boq43 computer system with licenced operating system internet facility , boq44 farmer potometer , boq45 ganong potometer , boq46 water and soil analysis testing kit digital , boq47 wooden press for herbarium , boq48 tissue culture rackcaster rack , boq49 blackman apparatus , boq50 camera lucida with filter micro type , boq51 camera lucida with filterprism type , boq52 gel electrophoresis unit with power supply , boq53 heating mantle with regulator cap 1 litre , boq54 microscopic camera , boq55 noise level meter , boq56 occular micrometer , boq57 stage micrometer , boq58 stem borer , boq59 tisuue culture rackcaster rack , boq60 auxanometer , boq61 cod analyzer multi parameter beanch photometer , boq62 oxygen electrode , boq63 rotatory microtome , boq64 specimen 20pices , boq65 botany map , boq66 digital colony counter , boq67 digital flame photometer , boq68 digital spectrophotometer , boq69 blood pressure machine , boq70 plant collection net , boq71 centrifuge machine , boq72 electronic balance , boq73 electrophoresis unit total quantity : 240...

Indian Army - Madhya Pradesh

33555938 supply of expendable medical stores dextrose monohydrate for oral use , grouping sera anti’a’ ( monoclonal ) bott of 10 ml , grouping sera anti’b’ ( monoclonal ) bott of 10 ml , grouping sera anti’d’ ( monoclonal ) igm, bott of 10 ml , weak anti ‘d’ ( igg ) , bott of 10 ml , anti human globulin, bott of 5 ml , serum anti h, bott of 5 ml , serum anti a1, bott of 5 ml , vacuatainer ( sodium flouride ) with needle 2 ml , vacuatainer ( k3 edta ) with needle 2 ml , vacuatainer ( strile / plain gel ) with needle 4ml , 3.2% sodium citrate vacuatainer 1.8ml , pregnancy test ( rapid card method ) pkt of 50 test , disposable blade for microtome pkt of 50 blade , diluent erba h560, pack of 20 ltrs , lyse 1 erba h560, bott of 200ml , lyse 2 erba h560, bott of 500 ml , h clean erba h560, bott of 50 ml , elite h5 for erba h560 control for erba haematology analyser , hiv i & ii rapid test kit , hbsag rapid test kit , anti hcv rapid test kit , kit for estimation of c reactive protein ( 25 test ) , prothrombine time test , bott of 5 ml , micropipettes tips ( 05 100ul ) , micropipette tips ( 100 1000ul ) , dengue kit ( ns1ag, igg / igm ) kit of 10 test , em 200 xl hba1c with cal set ( 2x15ml / 2x5ml ) , em 200 amylase small system pack 5x11ml , em 200 bilirubin total system pack 6x44ml / 3x22ml , em 200 bilirubin direct system pack6x44ml / 3x22ml , em 200 caclcium ( a ) system pack10x22ml , em 200 cholesterol system pack 10x44ml , em 200 ck nac small system pack2x44ml / 2x11ml , em 200 gamma gt small system pack 2x22ml / 2x6.8ml , em 200 glucose ( god – pod ) system pack 10x44ml , em 200 hdl cholesterol with calibrator 4x30ml / 4x10ml , em 200 ldh – psystem pack 2x44ml / 2x11ml , em 200 ldl cholesterol with calibrator 2x30ml / 2x10ml , em 200 micro albumin control1x1ml , em 200 micro albuminwith cal 1x10ml / 5x25ml , em 200 sgot – elsystem pack 6x44ml / 3x22ml , em 200 sgpt – elsystem pack 6x44ml / 3x22ml , em 200 urea system pack5x44ml / 5x11ml , em 200 total protein system pack10x44ml , em 200 triglycerides system pack5x44ml / 5x11ml , em 200 xl autowash ac / al kit 5x44ml / 5x44ml , em 200 creatinine –enzymaticsystem pack 5x30ml / 5x10ml , em 200 erba auto wash system pack 10 x100ml , em 200 xl multical 4x3ml , em 200 uric acid 5x44ml / 5x11ml , em 200 quanitative crp tulbilatex calibrator 2x22 / 1x11 ml , sterile urine container 20 50ml , lyphochek assayed bio chemistry control level 1 ( siemens / roche / biorad ) , lyphochek assayed bio chemistry control level 2 ( siemens / roche / biorad ) , biorad lyphochek assayed diabetes control ( level 1&2 ) 06 x 0.5ml , medica easylyte plus na / k / clsolutions pack ( ref 2121 ) with probe wipers ( 800 ml ) , medica easylyte na / k / cl ( 90ml x 0.50g ) daily rinse / cleaning solution kit ( ref 2118 ) , urinalysis reagent strips 2 para ( protein & glucose ) bott of 100 strips , urinalysis reagent strips 2 para ( ketone & glucose ) bott of 100 strips , urinalysis reagent strips 10 para ( multistix 10sg ) bott of 100 strips for siemens urine analyser , sodium chloride ar nacl 500gm , glycerine , pm kit for erba em 200 , ethanol absolute 500ml , em 200 lipase xl system pack ( 1x44ml / 1x11ml ) , tissue paper roll , ra factor ( 25 test ) , aso ( 25 test ) , typhi dot pack of 50 test ( tulip ) , esr tube pack of 100 , syphilis test pack of 50 , cr film 17 x 14 ( fuji ) , cr film 12 x 10 ( fuji ) , cr film 10 x 08 ( fuji ) , inj iohexol 350 mg , 50 ml water soluble nonionic contrast media ( contrapaque ) , inj iohexol 300 mg , 50 ml water soluble nonionic contrast media ( contrapaque ) , usg thermal printer paper roll size 110 mm x 20 mm type 5 highloss sony , liquid developer for automamatic film processor , em microprotein small system pack of 5 x 6 ml / 1 x 1 ml , three level elctrolyte analyser control low / normal / high 1 x 3 ml , mpo stain 50 ml => limited...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Department of Higher Education - Madhya Pradesh

33319767 bids are invited for bod incubator , flame photometer , tissue culture rack caster racks , electronic digital balance 0 1 mg , soxhlet extraction unit , bionocularmicroscope , autoclave vertical cap 50lt , colorimeter , distillation apparatus single distillation capacity 3lt , thin layer chromatography apparatus , centrifuge machine 3500 rpm , dissecting microscope , slide box for 100 slides , magnetic strirrer with hot plate , ph meter , hot air oven stainless steel , rotatory microtome with accessories , water bath double wall 6 holes stainless steel , gel electophorosis unit with power supply vertical , digital turbiditimeter , digital tds meter , water and soil testing analysis kit , digital colony counter , distillation apparatus double distillation capacity 5lt , laminar air flow horizontal , spectrophotometer 340 900nm range , compound microscope , chromatrographic chamber , spectrophotometer 340 900 nm , autoclave , paper chromatography testing kit , chemical balance , bod incubator , water soil testing kit digital , heating mentle 2 lit 500 w , distillation apparatus double distillation borosilicate glass cap 5 liter , water bath 6 holes , rotary microtome with accessories , tds meter digital , magnetic stirrer with hot plate , laboratory mixer , hot air oven 14 14 , electronic digital balance , conductivity meter digital with cell , d o meter digital , electronic balance 0 1 grm to 600 grm , flame photometer digital , single beam uv vis spectrometer without pc 200 1100 nm , thin layer chromatography kit , binocular microscope , distillation apparatus single distillation capacity 5lt , water bath double wall 12 holes stainless steel , oven...

Indian Army - Madhya Pradesh

33311037 supply of expendable medical store , betnovate n oint contain betamethasone 0.10% w / w , neomycin sulphate 0.5%w / w and chlorocresol 0.1%w / w, tube of 20 gm , cough lozenges tab contain dichlorobenzyl alcohol and amylmetacresol with ascorbic acid , levonorgesrel 0.15mg + ethinylestradiol 0.03mg ( pack of 21 tab ) , liquid developer for autoprocessor, 5 ltr , ondansetron 8 mg tab , levodopa + carvidopa 110mg tab , tab diethylcarbamazine citrate 100 mg , protene powder contain skimmed milk powder, malt extract , soy protein isolate , cocoa powder 10 %, minerals , calcium phosphate , ferric pyrophosphate , zinc sulphate, vitamins , nicotinamide , riboflavin , thiamine , calcium pantothenate artificial sweetnerjar of 250 gm , sodium bicarbonate 7.5% amp of 10 ml , tab resperidone 0.5mg , stimuflex ultra 360 degree needle for nerve blocks 5 cm , stimuflex ultra 360 degree needle for nerve blocks 10 cm , dvt stockings above knee size large , dvt stockings below knee size large , moxifloxacin eye ointment 0.5% tube of 5 gm , disposable blade for microtome pkt of 50 blade , cartridge for bar code printer type wax 333plus size 55mm x 75mm , lyphochek assayed bio chemistry control evel 1 ( siemens / roche / biorad ) , lyphochek assayed bio chemistry control evel 2 ( siemens / roche / biorad ) , biorad lyphochek assayeddiabetes control ( level 1&2 ) 06 x 0.5ml , medica easylyte na / k / cl ( 500ml ) urine diluent ( ref 2111 ) , sterile urine container 20 50ml , weak anti ‘d’ ( igg ) , bott of 10 ml , vicryl rapid fasting absorbing 4 0 round body 20 mm ( pack of 12 peces ) , polypropylene suture 4 0 3 / 8 circle cutting needle – 16mm ( pack of 12 peces ) , polyproplene suture 2 0 on round body 3 / 8 circle – 22 mm needle ( pack of 12 peces ) , polypropylene suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 25mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 round body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 cutting body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 round body 12mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 cutting body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 3 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 3 0 cutting body 26mm 3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 , pds polydioxane suture with needle 1 0 round body 30mm ( pack of 12 ) , pds polydioxane suture with needle 2 0 round body 30mm ( pack of 12 , polydioxane pds loop 1 0 ronud body 40mm ( pack of 12 ) , vicryl ( polyglactin 910 ) suture with needle 2 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 cutting body 22mm 3 / 8 circle ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 4 0 round body 20mm ( pack of 12 , monocryl ( polyglecaprone ) suture with needle3 0 cutting body 25mm ( pack of 12 ) , monocryl ( polyglecaprone ) suture with needle4 0 cuttong body 16mm 3 / 8 circle ( pack of 12 , monocryl ( polyglecaprone ) suture with needle5 0 cb 16mm 3 / 8 circle ( pack of 12 , silk suture with no3 0 ( for seton ) ( pack of 12 ) , silk suture with needle no 0 cutting body 45mm ½ circle ( pack of 12 ) , silk suture with needle no 0 round body 30mm 3 / 8circle ( pack of 12 ) , silk suture with needle no 2 0 cutting body 30mm 3 / 8 circle ( pack of 12 ) , silk suture with needle no 2 0 round body 30mm 1 / 2circle ( pack of 12 ) , silk suture with needle no 3 0 round body 30mm 3 / 8 circle ( pack of 12 ) , foley catheter 3 way 16 fr , ot skin marker pen ( black ) , polypropylene mesh 7.5 x 15 cm , polypropylene mesh 15 x 15 cm , polypropylene mesh 30 x 30 cm , skin stapler 35 mm , cast fibreglass , saccharomyces boulardii capsule 250 mg , lignocaine and prilocaine cream ( local lignocaine and prilocaine cream ( local anaesthetic ) of 50 gm , sterile collagen wet sheet size 10x10 cm pkt of 05 , papain urea debridement oint of 15 gm , recombinant human epidermal growth factor+silver sulfadiazine+chlorhexidine gluconate cream of gm , combined spinal epidural set size 18 ( b braun ) , epidural set size 18 ( b braun ) => limited...

Department of Higher Education - Madhya Pradesh

33263572 bids are invited for binocular microscope , water and soil testing kit , rotary microtome , ph meter , image projection system , tlc kit , centrifuge , spectrophoto meter , bod , colarimeter , autoclave , polari meter , compound microscope , distillation 5ltr , flame photo meter , colony counter total quantity : 36...

Department of Higher Education - Madhya Pradesh

33218675 bids are invited for magnetic strirrer with hot plate , hot air oven stainless steel , ph meter , digital tds meter , water and soil testing analysis kit , digital colony counter , gel electophorosis unit with power supply horizontal , water bath double wall 6 holes stainless steel , rotatory microtome with accessories , autoclave vertical cap 50lt , distillation apparatus single distillation capacity 3lt , distillation apparatus double distillation capacity 5lt , laminar airflow horizontal , colorimeter , spectrophotometer 340 900nm range , bod incubator , soxhlet extraction unit , compound microscope , dissecting microscope , bionocularmicroscope , slide box for 100 slides , centrifugemachine 3500 rpm , thin layer chromatography apparatus , electronic digital balance 01 mg , research microscope , tissue culture rack caster racks , flame photometer total quantity : 66...

Department of Higher Education - Madhya Pradesh

33179014 bids are invited for title 01 auto clave title 02 do meter digital title 03 counductivity meter digital with cell title 04 digital photoelectric colorimeter 5lit title 05 double distilation apperatus cap2lit title 06 electronic blance0.01mg to 600gm title 07 flame photometer digital title 08 heating metel 7lit title 09 hotplate with energy regulator 1500w title 10 centrifuge machine title 11 thin layer chromatograpy app title 12 magnetic stirrer with hot plate title 13 muffle furness title 14 shaking machine with wrist action title 15 bod incubator title 16 vortex mixer title 17 digital colony counter 4 digit title 18 digital turbidity meter 3.5 digit title 19 tds meter digital title 20 digital ph metr conductivity meter and temperature meter title 21 water bath double 12 holes title 22 water soil analysis kit 7 para meter title 23 ph meter digital with electrodes title 24 rotatory flask shaker title 25 vacuum pump title 26 melting point apparatus digital title 27 micropipette variable title 28 polarimeter half shades title 29 compound microscope title 30 dissecting microscope with bull lences title31 binocular microscope title 32 image projection system tringular microscope title 33 thin layer chromotograhic chamber title 34 water and soil testing analysis kit title 35 digital colony counter title 36 rotatory microtome with accessories title 37 digital spectrophotometer title 38 ph meter with electrodes title 39 gel electroproshish with power supply ( vertical ) title 40 hot air oven stainless steel title41 high defination microscope title 42 bod incubulator title 43 digital tds meter title 44 compound microscope title 45 dissecting microscope with bull lences title 46 image projection system tringular microscope title 47 oven title 48 beteriological incubator ss steel title 49 digital colony counter title 50 centrifuge machine3500 rpm title 51 binocular microscope title 52 rotatory microtom with accessories title 53 computer for zoology lab title 54 dna model 3d title55 human plastic skeleton title 56 blood pressure machine title 57 digital spectrophotometer title 58 fet characteristic apparatus title 59 mosfet characteristic app title 60 ujt characteristic app title 61 s.c.r characteristic app title 62 thermistor characteristic app title 63 diac and tiac characteristic app title 64 photo diode characteristic app title 65 photo transistor characteristic app title 66 power amplifier title 67 hartley and colpitts oscillator title 68 study of crystall oscillator title 69 high defination microscope title 70 newton ring app complete with travelling microscope power title 71 series and parailal resonrnce circuits title 72 reading telescop title 73 four probe methods title 74 spectrometer 6 / 7 title 75 die electric constant apparatus title 76 screw gauge electronic title 77 verniear calipers electronics title 78 ac ammeter title 79 dc voltmeter title 80 milimeter / milvoltameter / micrometer title 81 daniel cell title 82 jeager apparatus title 83 ldr cheracteristic apparatus title 84 cro digital 30 mhz / 40mhz title 85 high defination microscope title 86 travelling microscope title 87 digital multimeter total quantity : 236...

Department of Higher Education - Madhya Pradesh

33160930 bids are invited for title 1 ph meter title 2 oven title 3 thin layer chromatography apparatus title 4 flame photometer title 5 soxhlet extraction unit title 6 autoclave vertical cap 50lit title 7 compound microscope title 8 dissecting microscope title 9 slid box for 50 slides title 10 binocular microscope title 11 bod title 12 image projection microscope system title 13 digital high defination microscope title 14 water bath double wall 12 holesss title15 distillation apparatus single distillation cap title16 hot air oven title 17 heating mental with regulator cap 1lit title 18 heating mental with regulator cap 5oml title 19 vortex shaker title 20 water and soil testing analysiskit title 21 spectrophotometer340 900nmrange title 22 digital colony counter title 23 rotator microtome with acessories title 24 autoclave portable title 25 centrifuge machine 350rpm title 26 homegenizer title 27 digital turbiditimeter title 28 electric digital blance0.01mg title 29 micro pipette 1 5ml title 30 laminer air flow title 31 beteriological incubator stainless steel title 32 compound microscope title33 dissecting microscope title 34 slide box for 50 slides title35 hot air oven ss title 25 heating metal with regulatorcapn500ml title36 vortex shaker title37 water and soil testing analysiskit title38 rotator microtome with accessories title39 autoclave phortable title40 thin layer chromatography apparatus title41 binocular microscope title42 beteriological incubator stainless steel title43 autoclave vertical cap 50lit title44 micro pipette title 45 micro pipette title 46 digital high defination microscope title47 bod total quantity : 104...

Indian Army - Madhya Pradesh

32853308 expendable medical stores expendable medical stores , betnovate n oint contain betamethasone 0.10% w / w , neomycin sulphate 0.5%w / w and chlorocresol 0.1%w / w, tube of 20 gm , cough lozenges tab contain dichlorobenzyl alcohol and amylmetacresol with ascorbic acid , levonorgesrel 0.15mg + ethinylestradiol 0.03mg ( pack of 21 tab ) , liquid developer for autoprocessor, 5 ltr , ondansetron 8 mg tab , levodopa + carvidopa 110mg tab , tab diethylcarbamazine citrate 100 mg , protene powder contain skimmed milk powder, malt extract , soy protein isolate , cocoa powder 10 %, minerals , calcium phosphate , ferric pyrophosphate , zinc sulphate, vitamins , nicotinamide , riboflavin , thiamine , calcium pantothenate artificial sweetnerjar of 250 gm , sodium bicarbonate 7.5% amp of 10 ml , tab resperidone 0.5mg , stimuflex ultra 360 degree needle for nerve blocks 5 cm , stimuflex ultra 360 degree needle for nerve blocks 10 cm , dvt stockings above knee size large , dvt stockings below knee size large , moxifloxacin eye ointment 0.5% tube of 5 gm , single piece iol lens with uv protection size : 17.0 ds , single piece iol lens with uv protection size : 18.0 ds , single piece iol lens with uv protection size : 19.0 ds , single piece iol lens with uv protection size : 19.5 ds , single piece iol lens with uv protection size : 20.0 ds , single piece iol lens with uv protection size : 21.0 ds , single piece iol lens with uv protection size : 22.0 ds , single piece iol lens with uv protection size : 23.0 ds , single piece hydrophobic pmma lens size : 17.0 ds , single piece hydrophobic pmma lens size : 18.0 ds , single piece hydrophobic pmma lens size : 19.0 ds , single piece hydrophobic pmma lens size : 20.0 ds , single piece hydrophobic pmma lens size : 21.0 ds , single piece hydrophobic pmma lens size : 22.0 ds , disposable blade for microtome pkt of 50 blade , cartridge for bar code printer type wax 333plus size 55mm x 75mm , lyphochek assayed bio chemistry control level 1 ( siemens / roche / biorad ) , lyphochek assayed bio chemistry control level 2 ( siemens / roche / biorad ) , biorad lyphochek assayeddiabetes control ( level 1&2 ) 06 x 0.5ml , medica easylyte na / k / cl ( 500ml ) urine diluent ( ref 2111 ) , sterile urine container 20 50ml , single piece hydrophobic pmma lens size : 22.0 ds , weak anti ‘d’ ( igg ) , bott of 10 ml , vicryl rapid fasting absorbing 4 0 round body 20 mm ( pack of 12 peces ) , polypropylene suture 4 0 3 / 8 circle cutting needle – 16mm ( pack of 12 peces ) , polyproplene suture 2 0 on round body 3 / 8 circle – 22 mm needle ( pack of 12 peces ) , polypropylene suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 25mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 3 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 round body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 cutting body 17mm 3 / 8 circle ( pack of 12 peces ) , polypropylene suture with needle 5 0 round body 12mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 round body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 2 0 cutting body 22mm 3 / 8 circle ( pack of 12 peces ) , nylon ( polyamide ) suture with needle 3 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 3 0 cutting body 26mm 3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 round body3 / 8 circle , nylon ( polyamide ) suture with needle 4 0 cutting body 16mm 3 / 8 circle ( pack of 12 , pds polydioxane suture with needle 1 0 round body 30mm ( pack of 12 , pds polydioxane suture with needle 2 0 round body 30mm ( pack of 12 , polydioxane pds loop 1 0 ronud body 40mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 2 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 round body 25mm ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 3 0 cutting body 22mm 3 / 8 circle ( pack of 12 , vicryl ( polyglactin 910 ) suture with needle 4 0 round body 20mm ( pack of 12 , monocryl ( polyglecaprone ) suture with needle3 0 cutting body 25mm ( pack of 12 ) , monocryl ( polyglecaprone ) suture with needle4 0 cuttong body 16mm 3 / 8 circle ( pack of 12 , monocryl ( polyglecaprone ) suture with needle5 0 cb 16mm 3 / 8 circle ( pack of 12 , silk suture with no3 0 ( for seton ) ( pack of 12 ) , silk suture with needle no 0 cutting body 45mm ½ circle ( pack of 12 ) , silk suture with needle no 0 round body 30mm 3 / 8circle ( pack of 12 ) , silk suture with needle no 2 0 cutting body 30mm 3 / 8 circle ( pack of 12 ) , silk suture with needle no 2 0 round body 30mm 1 / 2circle ( pack of 12 ) , silk suture with needle no 3 0 round body 30mm 3 / 8 circle ( pack of 12 ) , foley catheter 3 way 16 fr , ot skin marker pen ( black ) , polypropylene mesh 7.5 x 15 cm , polypropylene mesh 15 x 15 cm , polypropylene mesh 30 x 30 cm , skin stapler 35 mm , cast fibreglass , saccharomyces boulardii capsule 250 mg , lignocaine and prilocaine cream ( local lignocaine and prilocaine cream ( local anaesthetic ) of 50 gm , sterile collagen wet sheet size 10x10 cm pkt of 05 , papain urea debridement oint of 15 gm , recombinant human epidermal growth factor+silver sulfadiazine+chlorhexidine gluconate cream of gm => limited...

Central Council For Research In Ayurvedic Sciences - Madhya Pradesh

32670762 bids are invited for alanine amino transferase , aspartate amino transferase , alkaline phosphatase , albumin , blood urea nitrogen , calcium , chloride , creatinine , glucose , gamma glutamyl transferase , phosphorus , potassium , sodium , total plasma protein , total cholesterol , triglycerides , total bilirubin , rodent thyroid stimulating hormone , rodent thyroxin , rodent triiodothyronine , dekaphan laura urine strips , prothrombin time , activated partial thromboplastin time , micro pipette tips , glass slides , cover slips , btct capillary tubes , nitrile gloves small , nitrile gloves medium , nitrile gloves large , micro centrifuge tubes 0.5 , microcentrifuge tubes 1.5 , micro centrifuge tubes 2 , oralgavage set , magnetic stirrer beads small , magnetic stirrerbeads medium , microtome blades slee , blotting papers ,bottle corks , diethyl ether , potassium iodide , isoflurane ,propanol , ethanol , xylene , hematoxylin stain solution ,eosin stain solution , paraffin wax , formaldehyde ,propylene glycol , sodium chloride , sodium dihydrogenphosphate , dihydrogen sodium phosphate , gum acacia ,giemsa stain solution , cell clean cl 50 , disodium edta total quantity : 53051...

Department of Higher Education - Madhya Pradesh

32465961 bids are invited for 1 auto clave 2 do meter digital 3 digital meter counductivity meter and temp meter 4 digital photoelectric colorimeter 5lit 5 digital app double distilation cap 6 electronic blance0.01mg to 220g 7 flame photometer digital 8 heating metel 7lit 9 heating metal 2 lit 500w 10 humidity chamber 11 hotplate with energy regulator 500w 12 centrifuge machine 13 laboratory mixer 14 magnetic stirrer with hot plate 15 muffle furness 9*4*4 16 shaking machine with wrist action 17 bod incubator 18 uv b3chromatrographic chamber 19 vortex mixer 20 digital colony counter 4 digit 21 digital turbidity meter 3.5 digit 22 tds meter digital 23 test tube stand 24 test tube mid 25 test tube big 26 beaker100ml 27 beaker 50ml 28 volumetric flask 100ml 29 volumetric flask 50ml 30 water bath double 12 holes 31 water soil analysis kit 7 para meter 32 ph blance b56 33 hot plate 34 shaking machine 35 petri disk 4” 36 rotatory flask shaker 37 rotatory light vacuum pump 25 lit / per min 38 ph meter with electrodes 39 burett 50ml 40 measuring cylinder100ml 41 bursan burner 42 flask 250ml 43 flask 100 44 polorimeter half shaade 45 vacuum dessicator 46 flask 50ml 47 hot air oven 48 compuetr for chemistry 49 melting point apparatus digital 50 micropipette variable 1 compound microscope 2 dissecting microscope with bull lences 3 binocular microscope 4 research microscope with digital eye computer i31 tb 21.5 5 betrological oven 6 thin layer chromotograhic chamber 7 magnetic stirrers with hot plate digital 8 water and soil testing analysis kit 9 digital colony counter 10 rotatory microtome with accessories 11 plant collection set 12 digital spectrophotometer 13 ph meter 14 homogenizer 15 colorimeter 16 gel electroproshish with power supply ( vertical ) 17 hot air oven stainless steel 18 bod incubulator 19 map botany 20 heating mental with regulator cap 1lit 21 magnetic stirrers with hot plate 22 speciman of botany 23 water bath double wall 6 holes stainless stell 24 digital tds meter 1 compound microscope 2 dissecting microscope with bull lences 3 water bath double wall 4 water and soil testing analysis kit 5 heating mantel with regulator cap 1 6 spectrophotometer 7 digital colony counter 8 rotatory microtom with accessories 9 centrifuge machine3500 rpm 10 research microscope with digital eye computer 11 binocular microscope 12 dna model 3d 13 human plastic skeleton 14 blood pressure machine 15 insect collection net 16 parmanent slide sample 10pices set 17 zoology map 18 eupletella models 19 hylonema models 20 euspongia models 21 obelia models 22 velella models+b128 23 aurelia 24 pennatula 25 faciola 26 teniasolium 27 earthworm 28 octopus 29 starfish 30 autoclave portable 31 colony counter digital 32 endo skeleton of rabbit 33 silde ( parmanent slide ) hydra 34 chik embryo wm of 16 hrs incubation 35 ls of 18 hrs embryo 36 whole mount of toys embryo 37 double appratus single ditilation+b19 38 bod incubator 39 laminar air flow horizontal 40 tissu culture rack 41 autoclave portable 1 fet characteristic apparatus 2 mosfet characteristic app 3 ujt characteristic app 4 s.c.r characteristic app 5 thermistor characteristic app 6 diac and tiac characteristic app 7 photo diode characteristic app 8 photo transistor characteristic app 9 power amplifier 10 hartley and colpitts oscillator 11 study of hybrid parameters circuits 12 zanier regulated power supply 13 newton ring app complete with travelling microscope power 14 series and parailal resonrnce circuits 15 study of multivibrators using omamp 16 clipping and clamping circuits using operational amplifire 17 spectrometer 6 / 7 18 die electric constant apparatus 19 screw gauge electronic 20 verniear calipers electronics 21 bi prism assembly 22 ac ammeter 23 dc voltmeter 24 pnp / npn tranistor dual 4 meter 25 boyle law app heavey metal 26 torsion pendulum 27 reading telescop 28 jeager apparatus 29 milimeter / milivplter 30 daniel cell 31 digital multimeter 32 travelling microscope 33 spectrometer prism ( crown / flint glass ) 34 galvanometer 35 apparatus to study cheracteristic tunnel diode 36 ldr charecterritics app 37 study of smps 38 four probe methods 39 solar cell characteristic apparatus 40 single stage double stage rc coupled amplifife 41 transistorized differential amplifire 42 f e t amplifire 43 study of schmitt trigger circuits 44 rectifier and filter characteristic app 45 8056 microprocessor with smps 46 cro digital 30 mhz / 40mhz 47 study of hybrid parameters resonces circuits 48 study of transission line 49 digitalto analog converter with power supply 50 multiplexer and demultiplexer built in power supply 51 bcd to seven segment decoderr with built in power supply 52 pulse width pluse position modulation and demodulation 53 computer for physics lab 54 sodium lamp with smaps 55 mercury lamp with smps total quantity : 883...

Department of Higher Education - Madhya Pradesh

32463737 bids are invited for magnetic strirrer with hot plate , hot air oven stainless steel , ph meter , digital tds meter , water and soil testing analysis kit , digital colony counter , digital turbiditimeter , gel electophorosis unit with power supply vertical , water bath double wall 6 holes stainless steel , rotatory microtome with accessories , autoclave vertical cap. 50lt , distillation apparatus single distillation capacity 3lt , distillation apparatus double distillation capacity 5lt , laminar air flow horizontal , colorimeter , bod incubator , spectrophotometer 340 900nm range , soxhlet extraction unit , compound microscope , dissecting microscope , bionocularmicroscope , slide box for 100 slides , centrifuge machine 3500 rpm , thin layer chromatography apparatus , electronic digital balance 0 1 mg , tissue culture rack caster racks , flame photometer , function generator b1hz to 10 mhz , function generator a 0 3 to 3 mhz , series and parallel resonance circuit , spectrometer 6 7 30 sec , weight box , battery eliminator , digital multimeter , travelling microscope , ldr characteristics apparatus , study of hall effect complete setup , e m by milikan s oil drop method , newton s rings apparatus complete complete with travelling microscope power supply and sodium lamp , vernier callipers , sodium vapor lamp , mercury lamp , photo diode characteristic apparatus , u j t characteristic apparatus , f e t characteristic apparatus , m o s f e t characteristic apparatus , s c r characteristic apparatus , diac and triac characteristic apparatus , solar cell characteristic apparatus , single stage and double stage r c coupled amplifier feed back amplifier , transistorized push pull amplifier , f e t amplifier , power amplifier , zener regulated power supply , study of various a c bridges e g anderson schering hay kelvin maxwell de sauty wien s bridges , transistorized regulated power supply , study of various network theorems , clipping and clamping circuit using operational amplifier , impedance and power factor of lcr circuit , 8085 microprocessor with smps , half wave and full wave rectifier apparatus with built in power supply , study of lissajous figure trainer. , apparatus to study rc coupled amplifier with built in power supply , to study the vi characteristics of the solar cell , apparatus to study characteristics of tunnel diode , binocular microscope , oven , autoclave portable , thin layer chromatography kit , incubator stainless steel , water bath double wall 12 holes stainless steel , tissue culture rack...

Department of Higher Education - Madhya Pradesh

32434017 bids are invited for digital colony counter , oven , heating mental with regulator cap 1 lt , gel electophorosis unit with power supply vertical , laminar air flow horizontal , spectrophotometer 340 900nm range , colorimeter , dissecting microscope , compound microscope , bionocularmicroscope , bod incubator , water bath double wall 6 holes stainless steel , distillation apparatus single distillation capacity 3lt , distillation apparatus double distillation capacity 5lt , hot air oven stainless steel , water and soil testing analysis kit , centrifuge machine 3500 rpm , flame photometer , ph meter , digital tds meter , electronic digital balance 0.1 mg , thin layer chromatography apparatus , function generator b 1hz to 10 mhz , function generator a 0 3 to 3 mhz , measurement of wave length of hene laser using ruler with laser complete setup , physical balance , weight box , vernier callipers , stop clock , ammeter d c a c required range , voltmeter d c a c required range , galvanometer , battery eliminator , digital multimeter , resistance box various range , optical bench with riders double bar heavy , inertia table , lee s apparatus to determine the hear conductivity of bad conductors of different geometry , zener diode characteristics apparatus with built in power supply. , plug key one way two way , four way key , moarse key , lachlanche cell , analog multimeter , soldering iron , rheostate various length , spectrometer prism crown flint glass , sodium vapor lamp , transformer of mercury lamp , screw gauge , f e t characteristic apparatus , m o s f e t characteristic apparatus , u j t characteristic apparatus , solar cell characteristic apparatus , single stage and double stage r c coupled amplifier feed back amplifier , zener regulated power supply , ic 7805 regulated power supply , study of various network theorems , study of various a c bridges e g anderson schering hay kelvin maxwell de sauty wien s bridges , series and parallel resonance circuit , impedance and power factor of lcr circuit , e m by milikan s oil drop method , spectrometer 6 7 , photo diode characteristic apparatus , research microscope , autoclave portable , rotatory microtome with accessories , thin layer chromatography kit , binocular microscope , magnetic strirrer with hot plate , electronic digital balance , soxhlet extraction unit , spectrophotometer 340 900nm range , autoclave vertical cap 50lt...

Indian Army - Madhya Pradesh

32207014 supply of expendable medical stores , brimonidine tartrate 0.2%, eye drops , bott of 5ml , brinzolamide eye drop 1% w/v bott of 5ml , ciprofloxacineye drop 0.3% bott of 5 ml , dorzolamide 2% + timolol0.5% eye drop bott of 5 ml , dorzolamide 2%, eye drops (5ml) , fluoromethonole 0.1% eye drop, bott of 5 ml , flurbiprofen sodium ophthalmic sol 0.03% bott of 5 ml , homatropine hydrochloride,sol 2% eye drop bott of 5 ml , loteprednol etabonate 0.5% w/v eye drop bott of 5 ml , moxifloxacin 0.5% eye drop bott of 5ml , nepafenac 0.1% eye drop,bott of 5 ml , olapatadine eye drop 0.1% w/v bott of 5 ml , prednisolone acetate 1 %eye drop bott of 5 ml , sodium hyaluronate opthalmic sol(14mg/ml) pre filled solution , tropicamide 1% eye drop bott of 15 ml , trypan blue opthalmic solution0.6%in vialof 1 ml , crescent knife , irrigation & aspiration tubing set for eye , set of 10 , single piece iol lens with uv protection size : 17.0 ds , single piece iol lens with uv protection size : 18.0 ds , single piece iol lens with uv protection size : 19.0 ds , single piece iol lens with uv protection size : 19.5 ds , single piece iol lens with uv protection size : 20.0 ds , single piece iol lens with uv protection size : 21.0 ds , single piece iol lens with uv protection size : 22.0 ds , single piece iol lens with uv protection size : 23.0 ds , single piece hydrophobic pmma lens size : 17.0 ds , single piece hydrophobic pmma lens size : 18.0 ds , single piece hydrophobic pmma lens size : 19.0 ds , single piece hydrophobic pmma lens size : 20.0 ds , single piece hydrophobic pmma lens size : 21.0 ds , single piece hydrophobic pmma lens size : 22.0 ds , e/d proparacaine 0.5 % w/v bott of 5 ml , eye drape (for surgery) , eye pads/patch , inj trypan blue 0.06% , hydroxy propyl methyl cellulose 0.5% opthalmic soln (pre filled)(visco) , dextrose monohydrate for oral use,pkt of 100 gm , grouping sera anti’a’ (monoclonal) bott of 10 ml , grouping sera anti’b’ (monoclonal) bott of 10 ml , grouping sera anti’d’ (monoclonal)igm, bott of 10 ml , weak anti ‘d’ (igg), bott of 10 ml , anti human globulin, bott of 5 ml , serum anti h, bott of 5 ml , serum anti a1, bott of 5 ml , vacuatainer ( sodium flouride) with needle 2 ml , vacuatainer ( k3 edta) with needle 2 ml , vacuatainer (strile/plain gel ) with needle 4ml , 3.2% sodium citrate vacuatainer 1.8ml , pregnancy test (rapid card method) pkt of 50 test , disposable blade for microtome pkt of 50 blade , diluent erba h560, pack of 20 ltrs , lyse 1 erba h560, bott of 200ml , lyse 2 erba h560, bott of 500 ml , h clean erba h560, bott of 50 ml , eliteh5forerbah560controlforerba haematology analyser , cell pack (transasia ) xp 100, pack of 20 ltrs , stomatolyser (transasia) xp 100, bott of 500ml , cell clean (transasia)xp 100, bott of 50ml , hiv i & ii rapid test kit , hbsag rapid test kit , anti hcv rapid test kit , kit for estimation of c reactive protein (50 test) , prothrombine time test , bott of 5 ml , micropipettes tips (05 100ul) , micropipette tips (100 1000ul) , paper filter round 9cm, pkt of 100 , paper fitler square 51cm x 51cm (pkt of 100) , slide microscope. thickness 1.15mm 1.35mm size 76mm x 50mm , blood culture bottle systems (aerobic/anaerobic ) 20 ml , blood culture bottle systems (aerobic/anaerobic ) 50 ml , macconkey agar , blood agar base , cled agar , muller hilton agar , nutrient agar , dengue kit (ns1ag, igg/igm) kit of 10 test , malaria antigen rapid kit of 50 test , eight check xp 100 control for sysmex haematology analyser , em 200 xl hba1c with cal set (2x15ml / 2x5ml) , em 200 albumin small system pack (10x44ml) , em 200 alkaline phosphatise small system pack 2x44ml / 2x11ml , em 200 amylase small system pack 5x11ml , em 200 bilirubin total system pack 6x44ml / 3x22ml , em 200 bilirubin direct system pack 6x44ml / 3x22ml , em 200 caclcium (a) small system pack 5x6ml , em 200 cholesterol system pack 10x44ml , em 200 ck mb small system pack 2x12ml / 2x3ml , em 200 ck nac small system pack 2x12ml / 2x3ml , em 200 gamma gt small system pack 2x22ml / 2x6.8ml , em 200 glucose ( god – pod) system pack 10x44ml , em 200 hdl cholesterol with calibrator 4x30ml / 4x10ml , em 200 ldh – p small system pack 5x11ml / 5x4ml , em 200 ldl cholesterol with calibrator 2x30ml / 2x10ml , em 200 micro albumin control 1x1ml , em 200 micro albumin with cal 1x5ml / 2x25ml , em 200 micro protein with cal small system pack 5x 6 ml , em 200 phosphorus small system pack 5x6ml , em 200 sgot – el system pack 6x44ml / 3x22ml , em 200 sgpt – el system pack 6x44ml / 3x22ml , em 200 urea system pack 5x44ml / 5x11ml , em 200 total protein small system pack 5x6ml , em 200 triglycerides system pack 5x44ml / 5x11ml , em 200 xl autowash ac/al kit 5x44ml / 5x44ml , em 200 creatinine –enzymatic system pack 5x30 ml / 5x10 ml , em 200 erba auto wash system pack , em 200 xl multical 4x3ml , em 200 uric acid 5x44ml / 5x11ml , em 200 quanitative crp tulbilatex calibrator 2x22/ 1x11 ml , cartridge for bar code printer type wax 333plus size 55mm x 75mm , sterile urine container 20 50ml , paediatric vaccutainer sterile , paediatric vaccutainer edta , lyphochek assayed bio chemistry control level 1(siemens/roche/biorad) , lyphochek assayed bio chemistry control level 2(siemens/roche/biorad) , biorad lyphochek assayeddiabetes control (level 1&2) 06 x 0.5ml , medica easylyte plus na/k/cl solutions pack (ref 2121) with probe wipers (800 ml) , medica easylyte na/k/cl (500ml) urine diluent(ref 2111) , medica easylyte na/k/cl (90ml x 0.50g) daily rinse/cleaning solution kit (ref 2118) , urinalysisreagentstrips2para(protein& glucose) bott of 100 strips , urinalysisreagentstrips2para(ketone& glucose) bott of 100 strips , urinalysis reagent strips 10 para (multistix 10sg) bott of 100 strips for siemens urine analyser , sterilized disposable petri dish (size 90mm) , cytochrome stain kit (modified leishman’s) with stock buffer (2x)500 ml stain+500ml buffer , ck mb kit 2x8 / 2x2 ml(semi automatic) => limited...

Department of Higher Education - Madhya Pradesh

32137481 bids are invited for electronic digital balance 0.01mg , soxhlet extraction unit , uv transiluminator , compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , kjeldahl digestion unit 6 test , gel electrophorasis horizontal tank with digital , deonizer with digital meter , d o meter digital , melting point apparatus digital , rotary microtome with accessories , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , double beam uv vis spectrometer without pc 200 1100nm , micro certifuge 10 1000 rpm , cork boring machine , humidity chamber , heating mentle 7 ltrs , ph meter digital , paper chromatography testing kit , chemical balance , thin layer chromatography kit , bod incubator , chromatrographic chamber , chromatrographic oven chamber , cod digestion apparatus , digital balance accuracy 0.001 200grm , digital thermostate , electronic digital balance , flame photometer , microprocessor flame photometer , polarimeter half shade , thin layer chromatography kit , oven , flame photometer , bod incubator , centrifuge machine 3000 14000 rpm , research microscope , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , spectrophotometer 340 900nm range , apparatus to study charging and discharging of a capacitor , e m by milikans oil drop , zener diode characteristics apparatus with built in power supply , weight box , compound pendulum bar pendulum , jaegers apparatus to determine the surface tension , spectrometer 6 7 inches , transformer the surface tension , spectrometer 6 7 inches , transformer of mercury lamp , transformer for sodium vapor lamp , transistorized push pull amplifier , power amplifier , study of schmitt trigger circuit , study of hall effect compl1ete setup , ionization potential of lithium complete setup , fiber optics trainer , 8086 microprocessor with smps , complete apparatuses to determine e by milikons method , mosfet characteristic apparatus , lees apparatus to determine the hear conductivity of bad conductors of different geometry , complete apparatus to determine elm using thomsons method , dielectric constant apparatus , photo diode characteristic apparatus , inertia table , travelling microscope , vernier callipers , stop watch digital , newtons rings apparatus complete complete with travelling microscope power supply and sodium lamp , transistorized differential amplifier , study of amplitude modulation and demodulation trainer , apparatus to study response curve for lcr circuits and to determine the resonance frequency , battery charger 2 to 12 volt , potentiometer , single stage and double stage r.c. coupled amplifier feed back amplifier , solar cell characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , physical balance , thermister characteristic apparatus , voltmeter dc ac required range , zener regulated power supply , transistorized regulated power supply , rheostate various length , diac and triac characteristic apparatus , sodium vapor lamp , fet characteristic apparatus , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , hartley and colpitts oscillator...

Department of Higher Education - Madhya Pradesh

32103480 bids are invited for electronic digital balance 0.01mg , soxhlet extraction unit , uv transiluminator , compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , kjeldahl digestion unit 6 test , gel electrophorasis horizontal tank with digital , deonizer with digital meter , d o meter digital , melting point apparatus digital , rotary microtome with accessories , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , double beam uv vis spectrometer without pc 200 1100nm , micro certifuge 10 1000 rpm , cork boring machine , humidity chamber , heating mentle 7 ltrs , ph meter digital , paper chromatography testing kit , chemical balance , thin layer chromatography kit , bod incubator , chromatrographic chamber , chromatrographic oven chamber , cod digestion apparatus , digital balance accuracy 0.001 200grm , digital thermostate , electronic digital balance , flame photometer , microprocessor flame photometer , polarimeter half shade , thin layer chromatography kit , oven , flame photometer , bod incubator , centrifuge machine 3000 14000 rpm , research microscope , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , spectrophotometer 340 900nm range , apparatus to study charging and discharging of a capacitor , e m by milikans oil drop , zener diode characteristics apparatus with built in power supply , weight box , compound pendulum bar pendulum , jaegers apparatus to determine the surface tension , spectrometer 6 7 inches , transformer surface tension , spectrometer 6 7 inches , transformer of mercury lamp , transformer for sodium vapor lamp , transistorized push pull amplifier , power amplifier , study of schmitt trigger circuit , study of hall effect compl1ete setup , ionization potential of lithium complete setup , fiber optics trainer , 8086 microprocessor with smps , complete apparatuses to determine e by milikons method , mosfet characteristic apparatus , lees apparatus to determine the hear conductivity of bad conductors of different geometry , complete apparatus to determine elm using thomsons method , dielectric constant apparatus , photo diode characteristic apparatus , inertia table , travelling microscope , vernier callipers , stop watch digital , newtons rings apparatus complete complete with travelling microscope power supply and sodium lamp , transistorized differential amplifier , study of amplitude modulation and demodulation trainer , apparatus to study response curve for lcr circuits and to determine the resonance frequency , battery charger 2 to 12 volt , potentiometer , single stage and double stage r.c. coupled amplifier feed back amplifier , solar cell characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , physical balance , thermister characteristic apparatus , voltmeter dc ac required range , zener regulated power supply , transistorized regulated power supply , rheostate various length , diac and triac characteristic apparatus , sodium vapor lamp , fet characteristic apparatus , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , hartley and colpitts oscillator...

Directorate Of Medical Education - Madhya Pradesh

32061822 tender for purchase of chemical and reagent for mdru dep tender for purchase of chemical and reagent for mdru dep , supply of chemicals and reagents for mdru , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 5 od , r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 5 od , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , tips i. 0.2 20 ?l tips pack size of 1000 each , tips ii. 20 200 ?l tips pack size of 1000 each , tips iii. 200 1000 ?l tips pack size of 1000 each , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tips , filter tips pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tips , filter tips pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tips , mct variable tubes , i. 20 200?l tubes pack size of 1000 psc. , ii. 200 600 ?l tubes each , iii. 500 2000 ?l tubes , nitrile autodextorous gloves pack size of 1000 psc. , mctstands for variable tubes sizes pack size of 1000 psc. each , i. 20 200?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , ii. 200 600 ?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , iii. 500 2000 ?l tubes stand , filter tip boxes pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000ml 05each , graduated beakers50, 100, 500, 1000ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , total rna mini kit ( human skin tissue ) pack size for 100 reaction , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , chloroform 500 ml , phenol 500 ml , isoamyl alcohol 500 ml , hno3 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , cholin cleaner 500 ml , sterilium 500 ml , hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , brown paper for autoclaving 10 rolls , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side 1 psc. each , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen 5ltrpkt. , liquid nitrogen sample handling gloves 5 sets of gloves , phosphate buffer saline 500 ml , formalin 500 ml , slide tray / rack pack of 2 psc. , paraffin wax ( 58 60c ) 250 gm , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 2 psc. , whatman filter paper grade 1 & 2 pack size of 50 psc. , harri’s hematoxylin powder 50 gm , yellow eosin powder 50 gm , coverslip 18x18 ( microscopic ) 100 psc. , dpx mount 50 ml , xylene 250 ml , glycerol 100 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , ammonia 250 ml , hot plate 1 psc. , methanol 250 ml. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , acrylamide / bis ar 500 gm , 10x tbe buffer 100 ml , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100ug , human pai 1 elisa kit pack size of 96 reactions , diethyl pyrocorbonate 5 ml , pbs 500ml , mortar and pestle homogenizers...

Department of Higher Education - Madhya Pradesh

32042426 bids are invited for electronic digital balance 0.01mg , soxhlet extraction unit , uv transiluminator , compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , kjeldahl digestion unit 6 test , gel electrophorasis horizontal tank with digital , deonizer with digital meter , d o meter digital , melting point apparatus digital , rotary microtome with accessories , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , double beam uv vis spectrometer without pc 200 1100nm , micro certifuge 10 1000 rpm , cork boring machine , humidity chamber , heating mentle 7 ltrs , ph meter digital , paper chromatography testing kit , chemical balance , thin layer chromatography kit , bod incubator , chromatrographic chamber , chromatrographic oven chamber , cod digestion apparatus , digital balance accuracy 0.001 200grm , digital thermostate , electronic digital balance , flame photometer , microprocessor flame photometer , polarimeter half shade , thin layer chromatography kit , oven , flame photometer , bod incubator , centrifuge machine 3000 14000 rpm , research microscope , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , spectrophotometer 340 900nm range , apparatus to study charging and discharging of a capacitor , e m bymilikans oil drop , zener diode characteristics apparatuswith built in power supply , weight box , compoundpendulum bar pendulum , jaegers apparatus to determinethe surface tension , spectrometer 6 7 inches , transformer1 / 67the surface tension , spectrometer 6 7 inches , transformerof mercury lamp , transformer for sodium vapor lamp , total quantity : 267...

General Administration Department - Madhya Pradesh

32042332 bids are invited for electronic digital balance 0.01mg , soxhlet extraction unit , uv transiluminator , compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , kjeldahl digestion unit 6 test , gel electrophorasis horizontal tank with digital , deonizer with digital meter , d o meter digital , melting point apparatus digital , rotary microtome with accessories , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , double beam uv vis spectrometer without pc 200 1100nm , micro certifuge 10 1000 rpm , cork boring machine , humidity chamber , heating mentle 7 ltrs , ph meter digital , paper chromatography testing kit , chemical balance , thin layer chromatography kit , bod incubator , chromatrographic chamber , chromatrographic oven chamber , cod digestion apparatus , digital balance accuracy 0.001 200grm , digital thermostate , electronic digital balance , flame photometer , microprocessor flame photometer , polarimeter half shade , thin layer chromatography kit , oven , flame photometer , bod incubator , centrifuge machine 3000 14000 rpm , research microscope , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , spectrophotometer 340 900nm range , apparatus to study charging and discharging of a capacitor , e m by milikans oil drop , zener diode characteristics apparatus with built in power supply , weight box , compound pendulum bar pendulum , jaegers apparatus to determine the surface tension , spectrometer 6 7 inches , transformer the surface tension , spectrometer 6 7 inches , transformer of mercury lamp , transformer for sodium vapor lamp , transistorized push pull amplifier , power amplifier , study of schmitt trigger circuit , study of hall effect compl1ete setup , ionization potential of lithium complete setup , fiber optics trainer , 8086 microprocessor with smps , complete apparatuses to determine e by milikons method , mosfet characteristic apparatus , lees apparatus to determine the hear conductivity of bad conductors of different geometry , complete apparatus to determine elm using thomsons method , dielectric constant apparatus , photo diode characteristic apparatus , inertia table , travelling microscope , vernier callipers , stop watch digital , newtons rings apparatus complete complete with travelling microscope power supply and sodium lamp , transistorized differential amplifier , study of amplitude modulation and demodulation trainer , apparatus to study response curve for lcr circuits and to determine the resonance frequency , battery charger 2 to 12 volt , potentiometer , single stage and double stage r.c. coupled amplifier feed back amplifier , solar cell characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , physical balance , thermister characteristic apparatus , voltmeter dc ac required range , zener regulated power supply , transistorized regulated power supply , rheostate various length , diac and triac characteristic apparatus , sodium vapor lamp , fet characteristic apparatus , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , hartley and colpitts oscillator...

Department of Higher Education - Madhya Pradesh

32042324 bids are invited for electronic digital balance 0.01mg , soxhlet extraction unit , uv transiluminator , compound microscope , dissecting microscope , autoclave portable , heating mental with regulator cap 1 ltrs , incubator stainless steel , digital colony counter , heating mental with regulator cap 500 ml , autoclave vertical cap 50ltrs , magnetic strirrer with hot plate , laminar air flow horizontal , binocular microscope , water bath double wall 6 holes stainless steel , hot air oven stainless steel , ph meter , water and soil testing analysis kit , vortex shaker , colorimeter , image projection system , slide readar , thin layer chromatography apparatus , laminar air flow vertical , kjeldahl digestion unit 6 test , gel electrophorasis horizontal tank with digital , deonizer with digital meter , d o meter digital , melting point apparatus digital , rotary microtome with accessories , water soil testing kit digital , spectrophotometer 340 900 nm , water bath 12 holes , double beam uv vis spectrometer without pc 200 1100nm , micro certifuge 10 1000 rpm , cork boring machine , humidity chamber , heating mentle 7 ltrs , ph meter digital , paper chromatography testing kit , chemical balance , thin layer chromatography kit , bod incubator , chromatrographic chamber , chromatrographic oven chamber , cod digestion apparatus , digital balance accuracy 0.001 200grm , digital thermostate , electronic digital balance , flame photometer , microprocessor flame photometer , polarimeter half shade , thin layer chromatography kit , oven , flame photometer , bod incubator , centrifuge machine 3000 14000 rpm , research microscope , water bath double wall , rotatory microtome with 12 holes stainless steel accessories , hot air oven stainless , magnetic strirrer with hot , water and soil testing , spectrophotometer 340 900nm range , apparatus to study charging and discharging of a capacitor , e m by milikans oil drop , zener diode characteristics apparatus with built in power supply , weight box , compound pendulum bar pendulum , jaegers apparatus to determine the surface tension , spectrometer 6 7 inches , transformer the surface tension , spectrometer 6 7 inches , transformer of mercury lamp , transformer for sodium vapor lamp , transistorized push pull amplifier , power amplifier , study of schmitt trigger circuit , study of hall effect compl1ete setup , ionization potential of lithium complete setup , fiber optics trainer , 8086 microprocessor with smps , complete apparatuses to determine e by milikons method , mosfet characteristic apparatus , lees apparatus to determine the hear conductivity of bad conductors of different geometry , complete apparatus to determine elm using thomsons method , dielectric constant apparatus , photo diode characteristic apparatus , inertia table , travelling microscope , vernier callipers , stop watch digital , newtons rings apparatus complete complete with travelling microscope power supply and sodium lamp , transistorized differential amplifier , study of amplitude modulation and demodulation trainer , apparatus to study response curve for lcr circuits and to determine the resonance frequency , battery charger 2 to 12 volt , potentiometer , single stage and double stage r.c. coupled amplifier feed back amplifier , solar cell characteristic apparatus , transistor characteristics apparatus with built in power supply and meters , physical balance , thermister characteristic apparatus , voltmeter dc ac required range , zener regulated power supply , transistorized regulated power supply , rheostate various length , diac and triac characteristic apparatus , sodium vapor lamp , fet characteristic apparatus , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to determine the value of planks constant complete with photocell light source set of filter and power supply , hartley and colpitts oscillator...

Indian Army - Madhya Pradesh

31849554 purchase of medical stores and drugs as per rfp , medicines : , prothrombin time ( 12x5 ml ) , ana ( 1x5 tests ) , sterile swab stick with polypropylene tube ( 1x100 tubes ) , troponine –i ( 1x25 tests ) , appendrof tube 1ml ( 1x1000 ) , biorad level 1 chemistry control ( 12x5 ml ) , biorad level 2 chemistry control ( 12x5 ml ) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper ( blue star ) , reticulocyte stain ( 100 ml ) , zn stain ready to use , indian ink stain ( 50 ml ) , lacto phenol cotton blue stain , cled agar ( 500 gm ) , urochrome agar ( 500 gm ) , muller hinton agar ( 500 gm ) , blood agar base ( 500 gm ) , saburoid dextose agar ( 500 gm ) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich ( ready to use ) , haematoxillin stain harris ( ready to use ) 500 ml bottle , ethanol , methanol ( alcohol methyl ) , chloroform , microtome blade s 35 high profile type ( 50 blades pack ) feather / lica microtome , salmonella, shigella agar ( 500 gm ) , microscope bulbs , glass marking pen ( diamond marker ) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Indian Army - Madhya Pradesh

31599724 purchase of medical stores as per rfp , medicines : , prothrombin time (12x5 ml) , ana (1x5 tests) , sterile swab stick with polypropylene tube(1x100 tubes) , troponine –i (1x25 tests) , appendrof tube 1ml (1x1000) , biorad level 1 chemistry control (12x5 ml) , biorad level 2 chemistry control (12x5 ml) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper (blue star) , reticulocyte stain (100 ml) , zn stain ready to use , indian ink stain (50 ml) , lacto phenol cotton blue stain , cled agar (500 gm) , urochrome agar (500 gm) , muller hinton agar (500 gm) , blood agar base (500 gm) , saburoid dextose agar (500 gm) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich (ready to use) , haematoxillin stain harris ( ready to use) 500 ml bottle , ethanol , methanol (alcohol methyl) , chloroform , microtome blade s 35 high profile type (50 blades pack) feather/lica microtome , salmonella, shigella agar (500 gm) , microscope bulbs , glass marking pen (diamond marker) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Government Dental College - Madhya Pradesh

31531391 dental equipments dental instruments and equipments , 3 point articulator / plane articulator ( mean value articulator ) , acryliser programmable preheating time & temperature programmable curing time & temperature analog control unit capacity 6 8 flask digital programming , adson” tooth forceps 5” , adsons tooth forceps 8” , advance digital microscope with imaging software ( with desktop + printer + ups + mouse ) optical system infinity color corrected optical system observation tube:seidentopf digital viewing head, 3.2 million pixels high resolution camera system: resolution ratio 2048*1536 pixels, line by line scan eyepiece: high eye point wide field plan eyepiece pl10x / 20mm, with ±5 degrees diopter control, ipd: 50 75mm objective:plan achromatic objective 4x plan achromatic objective 10x plan achromatic objective 40x spring plan achromatic objective 100x s, oil nosepiece:backward quadruple nosepiece illumination main supply 100v 240v, 3 watt led lamp or 6v / 20w halogen with intensity control ( fixed center ) focusing adjustment:coaxial coarse and fine focusing adjustment, with limited and tension adjustment coarse adjustment range: 25mm, fine adjustment precision:0.002mm. condenser: n.a.1.25 condenser ( with socket for phase contrast and dark field sliders ) stage:coaxial mechanical stage 140x132mm size and 76×50mm travel range. inbuilt microscopic scientific digital camera with imaging software consisting of: high resolution digital camera with 1 / 2” cmos chip usb 2.0 pc connection real time live image resolution: 3 mega pixels electronic shutter exposure time: 1ms 0.3s working temperature: 20°c ~ 70°c image analysis software: sportily calibration line measurements for distance, length, width, perimeter, angle, three point radius. area by enclosed line controlled by four arrow keys available on the keyboard arrow with zoomed preview the line measurement is not affected on zoomed images. identification of objects in an image, count them, obtain several features measurements. objects identification by user or automatically. user defined classification on basis of size or intensity. manual, auto bright and auto dark methods to identify intensity range defined object to be measured. various calculation & measurements available for selected particle are; dimensions, area, perimeter, ferrite length, min / max radius, thread length, thread width, fiber length, fiber width. roundness, shape, orientation, elongation, equal circular diameter, equal sphere volume, data export report generating and print out interactive file format. , advanced research microscope , air purifier , airotor cartridge suitable for nsk airotor hand piece , airotor control box with inbuilt micromotor , 3 way syringe & 02 nos. airotor control with trolly , airotor hand piece ( chuck ) , airotor hand piece noiseless ultra push type – with ceramaic bearing super torque head , airotor oiling machine , alcohol torch with adjustable flame , allis forcep 5” , allis forcep 6” , alloy cutter compact alloy cutter with high speed grinding and dependable trouble free operation with vaccum suction safety glass for glare elimination and visual protection 20000 rpm , amalgam carrier , amalgamator , anesthesia machine ( boyle apparatus ) 1. ms & aluminum combined structure with polyurethane coated finish for long life. 2. forged body regulators for medical oxygen & nitrous oxide for maintenance free operation. 3. two numbers each forged yokes with ss fittings for medical oxygen & nitrous oxide at the sides. 4. colour coded yoke mounted high pressure gauges. 5. two tube rotameter with oxygen ratio controller with unitized rotameter. 6. magill’s breathing system one number in addition. 7. bain’s breathing system one number in addition 8. safety features : • oxygen failure warning device ( ofwd ) • nitrous oxide cut off in the absence of oxygen • oxygen ratio controller 9. large diameter castor wheels with individual brakes at front castors 10. one year standard warranty 11. local service support with hand phone number of engineer 12. should be manufactured in an iso certified facility 13. circle absorber may be quoted as an option 14. cage mount isoflurance vaporizer may be quoted as an option , angled model saw , anoxic polisher cum reducer , anterior band removing plier , apex locator 5th generation or above , artery forcep artery 6” , artery forceps artery 5” , articulator model jp30, gnatus brazil sem adjustable safe and easy operation its offers a better performance high and precision easy to take patients impression and to mount the model. appropriate for diagnotics and clinic planning ideal for laboratory, used in many produres accessories bite fork for teeth bite fork for toothless ruler / face bow fork support mounting table incisal table metallic moounting plates. , articulator wide view individually adjustable, all the joint angles can be continuously set without having to replace any elements, centric locking catch, seprable upper & lower frame, optimized joint mechanics with continuously adjustable angles protrusion ( 0 60 degree ) , retrusion 35 degree, bennett ( 0 30 degree ) , side shift 0 1.5mm, protrusion shift 0 4mmcompatible with split cast system with earpiece type spring facebowtransfer complete assembly, one pair metallic and ten pair of plastic mounting plates , austins retractor , auto clavabel hand piece , stateof the art piexon techonology , no heat generation in hand piece, titanium tip , autoclave ( vertical loading ) overall size 18”x13”x15” cm capacity of 25 liters inside dimension : dia 30.5 cm. depth 38.0 cm. cycle time 16 minat 127 c, 19 psi power consumption 220v / 50hz 2k. watt heater provided at the base of the body with 2 drums of ss 11x5 inch body is made of 7 mm thick aluminum sheet imported insulation material provided to avoid and heat loss total cycle time from room temperature is approximate 36 minutes for first cycle and approximate 28 minutes for consequent cycles power saving as heater automatically off and on after reaching the required temperature , autoclave front loading b type front loading fully automatic autoclave with 3 vacuum cycle & dry cycle • 22 ltr capacity and micro processor controlled • wrapped / unwrapped, porous, solid instrument including cotton swabs can be sterilized • bow & dick test qualified • digital display of pressure & temperature • double safety lock on the door • silicon gasket prevent any leakage of air • can be used at ( 121 c & 134 c ) during sterilization • 2 storage tanks for fresh and used water • no. of tray 3 , automatic pressure hand piece cleaning machine , automatic radiographic film processors , automatic shade analyser equipment that relates to a computer readable medium comprising one or more programs for carrying out a method for determining a patients tooth shade, compatible with vita shade guide , b.p. handle, straight, rounded, angled rounded, straight flat no. 3& 4. , ball burnisher , band forming plier , base former made up of rubber base, 2sets maxillary and mandible , bearing for lab. clinical merathon micromotor &conventional straight h / p / , binocular microscope ?ergonomically design retro styled u shaped stand in one piece die casting. reverse nosepiece binocular head inclined at 45; ensure comfort during prolonged usage with high precision collimation. ipd adjustment provided between 54mm and 74mm. ? adjustment available on one tube for length compensation with no effect on performance. all prisms have hea coating for maximum light throughout and exact 50 / 50 light. ? eyepiece: 10 x wf ( fov 20mm ) has expanded wide field of view through high eye point 25mm with foldable eye guards. ? objectives plan achromatic objective 4 x, 10 x, 40 x ( sl ) and 100x ( sl, oil ) give excellent performance. ? double plate flat top mechanical stage with low positioned co axial controls. the plate size 160mm x 140mm. ? sub stage condenser na 1.25 pre centered with aspheric lens and day light blue glass filter. ? the illumination system has 6v 20 w halogen lamps with variable control, built in base, housing all electrical inside. ? packed kin wooden box ( with lock and key ) and with instruction manual and dust cover. with colorcorrected infinity optical system consisting of infinity optical system antifungal optic microscope stand binocular eyepiece tube siedentop type inclined wide field higheye point eyepieces wf10 x / 20mm pair reverse d quadruple nosepiece. , biochemical analyzer ( semi automatic ) semi automated chemistry analyzer capable of performing routine biochemistry tests including end point, various enzymatic ( kinetic ) , fixed time with multi standard curve calibration open system. program mode: absorbance, bi chromatic end point with standard or factor, with or without reagent blank / or sample blank. should have minimum 6 filters with range 340 to 670 nm. halogen lamp 12v 20w & should have lamp saver mode. photometric range from 0.0 to 3.0 a peltier controlled flow cell chamber with flow cell of 18ul with temp from 20 to 40 degree celsius at increment of 1 degree celsius aspiration system: in built peristaltic bi directional pump ( air purge between samples ) memory general operating software for storage of calibration curve & absfor reagent blank for end point methods. multi standard with end point / kinetics / fixed time for minimum 9 standards. triplicate mode of calibration and triplicate mode of sampling with mean and sd. display: large graphic lcd & thermal graphic printer for printing of reaction curves & test results & laboratory name and doctor’s name. should have on line graph and od and also graph should be edited to remove the non linear portion. the software should be user’s friendly and inbuilt profile calculators for lipids, iron / tibc etc. should have input voltage from 220 v / 50 hz. should have triple cuvette system : cuvette / flow cell for biochemistry and round tubes for coagulation. reaction volume: 100 to 1000ul. should have pt with inr, ratio & % values for the results. should copy, delete and edit function for easy programming of test methods. should have minimum storage of 5000 testin the memory with patient id. should have inbuilt feature of inventory for reagent management. should have usb keyboard connection. operator interface: membrane keyboard for about 35 keys for direct test selection quality control should have minimum 30 results with 3 levels. should have inbuilt dry bath incubator with inbuilt individual timers. , biopsy equipment , bite planer , bite positioner bioplast material, sizes small med and large. , bone file , bone gouge ( medium ) , bone gouge ( small ) , bone gouge large , bone nibbler 6” & 8” ( singleleaver ) , bone nibbler 6” & 8” ( double leaver ) , bone plate self screw holding 1.5mm driver , bone plate self screw holding 2.5mmdriver , bone plate self screw holding 2mm driver , bone ronger , bowl steel ( small & medium size ) , boyles apparatus construction should be tubular, rigid, electrostically powder coated steel section, gas specific yokes with sliding steel claming bars, for mobility 4 large diameter anti static castre wheels, 2 pressure gauge& regulatoreach for oxygen & nitrous oxide, non return pressure release valve, the ofwd ( oxygen failure warning device ) , space for 2 or more vapouriser long flowmeters ( approx.230mm ) , oxygen flush, circle absorber, the basic machine should be isi / ce marked. , broadrick occlusal plane analyser , bucks periodontal knife , bulb for light cure for tungsten halogen curing lights 300 mw / cm2 or higher , bunsen burner for use with butane gas / lpg , bur box , burn out muffle furnace * programmable, pre set system * microprocessor controlled temperature regulation with digital lcd display * heating upto 1100`c * mold chamber dimensions * height 100 150mm *depth 250 350 *width 200 250mm * 230v / 50hz / 2300 watt , camera ( dental ) • compact digital still camera with twin flash and ring flash, 5x optical / 4x digital / 20x combined zoom with optical image stabilizer system • monitor ( min ) 2.8 inch tft color lcd ( vari angle type with wide viewing angle • resolution ( min ) 10 megapixels • viewfinder type real image optical zoom • focal length 6.1 ( w ) 30.5 ( t ) mm ( 35mm film equivalent: 28 ( w ) 140 ( t ) mm ) • computer interface usb 2.0 hi speed usb ( dedicated female connector with unified type of digital, audio and video • memory card support secure digital ( sd ) card • shutter speed 15 1 / 4000 seconds ( total shutter speed range; varies based on shooting mode ) • power sources rechargeable lithium ion battery and ac adapter kit other features 2gb or more memory card macro ring lite mr 14ex conversion lens adapter user guide / instructions , carbon brush for marathon micromotor m3 , casting machine a. centrifuge motor cast , cats paw retractor , cement carrier , cement condensers , cement spatula , ceramic furnace – fully programmable ceramic furnace: firing chamber should be lined with high quality insulating material ??molybdenum disilicide heating elements ??color graphic touchscreen display ??50 freely programmable sintering programs. safety features that should be present: ??temperature sensor monitoring ??current monitoring ??protection against power failure. technical requirements: dimensions: firing unit: w x h x d 360 mm x 810 mm x 490 mm power unit: w x h x d 500 mm x 210 mm x 350 mm weight: firing unit: 32.0 kg casing with power unit: 27.5 kg firing chamber capacity: diameter : 84.0 mm height: 90.0 mm firing chamber temperature: max. 1600°c electrical requirements: power supply: 200 / 230 volt ac 50 hz 110 volt ac 50 / 60hz power consumption: max. 1500 watts classification: safety class 1 , ceramic kit ( instrument ) , chair side trolley ( small ) , cheatal forcep 8” , cheatal forceps 10” , cheek retractor ( small ) , cheek retractor ( medium ) , cheek retractor ( large ) , chip syringe , chisel , circular saw , clinical micromotor with st. & contra angle hand piece motor of 35000rpm. with control box & foot control , coll tubing for 3 way syringe& airotor h.p. , composite finishing instrument gold plated , composite placement instrument kit terflon coated / non sticky surfaced instruments for placement of composite , composite polishing kit , compressor centralized compressor system. compressed air system for 11 dental chairs and maximum 11 operators working simultaneously clinic pressure station p 6000 400 v, 50 / 60 hz, 8.6 10.7 kw, 22.5 25.5 a with 2 aggregates, incl. control unit, air intake bacteria filter, 500 litre pressure tank and refrigerant dryer, elec. cyclone separator, relieve valves, 100 % duty cycle, remote control display possible. designed for up to 30 workplaces for max 20 operators working simultaneously. voltage 400 v ( 3~ ) frequency 50 / 60 hz output at 5 bar with 2 aggregates 1133 / 1280 l / min separate control display ( 5922 520 51 ) for each machine room required dimensions compressed air station: h 180 x w 130 x d 100 cm dimensions receiver / dryer station: h 210 x w 90 x d 180 cm technical specification: number of compressors set of 2 compressors treatment stations at 60% sim. 50 / 60, at 100%. 20 / 30 voltage v 400 / 3n / pe / ac frequency hz 50 60 rated current a 22.5 / 25.5 power consumption kw 8.6 – 10.7 kw fuse a 40 characteristic c / d according to en 60898 electrical connection ø mm² 6 the diameter of the power cable must take into consideration the voltage, length of cabling and the local situation. rpm min 1500 interference according to en 55014 1: 2003 09 jamming resistance according to en 55014 2: 2002 08 protection type ip 20 protection class 1 sound levels db ( a ) 91 without silencing cabinet duty cycle %ed 100 net weight: kg 535 without silencig cabinet start up pressure bar 6 / 6.5 / 7 switch off pressure bar 7 / 7.5 / 8 *adjustable using a key operated switch safety valve bar 10 tank volume l 500 performance at 5 bar l / min 1133 / 1280 temperature range in operation +10 to +40 °c ( ideal +25 °c, with regard to life cycle of compressed air station and build up of condensation ) storage and transport 10 to +60 °c relative humidity in operation max. 70% relative humidity storage and transport max. 95% ( without condensation ) compressed air outlet connection g1 internal threading central air suction connection dn 70 condensate connection dn 50 condensation volume 150 210cm³ per condensate drain cycle, depending on temperature and relative humidity required room ventilation m³ / min 30 dimensions p 6000 ( h x w x d ) compressed air module cm 180 x 130 x 100 with silencing cabinet cm 210 x 140 x 125 tank module cm 210 x 90 x 180 required distance between the tank and the compressed air module ca. 30cm total required space ( including access ) cm 210 x 400 x 300 supplier has to connect the compressor to dental chairs. turn key basis. , compressor 1.0 h.p. oil free imported head ( with indian tank ) silent oil free air compressor which produces super clean airflow and gives you a very comfortable low noise, working easy to operate and safe to use, oil free imported head with double pistons compressor with indian tank supply voltage 220v ac 50hz, electric current 24a, frequency 550w, power 70l / min, capacity 0.8 mpa, discharge noise 56 65 db , compressor head noise less ` , condensor ( round ) , conebeam computed tomography ( cbct ) extra oral x ray system for dental 3d imagine including dedicated 2d pan & 2d ceph modalities hardware should have bitepiece, chinrest ( for opg, tmj, sinus ) sub nasal support, temple support chin support and 3 laser light for easy & comfortable patient positioning of standing and wheel chair patients. the unit should acquire images with 360 degree rotation for 3d. should have color touch screen graphic user interface ( minimum 10 inches or more ) for program selection & to indicate the system stats for easy operation with patient facing the operator. should have scout view facility for 3d examination. unit should have separate sensor for pan & a separate for cephmodality. should have multiple fov with diameter & height of minimum 6x6 cms to 15x18 cms or more ( choice of 8 or ore fovs ) . should have minimum 75 micron voxel size & up to 400 microns for larger fov. should have x ray generator with range of 60 90 kv and 2 16 ma. should have focal spot size of 0.5 mm according to iec 336 or less. should have 3d sensor of flat panel amorphous silicon technology or ccd / cmos. should have ccd / cmos sensor for 2d pan imaging. should have ccd / cmos sensor for 2d pan imaging. should have multiple pan examination and including full opg, half opg ( left & right ) bitewing , maxillary sinus ( lateral & pa ) tmj scan ( lateral & pa ) . should have multiple ceph examination and including ap & pa ceph, lateral ceph, submento vertex scan should have various 3d programs including high resolution endo volume ( 4x4 cm or smaller ) implant volume ( 10x10 cm ) craniofacial volume ( 16x18 cm or larger ) etc. mar application software should have user specific area cross section planning curved / liner should have presets for multiple 3d rendering 3d clipping / cropping facility from all views ( front back / right left / top bottom ) variable cross section thickness should be available facility to see volume in 2d coronal, sagittal and axial view in single windows text drawing, distance & angle measurement overlay facility on images should be available should be possible to do implant planning in the same software. customizable report layout with facility to store different report formats should be possible. should have facility to convert dicom into stl format. should have dicom print facility in the software. viewer file generation should be possible in the software other essential requirements suitable computer with following specs processor intel i7 9th gen or higher ram 16 gb 1tb ssd dvd writer drive keyboard & mouse monitor 24 inch full hd with hdmi input graphics card ati radeon rx 570 with 4 gb ram or equivalent original operating system windows 10 pro 64 bit online ups for units & computer minimum 5 kva with 10 mins. backup. suitable dicom printer with 1 online tray and >300 dpi print resolution. should provide 100 films of size 8x10 all the equipments supplied including printer should be new and not refurbished & manufactured not before tender publishing date. warranty / guarantee of cbct unit for 5 years from the date of supply unit should have valid aerb type approval with validity before tender publishing date. should quote for amc / cmc for 5 years after warranty period should provide order copy of quoted model in any reputed governments institute. the order should not be older than 3 years from the date of tender publishing date. , cord packer ( serrated and non serrated ) , cordless led light cure light cure unit type with cooling 1300 m / w / 59 cm. with 4 cooling modes ( ramp fast, long & plux ) powerful lion battery 4000 sec.work , core carrier thermoplastic obturation system obturation system to obdurate root canal using warm compaction with core carrier , coss bar elevator , cotton holder , cotton waste reciver , coupland elevator , coupling with nozzle for airotor h.p. 2 hole. , cow horn forceps upper , cow horn forceps lower , crimpable hookplacement plier , cryer elevator , cumine scaler , curette lucas ( small ) , curette molt ( medium ) , curettes –universal and gracey no. 1 to 14 ( hu friedy / medsey / equinox ) , d s carver , debonding plier , deflasking press ( 095 050 ) , demonstration models: partially dentate model jaws for prosthetic exercise: upper class i class ii class iii mod.2 class iv lower class i class ii class iii mod.2 class iv , dental air polishing unitwith both 27 micron and 50 micron sand • water supply pressure 0.2mpa 0.4mpa • air supply pressure0.2mpa 0.3mpa • max water spraying: 0.2ml / s • max sand spraying: 0.03g / s compatible with both 27 micron and 50 micron sand , dental chair pediatric dental chair •body contoured electrically operated zero programmable chair ( optional multi programmable ) •sensor operating light with two intensity. •chair porcelain spittoon •vacuum suction : high & low •chair mount unit modular delivery system hanging cords. •airotor two points •choice of hand piece : titanium cellular optic fiberoptic, ultrapush. super torque, miniature & standard •micro motor : mighty 35000 rpm / •three way syringes two nos. •x ray viewer •multi functional foot control , dental chair .electrically operated dental chair mount unit 1. electrically operatedmicro processor based multiprogrammable dental chair. 2. the chair should have erasable programs with microprocessor controlled, where doctor can set his ownprograms.the program switch should befitted to the instrument tray.program 0andgargling. 1 & 2 erasable program 3. body converging movement head rest of chair automatic motorized up & down movement for perfect adjustment having switch at the end for stopping 4. the right side arm of the chair has lateral rotation for easy access of the patient. chair mount unitfitted with: at 80 cm distance + 15% a ) led light with 3 intensity with 3 axis movement, 40, 000 to 45, 000 lux , maximum power consumption should be 4 to 6 watts. • on / off by sensor switch non touch • 3 step intensity control by non touch sensor b ) auto water connectionfor spittoon and tumbler. basin should be fabricated out of non rusting aluminum metal plastic with painting a ) stainless steel instrument tray for keeping instruments. b ) led x ray viewer c ) monitor mounting arm with the integrated wiring f ) high & low vaccuum motorised suction: noise free, which consists of high vacuum and lowvacuum with flow control valve with auto start.the fluid collection containerhasauto drainsystem and also auto flush system.amalgam collection filter. modular ( delivery systemover patient ) fitted with: a. airotorcontrol only i ) micromotor ( kavo / nsk / sirona / w& h ) micromotorbrushless speed range 2000 40, 000 rpm.with digital display of speed should be supplied with: i ) contrangle handpiece –autoclavable speed 40, 000 rpm1 no ii ) straighthandpiece –autoclavable speed 40, 000 rpm 1 no c.3 way syringe for air , water & spray 2 nos one for doctor and one for assistant zero back ache stool :should be most latestsurgical stool having raising and lowering by pneumatic piston with chromium plated legs. back rest should move forward and backward along with the body by pneumatic piston and it should give support all the time.the seat should have a piston to move with the body when a surgeon leans forward. , dental engine for clinical work , dental engine for laboratory work , dental implant maintenance kit along with plastic coated scaler and / or plastic / teflon coated curret set , 2 ) dental implant systemthe complete kit with instruments &implants and physiodispensorwith handpiece 2.1 secification for dental implant instruments • complete implant surgical kit • 2.00 mm sharp point internally irrigated pilot drill. • sequential width increasing drills with internal irrigation • drill extension with internal irrigation • surgical ratchet / wrench with adjustable torque 2.2 specification for physiodispensor along with handpice. • main unit should be capable of independent control • should be possible to switch motor on / off from main unit without touching foot switch. • should be possible to switch pump on / off form main unit without touching foot switch. • foot pedal should have dynamic speed control • variable large settings from 5 60 n cm should be available • 20:1 torque controlled implant surgery handpiece 2.3 threded inplants and coated implants. , dental lathe machine * hp 1 / 2 * rpm 2800 * equipped with double ball bearing, single speed, continuous rating, three chucks ( buff, bur chuck, shone ) , dental tweezers rust proof, with serrated working end , dentist stool low back support, physiologic stools , dfs ceramic brush no 6& 8 , dfs pindex system , dfs ring less system , dg 16 endodontic probe , digital auto pipettes fixed volume ( autoclavable ) ? volume10 micro liter ? accuracy + 0.9% ? precision 0.4 cv% , digital auto pipettes fixed volume ( autoclavable ) ? volume20 micro liter ? accuracy + 0.9% precision 0.4 cv% , digital auto pipettes fixed volume ( autoclavable ) ? volume 50 micro liter ? accuracy + 0.6% precision 0.4cv% , digital autopipetes fixed volume ( autoclavable ) ? volume 100 micro liter ? accuracy + 0.3% precision 0.3 cv% , digital autopipetes fixed volume ( autoclavable ) ? volume 1000 micro liter ? accuracy + 0.3% precision 0.3 cv% , digital magnetic hot plate stirrer sku la.ma.1579767 type of product digital magnetic hot plate stirrer max. stirring quantity ( water ) ( liters ) 3 ltr voltage 100 120v ac / 200 240v ac dimension of top plate ( mm ) 5 inch motor rating input / output ( w ) 5w / 3 w speed range ( rpm ) 100 1500 rpm speed / temperature display led top plate material stainless steel with ceramic coated hotplate heating power ( w ) 500 w temperature range 5 40°c dimensions ( wxdxh ) ( mm ) 150x260x80 mm frequency 50 / 60 hz control accuracy of heating temperature with pt 1000 ±0.5 external temperature sensor pt 1000 weight ( kg ) 1.8 kg protection class acc. to din en60529 ip21 power 515 w , digital multichannel pipettes 8 channel 12 channel , digital x ray single drawer printer for opg machine having true laser technology with minimum 250 laser pixels per inch. 50 100 micron laser spot spacing, with 64 bit pixel depth architecture. through output of minimum 50 100 sheets per hour ( size 8x10, 11x14, x10x12 ) printer should be small in size. compatibility with all kind of dicom file for printing. fast printing and compatible for opg, cbct, ct, mri machine , dingmann’s retractor ( pedo ) and blade , diode laser unit wavelength 810 / 940 / 980 nm power 0 to 7 watts , dippen dish , dissecting scissor straight 4” , dissecting scissor straight 6” , dontrix gauge upto 16 oz. markings, autoclavable and grooved markings, calibration in oz. and gms. , double disk model trimmer with diamond disk, carborandum disk and model trimmer with diamond disc and carborandum disk •?should have approximately hp 1 and 2800 rpm •?should be ergonomically designed, heavy duty, low noise, single speed •?should have diamond wheel size 10” •?should have automatic water valve with water spray attachment and splash shield •?should have orthodontic work table complete •?should have foot switch •?should have provision of both dry / wet trimming source: indigenous / imported. , dressing drum ( medium ) 11”x9” for autoclave , dressing drum ( small ) 9”x9”for autoclave , duplicating unit , duplicator equipment , electro cautery monopolar generator frequency 500+25 khz cut control . scale pure 375 + 10 w.500 o load.cut control full scale blende 250 + 10 w. 500 o load coag continuous blending through hemostasiscontrol 125 + 15 w bipolar genearator ( frequency 650 + 25khz ) output level 70+5 w. 125 o load power 230 v +5 % 50 hz size 480x290x180mm weight 15 kg applications : for all type of major surgery includes under water cutting t.u.r &for bipolar micro coagulation, ce / iso certified , electro phoresis system vertical and horizontal gel electrophoresis the system should use disposable sample applicators for applying the samples using capillary action. samples should not be directly applied on gel by pipette. the system should be able to use agarose gel as matrix for migration with capacity to process 7 samples at a time. the system should be manual electrophoresis system. the system should be able to perform a test menu of serum proteins, lipoproteins, haemoglobin’s in acid and alkaline ph, iso enzymes of cpk, ldh and alkaline phosphatase, high resolution proteins, serum and urine immunofixation. electrophoresis tank should have platinum electrodes. the system should have incubator dryer for fixation of proteins eliminating the need of acetic acid fixation. system must have the latest software which should be windows xp compatible for complete data control, graphics, graph corrections. graph overlay and history recall. patient reports should be printed out with electrophoretic graph and pattern. patient search, input and archives. it should have good q.c functions. software should be compatible with the gel scanner. software should be able to store upto 100, 000 electrophoretic curves and upto 4000 immunofixation reports. software should have bidirectional lis capabilities. power supply for the electrophoresis system should be programmable with a memory of 6 programs. voltage range should have be ranging from 5 – 300 volts for the power supply of electrophoresis system. current range of 0 – 200 ma for the power supply for the electrophoresis system. power setting of 0 – 60 w for the power supply for the electrophoresis system. the electrophoresis power supply should have 2 outputs 2 connect 2 electrophoresis tanks simultaneously. the electrophoresis system should have an electrophoresis chamber without paper wicks and the gels should dip directly in the buffer for direct contact. tank should have safety lock. the incubator – dryer of the electrophoresis system has tangential air flow for the fast and homogenous drying. the incubator dryer of the electrophoresis system has temperature settings of 37° c, 51° c & 80° c. the electrophoresis system comes with complete gel accessory kit with 5 vessels with cover, 3 double gel holders, vessel support and 2 incubation boxes , electronic needle destroyer , electronic orthodontic spot welder & solderewith variable welding power control having optimum electric adjustment of welding pulse at all welding currentstrength. complete with hand electrodes solder holding device with power rating 300 va pulse current 1000a, to work on 220 260 volts 50 , elevator periosteal , elevator warwick james curved , elevator warwicks james straight , emergency medicines kit , enaemal hatchet , enamal tray , endo block endodontic file rubber stop length measuring device during root canal treatment , endo box autoclavable box for holding endodontic instruments , endo instrument removal system system used to retrieve the separated instruments from root canals , endodonticnegative pressure ( vacuum ) irrigation system system to irrigate root canal in which negative pressure ( vacuum ) pulls micro particles out of the root canal system , endodonticsilver pointsretrieval forceps ( stiegitz plier or like ) forceps to retrieve silver points from root canals , endodontic microsurgery kit having the following: • b.p. handle • periosteal elevator • surgical curettes • endodontic excavator • root canal pluggers • tissue holding forceps • needle holder • surgical scissor • micro mirror • plugger / condenser • burnisher • plastic / placement instrument retractor , endodontic operating microscope • # floor mount sturdy heavy stand for counter balance and castor wheels with lock • # led illumination ( minimum 100k lux ) through fiber optic and controls within reach of operator • # apochromatic stepless ( zoom 6:1 ) magnichanger with provision to change to step magnification. magnification from 0.4x 2.5x • # magnichanger carrier with electromagnetic clutch system for positioning view head angle at desired angle. single hand / button operation user friendly for left or right hand controls • # ergonomic inclinable observation head, preferably 0 degree to 210 degrees • # green, blue, heat absorbing in built filters • # swivel arm and suspension arm with movement locking knob • # common main objective must be a variable f, preferably 300 to 400 • # f 170 binocular viewing tilting head with wide field eyepiece 10x and 12.5x, focusable • # double beam splitter with extension for sitting comfort and dual iris # along with inclined beam splitter with dslr camera adapter with latest dslr camera and led monitor , endomotor with handpiece with rotary and reciprocating motion, torque control, multi programmable capability, auto reverse feature. , excavator spoon shape , ext.tooth forceps ( lower anterior ) , ext.tooth forceps ( lower molar ) , ext.tooth forceps ( upper anterior ) , ext.tooth forceps ( upper molar ) , extra oral cassettes with intensifying screens ( conventional &rare earth ) , `forceps mosquito 5” , formalin chamber clear, 15 ltr. capacity with 3 level trays , fox plane , galveno coping unit , gas torch adjustable flame size, butane refillable, melts solder, gold solder, gas volumne:min 35ml, n, w:min 120g, flame tempreture 1300 / 2450f, with function of locking fire, electronic ignition , gear for nsk nac e contra angle hand piece , gigli saw holder , gigli saw wire , glass slab , goldman fox probe , heavy wire cutter with tungsten carbide tip , hilton sinus forceps , histopathology slide storage cabinets pathologic biopsy slide storage cabinet with distinctly separated shelfs for individual slide ( woodenor plastic or metallic ) external dimension:405mm ( l ) *478mm ( w ) *375mm ( h ) , including three units, each unit contains 6 large drawers, each large drawer contains 2 strips spcc stainless material, thickness 0.8mm cold rolled sheet. ( approx features; few alterations is acceptable ) total capacity: approx.10000 slides , histopathology wax block storage cabinets wooden with slots in separated divided drawers for proper placement of waxblocks total capacity: approx.10000 blocks , hot air drying cabinet , hot air oven , howarth’s periostal elevator , hydraulic bench press × working pressure 200 atm × test pressure 400 atm ×with pressure relief valve , hydro solder unit compact with maximum gas production up to 80 1 / b main connetion voltage 230 u / 50 hz 2 1 reactor and nickel electrode no necessity for changing electrodes. through compliance with safety regulator , i.o.p.a. x ray machine compatible to rvg with following features on wheel / wall mounted aerb approved, safety feature as per aerb norms focal spot 0.7 mm / or less tube current 60kv – 70 kv wall mounting / mobile, floor standing dual installation layout : remote ( close to the unit or outside the treatment room ) or integrated to the unit automatic / manual time setting, film or digital mode syncronisation link with rvg systems, collimators ( size a, b, c ) long cone ( 30 cm / 12in ) soft positioning arms for accurate tube positions lightness and flexibility in the movements head tube and cone are insernally lead coated to avoid scattered radiation high voltage generator with high efficiency in the emission of the x rays digital control equipped with an easy ready display indicating with precision the selected timeexclusive angular indicating system for head positioning in various radiographic techniques high efficiency and greater sharpness of the radiography, shorter exposure time and greater safety double pantographic arm with vertical and horizontal smooth movements , illuminated mouth mirror & probe , induction casting machine , injectable gutta percha obturation system with downpacking and back filling ( 23 and 25 gauge ) capabilities. , injection moulding flasking unit , instrumenttrolly ( cross ) , instrument cabinet , instrument trolly ( side ) , intraoral camera with display system sensor micron 1 / 2.5 cmos 2592 ( h ) x 1944 ( v ) video resolution 640 ( h ) x 480 ( v ) image resolution 1024 ( h ) x 768 ( v ) focus range 1 mm infinity angle of view 90° field of view 80° focus autofocus light source 8 white led array video output usb 2.0 tv ntsc tv pal s video vga wireless technology wifi transmission range 10 m , iontophoresis unit for treating dentinal hypersensitivity , kidney tray large , kidney tray small , kocher curved forcep 8” ( large size ) , kombi duplicating flask plastic , lab centrifuge revolutionary microprocessor lab centrifuge with brushless induction motor and frequency drive. digital display of speed & time stepless speedregulator 0 60 min digital count down meter. imbalance detector safety lid interlock to prevent cover opeing during centrifugation. max speed: 5250 rpm max rcf: 3600 g max capacity: 400ml supplied with 24x1.5ml rotor head temp and humidity controlled with digital display , lab micromotor a. with heavy duty handpiece b. corbon bush less , lacrimal probes , laryngoscope with all side blade 4 different size for standard blades 1 handle for pediatric & adult seapartely & 1 short stubby handle, ss made finish curved blades for adult & pediatric, should be provided with battery, should provide spare bulb 6 nos. , laser pointer bluetooth enabled with slide change tool , lead apron –doctor for protection of operator from radiation exposure , lead apron patient for protection of patient from radiation exposure , lead gloves , lead screens , led x ray view box , powder coated ms cabinetwith aluminium frame 14 inches x 17 inches , ligature cutter with tungsten carbide tip , light curing unit, plasma arc 75 watts, 12v tungsten halogen lamp. calibrated automatic timer from 10 to 60 seconds. autoclavable fiber optic probe, 115v 60hz or 230v 50hz ac , light wire plier with tungsten carbide tip , l retractor ( medium size ) langenback , l retractor ( large size ) langenback , luxator set for dental extraction , magill’s forceps , magnifying glass , marquis color coded probe , matrix system ( sectional ) ( palodent or like ) used for building proper contacts between teeth , mc call’s curettes , mekontosh sheet , metal grinder , metal saw with handle 6 inch and 12 inch , micro needle holder , micro scissor , micro surveyor , microsurgery / oscillating saw hand piece specification 1.8 mmreciprocating 3:1 reduction h. piece with external spray nozel max. speed – 12600 strokes / min. with blades ( packet of 10 each ) 1. 10 mm x .35 mm thickness 2. 20 mm x .35 mm thickness 3. 30 mm x .35 mm thickness 17 oscillating 3:1 reduction h. piece with external spray nozel max. speed 12800 strokes / min with blades 1 each 30 mm x ( .3 mm x 10.5 mm x 6mm ) 45 mm ( .3 mm x 10.5 mm x 6 mm ) 30 mm ( 15.5 mm x 6.5 mm x .3 mm ) 45 mm ( 15.5 mm x 6.5 mm x .3 mm ) 30 mm ( 15.5 mm x 9.2 mm x .3 mm ) 45 mm ( 15.5 mm x 9.2 mm x .3 mm ) 3” sagital saw 3:1 reduction with external spray nozel max. 12600 strokes / min blade packets of 10 each ( 25 mm x 6 mm x .3 mm ) , millers apexo elevator ( paired ) for tooth extraction for tooth extraction , mouth gag a. heister mouth gag b. fergussons mouth gag , mouth mirror , mouth mirror handle , mouth mirror top , mouth prop , naber’s probe , nasal hood for inhalation , needle holder 4” , needle holder6” , needle holer 8” , nerve retractor , nerve stimulator , newman’s probe , nitrous oxide oxygen inhalation unit technical specifications it should have table rigid ( trolley ) m.s. / aluminum structure duly electro statically powder coated. capacious double decker drawer for keeping necessary accessories rust free castors with brakes in front for easy mobility. stainless steel table top to keep necessary accessories. flow meter bank of nitrous oxide: 1 7 ltrs. / min. flow meter bank of oxygen: 1 10 ltrs. / min. a maximum total flow> 17 ltrs. / min. precise flow min 0.5 ltr, n2o: 0 70 %, 02:30% 100% o2 / n2o panel / yoke mount pressure gauges for cylinder tank. 02 / n2o panel / mount pressure gauzes for line working pressure 2 nos. gas specific yokes to fix a type nitrous oxide cylinders. 1 no. b type oxygen cylinder platform, provision for central gas supply which can be attached to n2o yokes with pin index block type hose & o2 can be attached in quick release valve. standard breathing circuit 02 which is provided along with nasal mask. ( autoclavable ) patient outlet link: 15 / 22 mm bag tee with emergency air valve. nitro lock basic safety against accidental delivery of nitrous oxide when oxygen meter is closed. oxygen failure warning device. ( o.f.w.d. ) nitrous oxide failure warning device. ( n.o.f.w.d. ) additional in built regulators should be provided for both gases to prevent excess pressure coming from main regulators or central gas supply in built excess pressure relief valve on main regulators. o2 quick supplement not less than 17 its. min. t safety valve with bag tee. std. silicon tubes ( fresh gas inlet & excel gas tube ) ( auto clavable ) with connector. 10 each nasal mask ( small, medium & large ) 02 mox regulator with conversion kit & combination spanner for b type cylinder 01 set flush type spanner for n2o pin index a type cylinder 01 each. seal bodak washers for n2o yokes. approximate dimentions : ( h ) 1100 mm ( w ) 510 mm ( d ) 610 mm , o ring for water booster cap , omega loop forming plier , optical spectroscopy instrument for oral cancer detection , orbans periodontal knife , orthodontic micro implant kit with sizes of implant from 008 to 012 10 implant each, implant driver 1 palatal, 1 universal, 01 punch drill, 01 guide drill with autoclavable implant kit box , otlight ( led ) halogen ot light ( single dome and double dome ) • single dome ceiling mounted halogen light • epoxy coated fibre / metallic single dome size 525mm • dichroic coated glass reflector • shadow less cold & white high intensity light with colour corrective filter glass to minimize heat. • spring balance control system • halogen lamp 24v, 150w with optional secondary lamp with auto switch on to reserve bulb within 5 seconds in case main lamp fails • lux output 1, 10, 00010% • field size 200 250 mm diameter • sterilizeable focusing adjustable detachable handle made of brass • 260 & 31 arm movement • dome tilting angular 45, lateral 60 • power supply source auto cut transformer / cvt with intensity control • input power supply voltage 170v 260v for double dome model also, as above , oxygen cylinder large ( jumbo with mask connection ) made of high quality strength aliminium alloy with heat sensitive coating & approved by and certify by deptt.of explosive nagpur, dot 3 al 2015 standard , should have valve safeguard, color code as per is : 3933 1966 / iso with all updating, valve should be as per is: 3745 1948 , palatel trimmer , paquette blade handle , parrallelogram condensor , pentahead microscope 01 , perforated impression trays , periodontal probes – unc 15, goldman fox probe , periodontal surgeryinstrument set a kirkland periodontal knife 15 / 16 , no. ( hu friedy / medsey / equinox ) b orbans periodontal knife1 / 2 no . ( hu friedy / medsey / equinox ) c bucks periodontal knife 3 / 4 , 5 / 6 no. ( hu friedy / medsey / equinox ) d.krane koplan pocket marker ( hu friedy / medsey / equinox ) f tissue nipper ( hu friedy / medsey / equinox ) g cumine scaler ( hu friedy / medsey / equinox ) h mallet ( hu friedy / medsey / equinox ) i oschenbain chisel ( hu friedy / medsey / equinox ) j schluger bone file 9 / 10 ( hu friedy / medsey / equinox ) k sugerman file 1s / 2s, 3s / 4s ( hu friedy / medsey / equinox ) , phantom lab unit ( pre clinical work station ) phantom table fitted with halogen operating light phantom head body type neck joint for all the movement, tmj movement. modular with air rotor, micro motor with contra angle hps, 3 way syringe, jaw with ivorine teeth, preferably soft gingival, dental operator’s stool ( not to use extracted or cadaver teeth ) . , photographic intraoral mirror ( front surface ) , piezon ultrasonic scaler with 7 tips model p3ii ( with digital display ) power selection modes. turbo for fast removal of hard calculas & tarter scalling for scaling perio for using endodontic kit. , piezotome unit 1 hindpiece, set of 6 bone surgery tips, set of 5sinus lift tips, set of 6 power periotome tips, set of 5 intrlift tips, 1 large sterilizationcassette, 2 sets of autoclavable tubing and 20 irrigation bag spikes , pindex system , plain screw driver 1.5mm , plain screw driver 2.5mm , plain screw driver 2mm , plaster dispenser •?should have a capacity of 20 30 kgs •?should be wall mounted •?should have a stainless steel body •?should have inside rubber container to prevent dispersion of dust in the environment •?plaster should be protected from humidity and other polluting elements •?should dispense plaster in dusty powder form •?digital electronic timer preferred. , plaster spatula , pneumatic chisel , polishing lathe , pontic formers anterior & posterior u.& l. modules , posterior band removing plier , potts elevator , pre heating furnace , pressurised local anaesthesia system , probes right angle , pulp tester ( digital ) , pulse oxymeter with audiolum , punch biopsy set , radiographic film storage lead containers , radiographic filters ( conventional & rare earth ) , radiometer for measuring light intensity at various wavelengths , real time pcr system the system should haveinbuilt gradient 96 well peltier based block capable of accommodating 96 x 0.2ml plates, tube strips and individual tubes system should have provision of being used as conventional gradient pcr system should have inbuilt touch screen display and option for controlling through computer system should have scanning optics with 6 filtered leds as excitation source and 6 filtered photodiodes / ccd camera as detection. system should not require any periodic calibrations system must be capable of multiplexing 5 targets in a single well system should have a channel dedicated for fret analysis excitation / emission wavelength range: 450 730nm the system should have inbuilt gradient range from least 30°c 100°c with gradient differential range of 1 24°c and capable of running 8 different temperatures or more the system should have maximum ramp rate of at least 5 °c / second or better block temperature range: 0 100°c, uniformity ±0.4°c and accuracy ±0.2°c the instrument should have dynamic range of 10 orders of magnitude or better the system should include software to support applications like relative quantitation, normalized expression with multiple reference genes should be supplied with high resolution melt analysis software software should have option for setting up the plate before, during of even after real time pcr is complete software should have reference gene selection tool for information on which reference genes are likely to be expressed at consistent levels in samples during the run software should have option for performing allelic discrimination, t tests, and one –way and two way anova software should have provision for automatic data analysis for multiplate studies ( unlimited cq values ) software should have following data visualization options bar charts, dot plots, box whisker plots, scatter plot, clustergram, volcano plot software should be able to generate data graphs in jpeg, png or bitmap format as per user selected image size and resolution system should have option for upgradation to 384 well block if required in future system should be supplied with starter kit ( hard shell 96 well low profile, full skirted plates 50nos, sealers 100nos and sybr green supermix 200rxns ) system should be supplied with compatible computer and 2kva online ups with 30mins back up , reverselangenback , rib cutting forceps and rib shear adult , rib cutting forceps shear child , rubber bowl small , rubber bowl large , rubber dam kits , rubber moulds for casting plaster study model upper & lower edentulous ridgesfully denture ridges , rubber moulds for casting plaster study model upper & lower individual tooth , rubber moulds for casting plaster study model upper&lower 1. edentulous ridges 2.fully denture ridges , rvg rvg is a digital imagin system, which allow quick or immediate viewing of image without using dental x ray film, consist of an intraoral sensor or imaging plate, an x ray system, computer hardware and software for image processing, and a hard copy printer operational requirments rvg sensor and the computer system along with imaging software is required. x ray generator is not to be quoted technical specification a. rvg sensor system • should be based on cmos / aps / ccd • 8 30 lp / mm true image resolution • exclusive sensor with compelete software package including optical fiber technology. • plastic pack design to allow easy periapical and bitewing radiograph • usb cable preferably wireless sensor • three ( small, medium & large ) size to help meet the unique imaging needs of practice and patients. • thickness of the sensor should be 1 5mm. • sensor life should be more than 500000 exposures. • sensor active area should range from 450 1000 square mm for different sizes of sensor. • rvg / system software. 1.should be licensed. 2.should have facility for rvg well as intra oral camera. 3.should have automatic acquistion and save facility. 4.should have sharpening, cleaning and improving feature. 5.should have search facility by patient id name or any other criteria. 6.should be internet compatible. 7.should be capable of generation reports. 8.should be capable of avoiding accidental deletion. b. radiation protection accessories : lead apron, thyroid collar, gonadal sheath. c. computer hardware: 1.should be intel core 2 duo pentium pc with 160 gb hard disk, min. 512 ram. dvd writer, 17 inches lcd / tft monitor. 2.should have compatible color photo printer. 4. system configuration accessories, spare and consumables 1.system as specified. 5. environmental factors 1.the unit shall be capable of being stored continuously in ambient temperature of 0 50 deg c and relative humidity of 15 90% 2.the unit shall be capable of operating continuously in a ambient temperature of 10 40 deg c and relative humidity of 15 90%. 6. power supply 1. power input to be 220 240vac, 50hz fitted with indian plug 2.suitable ups with maintenance free batteries for minimum one hour back up should be supplied with the system. 7. standards, safety and training 1.should be fda, ce, ul or bis approved product 2.manufacturer should have iso certification for quality standards. 3.electrical safety conformsto standard for electrical safety iec 60601 1 general requirements ( or equivalent bis standard ) 8. documentation 1.user / technical / maintenece manuals to be supplied in english. 2.certificate of calibration and inspection. 3.list of important spare parts and accessories with their part number and costing. 4.log book with instruction for daily, weekly, monthly and quarterly maintenance checklist. the job description of the hospital technician and service engineer should be clearly spelt out. , rvg with sensor size 1 true image resolution 14lp / mm or less sensor resolution 27.03 1 / mm or less usb2 – high speed connection super cmos / ccd with optical fiber technology , s / s suction cannula tip 3no. , s / s suction cannula tip 4no , sand blasting machine for ortho use ( microetching, bracket recycling , sand blasting unit for orthodontic bracket recycling portable with pressure guage and starter kit , sandblasting machine , scanner scanner system for the fabrication of esthetic & functional dental restorations with following features: should work on the principal of contact scanning should offer fabrication of crowns, laminates, abutments & bridge for all indection & custmise if need be. cad / cam software with easy to use tutorials open design for unrestricted visibility & access should be able to detect undercuts. should be able to scan and produce coping and bridges in both alumina and zirconia should be able to scane and produce full mouth bridge upto 14 units. , schluger bone file ( interdental ) , schlugers bone file no.9 / 10 , scissor , semi automatic rotary microtome semi automatic microtome with stepper motor driven specimen feed. vertical and horizontal cross roller bearing mechanism to ensure accurate reproducibility of section thickness. section thickness selection from 0.5 to 100um. section thickness range : 0.5um 100um increment 0.5um 5um in 0.5 um increment 5um 20um in 1um increment 20um 60um in 5um increment 60um 100um in 10 um increment trimming thickness setting from 1um to 600 um with step rim function. programmable retraction of 5um to 100 um in 5um. retraction can be deactivated when not required two forward and backward coarse feed speed and electric coarse feed at 300um / s and 900um / s. sectioning modes: 2 continuous and rocking mode should have rocking mode action of sectioning to minimize the risk of developing repetitive motion disorders ( rmd ) . horizontal feed of 28 mm via stepper motor and vertical stroke length of 70mm visual and acoustic remaining feed indication specimen orientation of 8 degree both horizontally and vertically section counter and section thickness totalizer all controls on the instruments with external control unit disposable blade holder with lateral displacement one hand operated universal cassette clamp and magnetized section waste tray. , sialandoscope , sialography cannula , sickle explorer 17 / 23 ( hu friedy / medsey / equinox ) , smith spreader , soft tissue diode laserspecification; 810 to 980 nm wavelength wattage 7 10 watt continuous wave, with fiberoptic tips , specifications of high speed refrigerated centrifuge maximum speed ( rpm ) 26, 000 to 29, 000•maximum rcf ( x g ) 70, 000 to 100, 000 •maximum capacity ( tubes x ml ) 6 x 1000 in swing bucket or fixed angle .•drive motor: high torque brushless high frequency motor •imbalance tolerant drive•temperature range must be ( °c ) : –10 to +40 •controls: microprocessor based, touch screen interface ( can be used with gloved hand ) . memorybased programmed operation 30 programmed operations possible. •acceleration / deceleration profile: nine stage variable acceleration. nine stage braked deceleration, • plus free decelerationrefrigeration system : cfc / hcfc free with 5 year non prorated warranty•run time : 99hrs; hold•programmability : 30 programs or more•actual run timer•temp. control accuracy : ± 2°c of set temperature •speed control accuracy : ± 20 rpm•s peed control range : 100 to 26, 000 rpm or 500 to 29, 000rpm •machine should be compatible with continuous flow operation ( for future upgradation ) •rcf calculation rcf integrator, rtc ( real time control ) , over speed detector facility •automatic rotor lock / self locking system •automatic rotor identification system •ambient temperature for operation: 2°c to 40 °c •non contact imbalance protection•pre cooling chamber•power : 200 240 vac, 50 hz, 30 a, single phase •mandatory 2 rotors to be quoted with the specifications mentioned below. •should be supplied with suitable 10kva servo voltage stabilizer. •warranty: comprehensive 5 years on both machine and rotor from the date of installation directly• certified by the manufacturers.in addition during the entire warranty period 2 maintenance service visits by engineers is a must.•company should provide user list with email and phone numbers of orders placed in the last 2years. . the centrifuge must have an energy savings mode ( “sleep mode” ) to reduce power consumption up to 15% by turning itself off if idle after a period of time. the centrifuge must be able to satisfy culus and ce safety requirements without being bolted to the floor, to provide flexibility to relocate within the facility. required rotors: 1. fixed angle rotor 8x50ml rpm 25, 000 and above and rcf 75, 000 x g or above with polyallomer 50ml tubes and adapter for 10 ml along with tubes ( minimum 50 tubes of each volume should be quoted in main offer ) 2. swing bucket rotor 4x500ml rpm 5, 300 or above and rcf 6, 800 x g or above with adapters for 50ml conical tubes, 15ml conical tubes and mtp’s carrier. optional rotor: 1. fixed angle rotor 6x1000ml rpm 8, 000 and above and rcf 15, 900xg and above should be quoted along with pc bottles. all rotors should be quoted in main offer along with the centrifuge , spindle grinder , spinix vortex shaker compact, rugged construction heavy metal base and rubber feet prevent movements of the shaker during use choice of continuous and touch mode variable speed control maximum speed 3000 rpm spare cup attachment spare one hand attachment spare one hand insert spare micro tube insert , split cast system , spong holding forceps , spoon escavator , sprit lamp , ss tray dentulous kit set , ss tray edentulous non perforated , stereo zoom microscope specifications preferable make: olympus, zeiss or leica optical bodytrinocular body zoom ratio1:7 objective zoom range0.65 x – 4.5 x eye pieceswf 10x / 22mm ( high eye point super widefield eyepieces ) working distance100 mm interupillary distance adjustment55 mm 75 mm binocular head inclination of45 deg diopter adjustment+ / 5 diopter optical body rotation360 deg reflected and transmitted illumination volt input 220v / 50 hz top halogen lamp 6v 15 v adjustment brightness bottom fluroscent lamp 5 w , sterilization package b class, 50 liter steam sterilizer with vacuum dry system printer. • perfect sterilizer with vacuum dry system with lcd display • lamp light will be on when the door is closed • lamp light will be on when the heater is heating process • when sterilizing process start, sterilization display lamp light will be on • dry lamp will be on when drying process is started • during each processuser can choose to pass any one process by pressing the pass button • control panel : device to manipulate& control the sterilization process technical specification: rated voltage and frequency :ac 220v / 50 / 60 hz power consumption : 2.9 kw capacity of the chamber: 50l sterilizing pressure : 1.0 kg / cm2and 2.0 kg / cm2 ( + 20% ) sterilization temperature: 1210 c + 40 c and 1320+50 c protection type & degree for electronic shock b ) washerdisinfector. • the universal large capacity solution • three face connection for short programme durations • can take upto 11 transmission instruments per load • efficient cleaning and disinfection in a single closed system • interface for process documentation • thermal disinfection system • can be connected to liquid dispensing systems. • front loader with drop down door without baskets • freestanding appliance with lid can be built under in a run of units • fresh water system , max temperature 930c • electrical door lock • buzzer to signal end of programme • programme failure check • serial interface for process documentation c ) pouch sealer sealer for 75 & 100 mm size pouch rolls are mounted together above the sealer thermostatic contol perfect seal easy to handle minimum space d.table top distil water plant water purifier should beequipped with an automatic control thermostat with blocksystem to besupplied with: no. 1 detergent no. 1 container for the distilled water variousaccessories. e ) handpiece cleaner • safe for anybody to use • automatically purges excess solution from handpieces • automatically removes solution vapour from the chamber • economical, efficient and time saving • extends the life of handpieces • compact size and easily installed • professional handpiece maintenanceand lubrication system • maintains all handpiece brands • a fail safe maintenance solution for all dental handpieces f ) needle burner / destroyer: with automatic syringe cutter , sterlizer boiler a. small b. medium c. large , straight explorer , straight probe williamsprobe , sub gingival scaler , suction machine vacuum suction devices, noise level:65db, small size, light weight, silent and easy to install, dental suction with liquid drainage pump, mainly used in hospitals of all levels for suction of blood , sugerman bone file 1s / 2s, 3s / 4s ( hu friedy / medsey / equinox ) , supra gingival scalers set ( u 15 / 30posterior jacquet, cumine , sickle scalers ) , surgical loupe4x 4x zoom, working distance 18 inches ( 450 mm ) with titanium frame , surgical micromotor fiber optic having 200 40, 000 rpm, high torque with foot control, low noise and vibration free autoclavable micromotor . advanced torque calibration to automatically set optimum speed and torque for each individualattachment with high level accuracy. cellular optic light emission from the handpiece provides clear illumination of the target site to facilitate even faster more precise treatment. supplied with 20 degree angle hp straight handpice autoclavable 40, 000 rpm 20: 1 reduction handpiece for implant , surgical scissors , surgical trolly , surveying unit , suture cutting scissors , suture needle holder , table top distil water plant with accessories • water purifier should beequipped with an automatic control thermostat withblocksystem. to besupplied with: • no. 1 detergent • no. 1 container for the distilled water , three prong plier , tissue guard 40+a550 331, 4108 830 messal ( o.or. ) , toffle mere retainer , torquing keys one torquing plier and keys of 0.018 and 0.022 , torquing turret rectangular arch forming turret. slots marked indicating wire gauge .016 x .022, .017 x .025, .0215 x .028, .019x.025, .0215x.028. , toungue blade , towel clips5” , t scan occlusal analysis system , twizzer , u / l edentulous die metallic ( brass ) , ultra bone surgery unit ( piezosurgery ) piezosurgery unit with automatic feedback system for power control, handpiece interference indicator, working frequency for 24 29.5 khz, ce / isi aproved , ultra sonic instrument washer maximum 2 liter capacity with waqrning function b type , ultra sonic instruments washer ( 13 lt ) , ultra sonic scalersunit specification; piezotronic scaler28 to32 khz frequency. autoclavable handpiece total control is micro processed based control unit.sleek handpieces. the scaler is supplied withminimum3 tips , ultra sonic scalers inserts ( compatible with satellac scalers ) insert number – n1, n10x, n3 , ultrasonic cleaner minimum capacity 13 liters with mesh bucket , ultrasonic cleaner minimum capacity 5 litre , ultrasonic cleaner programmable with time adjustment & spare tray , ultrasonic cleaner for cleaning casting ( small ) , ultrasonic crown remover for removing crowns& bridges , ultrasonic retro preparation, endodontic and conservative inserts , ultrasonic scaler hand piece ( woodpaker ) , ultrasonography machine , universalplier , uv chamber s.s. chamber with 12 die pressed ss trays imported uv tube mounted on s.s. reflector emits uv light ( germicidal in properties ) , technical specifications: uv tube: 15w chamber size:23” x 13” x 8” weight: 12.0 kg. no. of trays : 12 ( 9 shallow + 3 deep ) door closing mechanism:magnetic gasket , uv vis d / b spectrophotometer optical design: double beam with sample and reference cuvette positions; czerny turner monochromator spectral bandwidth: 1 nm light source: xenon flash lamp, 3 year warranty detector: dual silicon photodiodes scan ordinate modes: absorbance, % transmittance, % reflectance, kubelka munk, log ( 1 / r ) , log ( abs ) , abs*factor, intensity resolution: >1.6 ( peak to valley ratio ) wavelength range: 190 –1100 nm wavelength accuracy: ± 0.8 nm ( full range ) ± 0.5 nm ( 546.11 nm mercury line ) wavelength reproducibility: less than 0.1 nm ( 546.11 nm mercury line, sd of 10 measurements ) scanning speed: <1 to 6000 nm / min; continuously variable slew speed: 31, 00 nm / min data intervals: 10, 5, 2, 1, 0.5, 0.2, 0.1 nm photometric range: > 3.5 abs photometric accuracy: 0.5 a: ± 0.004a;1a: ± 0.006a; 2a: ± 0.010a; ( 440 nm; traceableneutral density filters ) noise: 0a: less than 0.00015 a; 1a: less than 0.00050 a; 2a:less than 0.00080 a; ( 260 nm, rms ) drift: < 0.0005 a / hr ( 500 nm, 1 hour warm up ) stray light: kcl, 198 nm: less than 1% t nai, 220 nm: less than0.05% tnano2, 340 nm, : less than 0.05% t baseline flatness: ±0.0010 a ( 200 800 nm; smoothing ) keypad: sealed membrane local control display: touch screen lcd panel; 800 x 480; 17.8 cm ( 7 in ) diagonal with in built 300gb memory capacity. operating system: microsoft windows xp embedded dimensions: 62.2 x 48.6 x 27.9 cm ( 24 x 19 x 11 in ) l x w x h weight: 14.4 kg ( 32 lb ) electrical supply: 100 – 240 v, 50 – 60 hz, selected automatically; 150 w maximum next generation uv vis instrument with the latest technology to bring you the usability and performance you demand without added complexity features: ~ up to 100 hz data acquisition for single cell kinetics ~ complete line of peltier temperature control accessories ~ adjustable cell holder for optimum cell positioning ~ numerous accessories for liquid and solid sampling ~ performance verification and optional software and documentation for regulated laboratories user friendly s / w to do various orders of spectral derivative analysis. insight software features: ~ advanced fixed wavelength analysis with graphical data display and user defined limits ~ wavelength scanning application with advanced tools for peak analysis and spectral processing ~ next generation quantification package makes quantitative analysis straightforward ~ integrated calculations provide more data per measurement in quant ~ automated file export and e mail ~ seamless paper based reporting with user defined parameters ~ workbook and template scheme makes data organizationeasy ~ cue software for customized user interface and workflows includes: ~ euro / us power cords ~ single position cell holder ~ stylus for touch screen interaction ~ insight software for computer control of instrument and off line data analysis ~ usb memory device ~ power cord indian 250v , vaccum and pressure moulding unit single unit pressure and vaccum based with different sheet size adjustment, microprocessor based, programmable, starter kit and pressure gauges. , vaccum investment equipment , vaccum thermoforming unit for entire range of dental thermoforming ( kalabhai manufacturer erkodent, erkopress by pressure, erkoform rue by vaccum ) twin flask with compressor & key , spring loaded all in gun metal hanau type , vacuum cleaner , vacuum mixer , v bend forming plier , vernier calipers , vertical reciprocating endodontic handpiece endo hand piece with capability of attaching both latch type and hand endodontic files. capable of working with e type motor. , vibrator for eliminating air bubbles while pouring impressions, casting ring investments and duplicating molds. to provide a range in vibration, from low to maximum intensity. easy in operation and maintenance. featuring large suction feet for stability and a convenient power indicator light to show when the vibrator is on. • variable speed control knob. non slip table top , vita 3 d master shade guide , vita easyshade ( spectro meter ) , w h o probe , water distiller capacity 6 ltr. , water heater 10 litt. capacity , water retractive valve , water spray valve , wax carver , wax dipping pots × electronic controlled wax pots × four individual square containers × uniform temperature maintenance × physical characteristics of wax unaltered × 30`c 110`c , wax elimination furnace , wax knife , wax spatula , weingardt plier with tungsten carbide tip , whipmix arcon articulator with face bow for direct & indirect mounting , william’s periodontal probe , winter’s cross bar elevator , wire cutter ( double action ) , wire cutter for maxillofacial use , wire tucker , wire twister6” , x ray clip , x ray film, holder snap a ray , x ray hanger , x ray view box led x ray view box , powder coated ms cabinetwith aluminium frame 14 inches x 17 inches , mouth prop open and close serrated , metal suction tip , caries removal hand instrument smart kit , bite block , micromotor hand piece contra angle push button , electrical wax carver ( with 2 tips ) , 5 axis cad cam with hilling machine , flexible denture injection system , injection molding system , orthodontic software for cephalomatric with image manipulation software and surgical prediction for cbct images , slr camera : digital slr camera for intra oral use digital slr set w / body cap, lcd monitor cover, neck strap, en el3a rechargeable battery, mh 18a quick charger w / power wire, usb cable, video cable, software cd rom, rechargeable battery , 18 70 mm f3.5 4.5 g afs dx if –ed zoom lens , scandisk 1gb compact flash ( cf ) memory card, additional macro lens and filter, auto zoom flash compatible with camera, ring flash compatible with slr camera, light kit and backdrops for the studio , spinix vortex shaker compact, rugged construction heavy metal base and rubber feet prevent movements of the shaker during use choice of continuous and touch mode variable speed control maximum speed 3000 rpm spare cup attachment spare one hand attachment spare one hand insert spare micro tube insert , oralcdx oral brush biopsy painless oral brush biopsy in minutes. simply mail the slide & test forms in the prepaid mailer to cdx lab where specially trained pathologists analyze with assistance of advanced computer analysis. each oralcdx biopsy test includes a sealed, sterile biopsy brush, two fixative packages, a glass slide and slide holder, a prepaid mailer box, a test requisition form, billing and reimbursement information. ada accepted. includes 12 complete biopsy tests and instructions. manufacturer code: 12pk brand: oralcdx component ( s ) : complete mail in kit packaging: package of 12 complete biopsy kits , advanced research microscope with attachments infinity color corrected optical system per focal and per centric inverted image, 30° inclined sidentoff trinocular head, interpupillary distance: 50mm~76mm; splitting ratio r:t=100:0 or 20:80 or 0:100 high eye point wide field plan eyepiece pl10x25mm, with reticule, eye guard, diopter adjustable nosepiece ( with dic slot ) , septupletnosepiece ( for 7 nosepiece ) , and rubber eyecups ( pair ) . polarizer and analyzer biological frame ( transmitted ) , low position coaxial coarse and fine adjustment, coarse adjustment distance: 25mm; fine precision: 0.001mm. with coarse adjustment stop and tightness adjustment. built in 100 240v_ac50 / 60hz wide voltage transformer, intensity adjustable by digital set and reset led;built in transmitted filters lbd / nd6 / nd25 ) stage: mechanical stage, moving range: 75mm x50mm; precision: 0.1mm; two way linear drive, tension adjustable , stage micrometer, double slide holderslot for polarizer and analyzer plan achromatic 4x / 0.13, phase10x / 0.40, phase20x / 0.75plan flour 40x / 0.95, phase 40x, plan fluor100x, / 1.30 phase 100x. adjustment: integrated all metal high pressure die castingbody, precision transmission mechanism with pinion and rack. coarse focusing scope universal condenser forphase , dark field and bright field. transmitted illumination: 12v 100w halogen lamp intensity continuously adjustable, 100v 240v_ac50 / 60hz wide range voltage, lbd color change filter ( f45mm ) , immersion oil 8 ml, allen hex keys f2mm vinyl dust cover, universal power supply 05 unit 12v / 100 w spare bulb. epi – fluorescence attachment with sextuple reflected fluorescence illuminator with iris field diaphragm and aperture diaphragm, central adjustable; with filter slot and polarizing slot; with fluorescence filters, uv, fitc, tritc fluorescence filter. advance cooled camera for fl, bf, df and phase imaging. color: colorcooled two stage te cooling with controllable electric fan spectral range: 380 650nm ( with ir filter ) resolution: 9 micron ×9 micron, fps:30 data interface: usb3.0 / fire wire interface ensuring high speed data transmission; exposure time: 0.1ms~3600s, recording system: still picture and movie advance imaging software for measurement, multilayer focus, stitching, time laps imaging etc. compatible branded computer supply with above system. upgradable to fully motorize at any point of time. , microwave for ihc , cryostat technical specifications microtome section thickness selection 1 100 ?m total specimen feed 25 mm vertical specimen stroke 59 mm maximum specimen size 55 x 55 mm or 50 x 80 mm specimen orientation 8° ( x, y, z axis ) electric coarse feed, slow 600 ?m / s electric coarse feed, rapid 900 ?m / s refrigeration system 50 hz / 60 hz cryochamber temperature setting range 0°c to 35°c ( +3 k / 3 k ) cooling time down to 35 °c max. 6 hours, at 22°c ambient temperature defrost automatic hot gas defrost, 1 automatic defrost cycle / 24 hours, time controlled ( duration 12 min. ) quick freeze shelf maximum cooling 40°c ( +3 k / 5 k ) number of freezing stations 8 defrost manual hot gas defrost, time controlled ( duration 12 min. ) peltier element max. temperature difference 17k, at 35°c chamber temperature number of freezing stations 2 defrost in conjunction with the quick freeze shelf dimensions and weights width ( w / o handwheel ) 600 mm / 23.6 in width ( with handwheel ) 730 mm / 28.7 in depth 730 mm / 28.7 in height 1140 mm / 44.8 in weight ( incl. microtome, without specimen cooling ) approx. 135 kg / 298 lbs uvc surface disinfection 30 or 180 minutes, user selectable technical specifications subject to change without prior notice , hard tissue microtome section thickness range: 0 1, 000 ?m, adjustable in 1 ?m steps total horizontal specimen stroke: maximum 275 mm total vertical knife feed: 70 mm knife retraction ( during specimen return stroke ) : 0 1, 000 ?m clearance angle adjustment: 0° 17° knife declination fixed setting ( declination blocks = optional accessory ) : 45° maximum specimen size ( l x w x h ) : 250 x 200 x 70 mm specimen orientation ( along x / y axis ) : 4.8° along each axis specimen orientation ( rotation ) : approx. + / 3 and 90° sectioning speed: 0.5 100 mm / s, adjustable in 0.1 mm steps return speed: 0.5 100 mm / s, adjustable in 0.1 mm steps manual knife movement ( slow / fast ) : 37 mm / s and 74 mm / s manual specimen movement ( slow / fast ) : 37 mm / s and 74 mm / s electrical connections: nominal voltage: 100 / 120 / 230 / 240 v nominal frequenzy: 50 hz and 60 hz maximum power draw: 1, 400 va main fuses, type mda, fa. bussmann: 2 x t10a protective class: i overvoltage installation category: ii vacuum cleaner: 100 / 120 v maximum power draw 500 va vacuum cleaner: 230 / 240 v maximum power draw 1, 200 va lamp: 100 / 120 v maximum power draw 100 w lamp: 230 / 240 v maximum power draw 200 w dimensions and weights: microtome ( h x w x l ) : 250 x 390 x 750 mm control unit ( h x w x d ) : 220 x 385 x 510 mm required bench top space for microtome and control unit:1, 000 x 950 mm microtome: approx. 75 kg control unit: approx. 23 kg , tissue storing cabinet ( frozen ) , image analysis software image pro express , spinix vortex shaker compact, rugged construction heavy metal base and rubber feet prevent movements of the shaker during use choice of continuous and touch mode variable speed control maximum speed 3000 rpm spare cup attachment spare one hand attachment spare one hand insert spare micro tube insert , digital magnetic hot plate stirrer digital magnetic hot plate stirrer : 25k type of product:digital magnetic hot plate stirrer max. stirring quantity ( water ) ( liters ) :3 ltr voltage:100 120v ac / 200 240v ac dimension of top plate ( mm ) :5 inch motor rating input / output ( w ) :5w / 3 w speed range ( rpm ) :100 1500 rpm speed / temperature display:led top plate material:stainless steel with ceramic coated hotplate heating power ( w ) :500 w temperature range:5 40°c dimensions ( wxdxh ) ( mm ) :150x260x80 mm frequency:50 / 60 hz control accuracy of heating temperature with pt 1000:±0.5 external temperature sensor:pt 1000 weight ( kg ) :1.8 kg protection class acc. to din en60529:ip21 power:515 w , high speed refrigerated centrifuge maximum speed ( rpm ) 26, 000 to 29, 000•maximum rcf ( x g ) 70, 000 to 100, 000 •maximum capacity ( tubes x ml ) 6 x 1000 in swing bucket or fixed angle .•drive motor: high torque brushless high frequency motor •imbalance tolerant drive•temperature range must be ( °c ) : –10 to +40 •controls: microprocessor based, touch screen interface ( can be used with gloved hand ) . memorybased programmed operation 30 programmed operations possible. •acceleration / deceleration profile: nine stage variable acceleration. nine stage braked deceleration, • plus free decelerationrefrigeration system : cfc / hcfc free with 5 year non prorated warranty•run time : 99hrs; hold•programmability : 30 programs or more•actual run timer•temp. control accuracy : ± 2°c of set temperature •speed control accuracy : ± 20 rpm•s peed control range : 100 to 26, 000 rpm or 500 to 29, 000rpm •machine should be compatible with continuous flow operation ( for future upgradation ) •rcf calculation rcf integrator, rtc ( real time control ) , over speed detector facility •automatic rotor lock / self locking system •automatic rotor identification system •ambient temperature for operation: 2°c to 40 °c •non contact imbalance protection•pre cooling chamber•power : 200 240 vac, 50 hz, 30 a, single phase •mandatory 2 rotors to be quoted with the specifications mentioned below. •should be supplied with suitable 10kva servo voltage stabilizer. •warranty: comprehensive 5 years on both machine and rotor from the date of installation directly• certified by the manufacturers.in addition during the entire warranty period 2 maintenance service visits by engineers is a must.•company should provide user list with email and phone numbers of orders placed in the last 2years. . the centrifuge must have an energy savings mode ( “sleep mode” ) to reduce power consumption up to 15% by turning itself off if idle after a period of time. the centrifuge must be able to satisfy culus and ce safety requirements without being bolted to the floor, to provide flexibility to relocate within the facility. required rotors: 1. fixed angle rotor 8x50ml rpm 25, 000 and above and rcf 75, 000 x g or above with polyallomer 50ml tubes and adapter for 10 ml along with tubes ( minimum 50 tubes of each volume should be quoted in main offer ) 2. swing bucket rotor 4x500ml rpm 5, 300 or above and rcf 6, 800 x g or above with adapters for 50ml conical tubes, 15ml conical tubes and mtp’s carrier. optional rotor: 1. fixed angle rotor 6x1000ml rpm 8, 000 and above and rcf 15, 900xg and above should be quoted along with pc bottles. all rotors should be quoted in main offer along with the centrifuge , microbiology culture cabinets with digital controlled temperature and humidity and auto controlled timer to start and stop the process , wax dipping pots electronic controlled wax pots four individual square containers uniform temperature maintenance physical characteristics of wax unaltered 30`c 110`c , advance digital microscope with imaging software. optical system infinity color corrected optical system observation tube:seidentopf digital viewing head, 3.2 million pixels high resolution camera system: resolution ratio 2048*1536 pixels, line by line scan eyepiece: high eye point wide field plan eyepiece pl10x / 20mm, with ±5 degrees diopter control, ipd: 50 75mm objective:plan achromatic objective 4x plan achromatic objective 10x plan achromatic objective 40x spring plan achromatic objective 100x s, oil nosepiece:backward quadruple nosepiece illumination main supply 100v 240v, 3 watt led lamp or 6v / 20w halogen with intensity control ( fixed center ) focusing adjustment:coaxial coarse and fine focusing adjustment, with limited and tension adjustment coarse adjustment range: 25mm, fine adjustment precision:0.002mm. condenser: n.a.1.25 condenser ( with socket for phase contrast and dark field sliders ) stage:coaxial mechanical stage 140x132mm size and 76×50mm travel range. inbuilt microscopic scientific digital camera with imaging software consisting of: high resolution digital camera with 1 / 2” cmos chip usb 2.0 pc connection real time live image resolution: 3 mega pixels electronic shutter exposure time: 1ms 0.3s working temperature: 20°c ~ 70°c image analysis software: sportily calibration line measurements for distance, length, width, perimeter, angle, three point radius. area by enclosed line controlled by four arrow keys available on the keyboard arrow with zoomed preview the line measurement is not affected on zoomed images. identification of objects in an image, count them, obtain several features measurements. objects identification by user or automatically. user defined classification on basis of size or intensity. manual, auto bright and auto dark methods to identify intensity range defined object to be measured. various calculation & measurements available for selected particle are; dimensions, area, perimeter, ferrite length, min / max radius, thread length, thread width, fiber length, fiber width. roundness, shape, orientation, elongation, equal circular diameter, equal sphere volume, data export report generating and print out interactive file format. , multichannel ( 8 channel and 12 channel micropipette • theinstrument is fully autoclavable at 121 degree and 15 psi for duration of 10 15 minutes. • recommended for elisa ( diagnostic test ) , molecular screening, kinetic studiers, dna amplification. • adjust volume easily with plunger ? the plunger has been carefully designed with a high quality spring mechanism to ensure sang free and soft movement. ? simply turn it to adjust the instrument’s volume comfortably. • use various tips a with universal tipcone ? a universal tipcone enhances the compatibility of the instrument enables it to easily work with most internationally accepted standard tips. • set the volume with perfection ? a soft click sound at every increment ensures perfect volume setting and prevents any accidental changes. it also facilitates single handed operation. • work with a good tip ? a specially designed grippyprovides good grip and great ease of use while operating • store safely with a holder ? the instrument includes a holder that enables easy, efficient and safe storage. • eject tips with a sequential tip ejector ? a specially designed sequential tip ejector and tip ejection knob facilitates easy and effortless tip ejection, single handedly. • operate flexibly ? the lower housing unit of both the instruments can be rotated to 360 degree, providing enhanced operational flexibility. • both 8 channel and 12 channel micropipettes are offered in 6 models, covering volume ranges from 0.5 10 microliter to 40 300 microliter , fixed volume micro pipette 1mu , fixed volume micro pipette 2mu , fixed volume micro pipette 5mu , fixed volume micro pipette 10mu , pentahead microscope optical system treatment, uniformly centered body based on ball bearing and wire guide thereby ensuring smooth and precise movement viewing head of main observer setting – 1 no: viewing head for co observers setting – 4 nos. setting – 1 nos. penta head attachments stand for support two nos led pointer attachment 1nos the co observer get the same orientation of image as that of main observer dual head attachment stand for support – one no led pointer attachment 1nos connecting fitting – 1no image as that of main observation eyepiece wh10x / 20 ( fn20 ) – 5 pairs wh10x / 20 ( fn20 ) – 2 pairs nosepiece click stop objective 10x, 40x ( spring ) , 100x ( spring, oil ) focus system slides mechanical stage illumination system, led 3w ( lifetime : 30000 working hours ) illumination condenser ( na 1.25 ) focusable with rack and pinion , opg with ceph technical specifications valid aerb type approval certificate the unit should have ccd / cmos sensor for 2d pan & @d ceph and should be able to capture following programs: adult & child panoramic bitewing half pan ap & lateral sinus pa & lateral tmj lateral ceph ap pa ceph the unit should be floor & wall mounted for stability. should cater to all patients including adult, pediatrics, standing, sitting and wheel chair patients. should be based on dc current. focal pot is 0.2 / 0.5mm sq inherent filtration: 2.5mm ai equivalent. tube voltage min range 60kv to 80 kv or more tube current min range 2ma to 15 ma or higher exposure time panoramic 1 18 secs. pixel size 100? or less. image resolution 5 7 ip / mm standard intel i7 or latest desktop with original windows 10 / 64 bit software, 4 gb ram, 1tb hard disk, 24 inch tft monitor, dvd rw should be supplied with single online tray dicom printer with 300 or more dpi able to print 8’x10’ & 10’x12’ film vendor should also supply 01 packet ( 100 or more ) films of 10’x12’ films x ray unit should be supplied with lead apron, thyroid collar and gonadal sheath 02 nos. should be supplied with 2 customized tables and 2 height adjustable chairs with back and hand support the unit should be upgradeable to cbct in the near future, if required vendor should also supply 01 no. suitable online ups min. 3kva with 10 20 min back up the vendor should have installed similar model machine to any govt. institute in the past 3 years. enclose performance certificate to the same , technical specifications of mobile dental van to be supplied four tyre vehicle with air conditioning system without seats = 1no. fuel type diesel tyre 4 no. max. power 91 hp@2800 rpm service brakes front: hydraulic disc, rear: hydraulic drum max. torque 250 nm@1400 2400 rpm emission norms compliance bsiv engine fm 2.6 cr engine cylinders 4 engine displacement 2596 cc fuel tank capacity 70 litres gearbox synchromesh transmission 5 speed manual ( 5f+1r ) , with 5th overdrive gear seating capacity: without seats as dental chair has to be fitted overall length : 6065 mm anti roll bar:front only axle configuration : 4 x 2 front axle:dead rigid i beam, reverse elliot type front overhang: 900 mm front suspension: semi elliptical leaf springs, with hydraulic telescopic shock absorbers ground clearance:210 mm gvw: 4060 kg overall height: 2550 mm, 2770 mm ( with ac ) overall width: 1975 mm rear axle: live rigid rear overhang: 1465 mmrear suspension: semi elliptical leaf springs, with hydraulic telescopic shock absorbers turning circle radius: 6.5 m tyres: 215 / 75 r 15 wheelbase: 3700 mm air conditioner: yes:split ac roof mounted with connection for both generator as well as line power supply. antolock braking system: abs with ebd driver seat type: standard seat mobile charging point: yes steering adjustment: tiltable steering type: power steering anti roll bar:front only fog light:yes parking brakes: mechanical on rear wheels seat belts:yes battery: 12v, 130 ah alternator:2x 110a ac flooring: button vinyl def tank capacity ( i ) : 20 fabrication work plumbing work fresh water tank made of ss 304, capacity 300 liters to be provided on the top of the vehicle. ( hand washing bay ) : washbasin will also be stainless steel made. it has to be provided with looking mirror soap dispenser, towel ring or hanger. sink with elbow tap. one wash basin ( instrument washing bay: one sink with elbow tap, soap dispenser, towel ring one grey water tank 150 litters under carriage with outlet valve easy to reach. one cabinet below both the sinks with shelves and door. plumbing will be in such a manner that the same can be easily repaired in future without any damage or pipes can easily be change. exterior and interior lighting illumination inside the container will be according to bis / iso standard. all lighting will be led based. each cabin will have minimum of 02 emergency lighting lamp, which will be automatically charged directly from line power or generator. lamps power to be minimum of 8w. the total number, intensity and design of lights shall be finalized as per drawings electrical fittings specifications it would include external power source ( shore power ) and generator. specifications for generator : 5kw generator fuel type petrol: engine: eu or similar running time: once tank is full then it should work for 10 hours alternating current supply ( ac ) and direct current supply ( dc ) i.e. from vehicle battery or additional battery. cables used shall be bis marked ( legrand & finolex ) . copper conductors to be used will be with fire retardant pvc insulation and will be able to withstand working temperature upto 70 degree celcius. external power source will be in an accessible and well protected area from rain etc. electrical cables will be internally concealed and located such that no part can make contact with any fuel line or exhaust system subjected to excess heat. suitable special insulation to be provided where required every electrical circuit will be provided with fuse. electrical layout plan to be pasted at visible location. adequate number of 5 and 15 amp plug points along with switches of standard quality ( bis ) . location and number to be finalized as per design. main power switch / ups kva for equipments power source / line power selection switch. circuit breaker voltage stabilizer countertops specifications table countertops will be of scratch resistant material or stainless steel. edges to be covered with stainless steel channel. table thickness will be of at least 25 mm. the number, size and placement of doors and windows shall be finalized with the institute authorities. all doors / windows and hatches will comply with bis standard method for water proofing test on automobiles doors and windows specifications doors will be in appropriate dimension minimum 800 millimeters ( 2.6 feet ) in width and 1900 millimeters ( 6.23 feet ) in height. the windows will be sliding. size of the window will be minimum 2 feet wide and 1.5 feet high doors to have mechanism to hold them in open position. foldable steps with anti skid materials to be provided. there will be adequate provision of loading wheelchair on to the van cabinet specifications table and cabinet tops will be of scratch resistant material or stainless steel & edges will be covered and smooth. cabinet and storage compartments to be made up of powder coated steel / stainless steel of at least 20 gauges. the cabinets will have provision for vision window, so that the materials kept inside can be seen. drawers will be in increasing level from the top for easy of storage of instrument according to their sizes. there will be a retractable / foldable writing table in the passenger as well as clinic area. the cabinets etc. will be lockable with magnetic self locking latch type system. the drawers will be of medical grade with silicone rollers. the cabinets in the clinic area will be designed in such a way that there is separate storage for dental instruments, equipment and consumables roof specifications made of insulated sandwich panel as per specifications mentioned before. roof to be fabricated in a joint less manner to avoid rain water leakage. external guttering to be provided for draining rain water, ac condensation etc. the roof will be sturdy enough to take a load of 100kg. / sq. ft. the interior of the roof will be of aluminum composite panel of at least 2 mm thickness floor specifications floor will be internally welded steel frame with formed steel cross members. flooring will be of at least 0.6 mm thick gi sheet over which will be at least 18 mm thick fire retardant, marine grade plywood will be bonded. on the floor will be pasted a 1.5 mm thick industrial grade, durable, non slip, anti static coated vinyl flooring of superior quality. the entire flooring will be water proof using adequate coating and under coatings. floor will have adequate initial steel framework reinforcements for mounting equipment and other gadgets and accessories securely interior body specification inner skin will be of 1.5 mm thick grp / acp sheet. the body of the rear compartment will be made from minimum 40 mm, thick & monolithic sandwich panel for each of the surfaces. an insulation of 40 mm must thick puf ( poly urethane foam ) must be provided. the density of the puf will be 40kg / m3 minimum. the interior wall will be smooth with no visible joinery, made of medical grade material, aluminum composite panel of at least 2 mm thickness. the panel edges will be covered with stainless steel / aluminum formed section. the use of wood is to be avoided. 2 fire extinguishers in driver cabin and 1 in operatory with fixed brackets. public addressing system in driver cabin with overhead microphone fixed dustbin for bio medical waste exterior graphic designing with logo of the college and full wall pictures to be provided by the departmentdetails of dental equipments dental chair= 2 no operated dental chair with zero program with right arm rotatable. body contoured, led operating light, having on and off and intensity control by non touch sensor with 3 directional movements. chair side porcelain spittoon with auto water connection. high and low vacuum dry suction, with drain and auto flush. modular c delivery hanging system. air rotor points 02 nos. micromotor 35000 rpm with digital display of speed. three way syringe 02 nos., one operator / one assistant scalar ( in built ) with 5 scalar tips. light cure gun. s. steel instrument tray. x ray viewer. dental operator stool and dental assistant stool. light cure gun specification: digital display for timer, light intensity 1000mw per square centimeters, 04 smart modes ( fast, pulse, ramp and slow ) accessories with each chair 1 dental compressor 1 hp 1 press button, high performance air rotor preferably with ceramic ball bearing potable dc x ray with self developing films and portable rvg with tablet= 1no.each rvg sensor system: rvg water proof sensor, should be possible to safely insert sensor in disinfectant, shock resistant with silicon padding, shouldbepossibletoseetheimagefastest processing, sensor dimension 25 32x39 45mm, active area on sensor approx. 600 900mm2.sensor technology should be cmos, sensor cable length 03 meters, resolution in excess of 22lp / mm. other essential requirement should quote suitable laptop. product must have iso / ce / usfda certification. manufacture or supplier should have iso or bis certification. guarantee for 03 years comprehensive. amc for 05 years after expiry of guaranty. ( price should be quoted ) should provide original brochure ( printed in english ) onsite training. manufacturer and supplier should furnish a certificate stating that the equipment is original not a reconditioned one. autoclave= 1no. 11 liters, top loading and to be fixed in the cabin , pascal pressure cooker for immunohistochemistry , thermo statistically controlled wax dipping pots with digital display electronic controlled wax pots four individual square containers uniform temperature maintenance physical characteristics of wax unaltered 30`c 110`c , paraffin embedding wax bath thermostatically controlled double walled with cups and sleeves for glass tubes. temperature up to 95° c with accuracy of 1° c 12 cups and 14 sleeves. digital display and microprocessor control system. , water bath / tissue flotation bath temperature setting range: 0 55°c temperature tolerance: +1°c working voltage: ac110v 60hz power: 400 va fuse: f6a l 250ac glass bowl dimensions: 350 x 220 x 45mm overall dimensions: 410 x 510 x 150mm weight: 9.5kg waterbath with pyrex dish the tissue flotation bath is used for heating a tissue ribbon before placing it on a slide for reading. its small size and light weight make it a practical instrument for pathology labs, hospitals, medical schools and scientific research institutions. product features: bright, digital screen shows heater working state, temperature and time highest quality american microprocessor for precise temperature control bright led lighting operating temperature nearly 3 times faster than major competitors displays real time figures of setting temperature, work temperature, time and work state memory function and recovery function never forget to turn off unit again with programmable on / off timer no troublesome probe to break and flip all the time , orbital shaking incubators temp. range and accuracy : cis 24 plus: : 5 degree c to 60 c ris 24 plus :5 degree c above ambient to 60 degree c internal volume : 215 ltrs platform size : 580x 600 mm maximum shaking capacity : 100mlx49, 150x49, 250x33, 500x24, 1000x15, 2000mlx9 shaking speed range ( rpm ) : 20 to 250 shaking amplitude: 25mm internal dimensions w x d x h ( mm ) : 660 x 765 x 650 external dimensions w x d x h ( mm ) : 800 x 1150 x 1300 temperature control: microprocessor with pt 100 sensor display : 4? lcd screen, large size display for ease of reading power failure alarm: audio visual alarm door open alarm: audio alarm in case door open for over one minute temperature variation alarm : set temperature ± 2°c, audio visual alarm illumination : 8 watts fluorescent tube internal body material : stainless steel – 304 grade ( standard models ) , stainless steel – 316 grade ( gmp models ) external body material : powder coated crca steel ( standard models ) , stainless steel – 304 grade ( gmp models ) insulation ( cfc free polyurethane foam ) : 70 mm minimum for body & 80 mm for door noise level : less than 65 db ( a ) recommended voltage stabilizer : vs 02 , oral cdx brush biopsy kit with software and computer printer attachments oralcdx painless oral brush biopsy in minutes. simply mail the slide & test forms in the prepaid mailer to cdx lab where specially trained pathologists analyze with assistance of advanced computer analysis. each oralcdx biopsy test includes a sealed, sterile biopsy brush, two fixative packages, a glass slide and slide holder, a prepaid mailer box, a test requisition form, billing and reimbursement information. ada accepted. includes 12 complete biopsy tests and instructions. manufacturer code: 12pk brand: oralcdx component ( s ) : complete mail in kit packaging: package of 12 complete biopsy kits , automatic ice flake maker capacity 2 10 kg material ss, ms frequency 50 60 hz, phase 1 power source electric, voltage 220 v gross weight 36 50 kg usage laboratory pmt detector , horizontal laminar air flow material of construction galvanized iron sheet with epoxy polyester thermosetting powder coating of 60 80 microns, 1.5 mm thickness g.i. sheet. anti microbial powder coated / or / stainless steel 304 grade 1.2 mm complete. internal dimensions 1012 x 560 x 610 mm ( l x b x h ) + / 5 mm 39.84 x 22 x 24 inches external dimensions 1130 x 745 x 2025 mm ( l x b x h ) + / 5 mm 44.5 x 29.33 x 79.72 inches velocity 90 fpm at 6” from face of the filter + / 20 feet per minute table top stainless steel 304 grade 1.2 mm thickness body finish off white colour design & classification front top loading pre filters / complete work area will be of ss 304 including hepa grill, table top and light canopy internal surface. as per iest – rp – cc002.4 cleanliness class iso standard 14644 – 1 class 5 noise level less than 60 db at 1 meter from the face of the filter stages of filtration 1 ) pre filters = 10? with an efficiency of 90% ( washable hdpe media in frp pu coated frame ) 2 ) mini pleat hepa filter encased in aluminum frame final = 0.3? with an efficiency of 99.995% ( hepa filter : aaf india ltd. ) front door vertical sliding door 6 mm toughened glass with counter weight. hepa filter grill stainless steel 304 grade grills duly perforated and polished motor blower assembly “variable speed motor mounted on pu coated frp blowers with aluminum impellers switches & speed controller feather touch microprocessor controlled fluorescent lighting 18 watt slim tubelight – 2 nos. chokes for lighting electronic choke 18 watts – 3 nos. ultra violet lighting 1.5 feet length g15t8 15 watt sankyo denki / philips make electrical socket 5 / 15 amps socket – 1 nos. side panels stainless steel 304 grade pressure gauge minihelic gauge ( dwyer / aerosense make ) made in u.s.a gas / vacuum cock standard make – optional ( extra not included in the price ) wheels & leveling lugs pu solid wheels with plated brackets & metallic leveling lugs power supply & service single phase 230v, 50hz power supply consumption : 230 watts all services from front and back , multimode plate readers ( good branded standard company ) uv vis absorbance filter orspectrometer filter and quad monochromators filter and / or quad monochromators fluorescence intensity filter quad monochromator filter and / or quad monochromators luminescence ultrasensitive luminescence trf and tr fret lamp based2 lamp based lamp or laser based2 fluorescence polarization alpha ( laser based ) alpha standard alpha hts alpha standard or alpha hts alphaplex ( laser based ) alpha standard fast image based cytometr , ultrasonicator power supply, 85 260v / 50 60hz net power output, 700w nominal frequency, 24khz, real time display ( 19 26khzautomatic frequency scanning and checking ) timer, 1 min~99h can be set power regulation, 1% 100%, 1% progressive temperature setting, 0 300 ?, 1?progressive store data, 10 groups ( set, store, check in work status ) pulser, closed, open, 1s 60min can be set operation mode, pulse?time?continuous lcd display screen, color touch screen, resolution: 400 x 240 operational language, english main interface display parameters, ultrasound output power, frequency, working mode, user group, setting key, operation status, start / stop, operation parameters running interface displays, total running time, working time, pause time, user group, overload temperature, power output ratio, working mode, program save key small bulb, small bulb inside the box allows to observe the status of the sample during processing. size, 18.5×12.6×20.6in ( 470×320×525mm ) configuration of piezoelectric frequency converter piezoelectric frequency converter, cv33, pzt lead zirconatetitanate piezoelectric ceramics standard amplifier, aluminum alloy material: t1 6al 4v horn diameter, 8mm processing capacity, 0.1—800ml total length, 105 115mm ( variable ratio ) cable line, 150cm , bio safety cabinet class ii type a2 material of construction, galvanized iron sheet with epoxy polyester thermosetting powder coating of 60 80 microns, 1.5 mm thickness g.i. sheet. anti microbial powder coated / or / stainless steel 304 grade 1.2 mm complete. internal dimensions, l x d x h ( mm ) : 630 x 600 x 650 + / 5 mm external dimensions, l x d x h ( mm ) : 795 x 785 x 2220 + / 5 mm down flow velocity, 60 fpm at 4” from the ulpa grill inflow flow velocity, 100 fpm across the work access opening. body finish, glossy off white colour design, class ii – a2 compliant and approximately 30% of the air volume exhausted as sterile air back into the environment and approximately 70% of the air is re circulated inside the work area. cleanliness class, iso standard 14644 1 iso class 3 noise level, less than 60 db at 1 meter from the face of the filter stages of filtration, ulpa final = 0.12? with an efficiency of 99.9995% ulpa exhaust = 0.12? with an efficiency of 99.9995% ( ulpa filter : aaf india ltd. ) front door, one piece full view frame less sliding toughened glass door 6 mm thick. motorized automatic door. ulpa filter grill, ss 304 grills duly perforated and polished motor blower assembly, “godrej” make variable speed motor mounted on pu coated frp blowers with aluminum impellers switches & speed controller, feather touch microprocessor control fluorescent lighting, “osram” make. 18 watt slim tube light 2 chokes for lighting, “wipro” electronic choke 18 watts – 2 nos. ultra violet lighting, 1.5 feet length g15t8 15 watt “philips” make electrical socket, 5 / 15 amps socket – 1 nos. internal work area, complete stainless steel 304 with rounded joint less corners pressure gauge, magnehelic gauge gas / vacuum cock, standard make ( premier make ) wheels & leveling lugs, pu solid wheels with plated brackets & metal leveling lugs power supply & service, single phase 230v, 50hz power supply consumption : 350 watts all services from front and back alarm for excess height opening and automatic cutoff for uv tube when the door is open. interlocked switches for uv & lights. stainless steel drain collection system raised arm rest prevents grille blocking, and provides comfortable working posture. single piece work tray to contain spillage with sloped easy to swipe perimeter. system is ergonomically designed with angled cabinet front which is sloped at around 10° for enhanced comfort and reduced operator fatigue. for easy servicing all cabinet components, including ulpa filters are easily accessible from the front / back to allow for rapid service and minimal work disruption during preventative maintenance and recertification. system will comply with nsf / ansi 49 to ensure a safe operating environment for class ii, type a2 conditions , microprocessorbasedph meter features: measure ph, mv & temperature highly accurate & easy to operate auto temperature compensation facility 7 segment bright red led display soft touch membrane keys instrumentto provide the precise ph, mv and temperature measurements with auto buffer recognition for 4.00, 7.00 and 9.2 ph buffers and auto 2 or 3 points buffer calibration. with 7 segment bright red led display with latest microprocessor technology and advanced engineering techniquesto give enhanced accuracy and reproducibility.6 soft touch membrane type keys for ease of operation. calibration should be retained even after the instrument is switched off specifications parameters, ph, mv, temp range, 0 14.00 ph, 0 ±1999, 0 99.9 °c resolution, 0.01 ph, 1 mv, 0.1 °c accuracy, ± 0.01, ± 1 digit, ± 1 mv, ± 1 digit, ± 0.1 °c relative stability, 0.02 ph / hour acceptable electrode slope, 80% 120% temperature compensation, 0 100 oc auto / manual temperature sensor, semi conductor ( lm35 ) type calibration, auto ( 2 or 3 point ) auto buffer recognition, 4.00, 7.00 & 9.20 ph readout, 7 segment bright red led display ( 3 for temperature and 4 for ph / mv ) key board, 6 keys, soft touch membrane type power supply, 230v + 10% ac, 50 hz. accessories, combination ph electrode, buffer tablets ( 7.0 and 4.0 ph ) , temperature probe, electrode stand, mains lead, operation manual and dust cover...

Department of Higher Education - Madhya Pradesh

31419861 bids are invited for paper chromatography testing kit , chemical balance , bod incubator , water soil testing kit digital , heating mentle 2 lit 500 w , water bath 6 holes , rotary microtome with accessories , cod digestion apparatus , tds meter digital , magnetic stirrer with hot plate , laboratory mixer , hot air oven 14x14 , electronic digital balance , conductivity meter digital with cell , d o meter digital , digital ph meter conductivity meter and temperature meter , electronic balance 0.1 grm to 600 grm , flame photometer digital , single beam uvvis spectrometer without pc 200 1100 nm , chromatrographic chamber , spectrophotometer 340 900 nm , autoclave , compound microscope , dissecting microscope , binocular microscope , laminar air flow horizontal , ph meter , digital colony counter , water and soil testing analysis kit , spectrophotometer 340 900nm range , flame photometer , oven , rotatory microtome with accessories , autoclave portable , centrifuge machine 3500 rpm , thin layer chromatography kit , digital tds meter , micro pipette fixed 1to 5 ml , soxhlet extraction unit , incubator stainless steel , heating mental with regulator cap 1 lt , water bath double wall 12 holesstainless steel , distillation apparatus double distillation capacity 5lt , tissue culture rack total quantity : 83...

Indian Army - Madhya Pradesh

31341499 purchase of medical stores as per rfp , medicines : , prothrombin time (12x5 ml) , ana (1x5 tests) , sterile swab stick with polypropylene tube(1x100 tubes) , troponine –i (1x25 tests) , appendrof tube 1ml (1x1000) , biorad level 1 chemistry control (12x5 ml) , biorad level 2 chemistry control (12x5 ml) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper (blue star) , reticulocyte stain (100 ml) , zn stain ready to use , indian ink stain (50 ml) , lacto phenol cotton blue stain , cled agar (500 gm) , urochrome agar (500 gm) , muller hinton agar (500 gm) , blood agar base (500 gm) , saburoid dextose agar (500 gm) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich (ready to use) , haematoxillin stain harris ( ready to use) 500 ml bottle , ethanol , methanol (alcohol methyl) , chloroform , microtome blade s 35 high profile type (50 blades pack) feather/lica microtome , salmonella, shigella agar (500 gm) , microscope bulbs , glass marking pen (diamond marker) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Department of Higher Education - Madhya Pradesh

31053182 bids are invited for autoclave portable , binocular dissecting microscope , binocular microscope , cooling centrifuge , deep freezer , digital balance ( 0.1 mg ) , dissecting microscope , ganongs respirometer , hot air oven , magnetic stirrer with hot plate , maximum minimum thermometer , micro pipette ( varable 1 5 ml ) , normal chromatographic chamber , ph meter ( digital ) , slide cabinet with 12 showcase , thin layer chromatography appratus , wilmotts bubbler , bod incubator , digital colony counter , digital tds meter , compound microscope , digital thermometer , rotatory microtome with accessories , analytical balance ( chemical balance ) ( student level ) , autoclave portable , blood cell calculator ( student level ) , bod incubator 2 0 c to 60 0 c , digital haemoglobi nometer , digital ph meter , digial spectrophotometer , digital nephalo turbidity meter , glucometer , haemocytometer ( complete box ) , horizontal deep freezer , hot plate , inverter , microwave oven , refrigrator , sphygrnoma nometer ( student level ) , vortex shaker , water and soil testing analysis kit ( digital ) , water distillation apparatus ( single distillation unit 2 liter / hour , screw gauge , ammeter dc / ac ( required range ) , stop clock , stop watch digital , analog multimeter , voltmeter dc / ac ( required range ) , spectrometer prism ( crown / flint glass ) , galvanometer , thermometer different range , choke of mercury lamp ballast , digital multi meter , rheostate ( various length ) , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to study charactersitics of tunnel diode , zener diode characteristics apparatus with built in power supply , apparatus to study rc coupled amplifier with built in power supply , audio frequency generator , lachlance cell , battery charger 2 to 12 volt , apparatus to study response curve for lcr circuits and to determine the resonance frequency , cro single trace 20 mhz , potentiometer , m.o.s.f.e.t characteristic apparatus , zener regulated power supply , digital balance ( 2 kg ) , photo diode characteristic apparatus , travelling microscope , series and parallel resonance circuit , solar cell characteristic apparatus , function generator 0.3 to 30 mhz , plancks constant using solar cell apparatus ( complete kit ) , vibration magnetometer , singie stage and double stage r.c. coupled , power amplifier ( trainer board ) , variable regulated dc power supply 0 30 v range up to 5a with current controller , u.j.t. characteristic apparatus , s.c.r characteristic apparatus , horizontal torsion apparatus , regulated power supply trainer board. , thermistor characteristic apparatus , drill machine with all size bits ( hammer ) , bread board ( trainer kit ) , study of amplitude modulation and demodulation trainer. , study of crystal oscillator , induction hot plate with induction pots , transistorized push pull amplifier , study of frequency modulation and demodulation trainer. , opamp as voltage to frequency / frequency to voltage convertor , study of active and passive filters , study of smps. , constant deviation spectrometer ( student version ) , chemical balance digital , balance digital , stabilizer 5 kva , chemical cabinet storage , thermostatic water bath , melting point apparatus , ph meter digital , high precision water bath , digital photoelectric colorimeter...

Department of Higher Education - Madhya Pradesh

31033366 bids are invited for physical balance , weight box , vernier callipers , screw gauge , spherometer , stop clock , stop watch digital , slotted weights / hanger , resistance box ( various range ) , rheostate ( various length ) , ammeter dc / ac ( required range ) , voltmeter dc / ac ( required range ) , galvanometer , miliammeter / milivoltmeter / microammeter ( required range ) , battery eliminator , plug key one way / two way , reversing key , four way key , moarse key , daniel cell , lachlance cell , lead accumulator , digital multimeter , analog multimeter , soldering iron , travelling microscope , battery charger 2 to 12 volt , ballistic galvanometer with lamp and scale arrangement , spectrometer prism ( crown / flint glass ) , spectrometer 6 / 7, 30 sec , optical bench with riders double bar , optical bench with riders double bar heavy , inertia table , complete apparatus to verify law of parallel and perpendicular axes for moment of inertia , compound pendulum / bar pendulum , reading telescope , bending of beam apparatus to determine youngs modulus , cantilever to determine youngs modulus , horizontal torsion apparatus , jaegers apparatus to determine the viscocity of fluid using poseuiles method , apparatus to determine the surface tenstion , callendor and barnes apparatus to determine the value of mechanical equivalent of heat , measurement of low resistance by carey fosters bridge complete with power supply , potentiometer , lees apparatus to determine the heat conductivity of bad conductors of different geometry , apparatus to verify newtons law of cooling , searles apparatus to determine the coefficient of thermal conductivity , sodium vapor lamp , transformer for sodium vapor lamp , mercury lamp , transformer of mercury lamp , fresnel biprism , biprism assembly , complete apparatus to determine resolving power of telescope , biquartz or half shade polari meter o f t e l e s c o p e , biq u a r t z o r h a l f s h a d e p o l a ri m e t e r , n e w t o ns rin g s a p p a r a t u s c o m p l e t e wit h t r a v e l lin g mic r o s c o p e , p o w e r s u p p l y a n d s o diu m l a m p , e l e c t r o s c o p e o r e l e c t r o m e t e r , a u dio f r e q u e n c y g e n e r a t o r , c r o d u a l t r a c e 3 0 m h z sin g l e t r a c e 1 0 m h z , u s e o f vib r a tio n m a g n e t o m e t e r t o s t u d y a fie l d , t a n g e n t g a l v a n o m e t e r , a p p a r a t u s t o s t u d y r e s p o n s e c u r v e f o r ic r cir c uit s a n d t o d e t e r min e t h e r e s o n a n c e f r e q u e n c y , a p p a r a t u s f o r m e a s u r e m e n t o f c a p a cit a n c e a n d in d u c t a n c e u sin g impedance at different frequency , apparatus to determine the value of planks constant complete with photocell, light source, set of filter and power supply , complete apparatus to determine e / m using thomsons method , complete apparatus to determine by milikons method , apparatus to study the absorption spectra of iodine vapor complete with white light source, power supply, grating and spectrometer , apparatus to draw b h curve of ferromagnetic material with the help of cro , half wave and full wave rectifier apparatus with built in power supply , transistor characteristics apparatus with built in power supply and meters , apparatus to study charactersitics of tunnel diode , apparatus to study hysteresis curve of transformer core , apparatus to study specific resistance and energy gap of a semiconductor , apparatus to study transistorised regulated power supply , apparatus to study rc coupled amplifier with built in power supply , zener diode characteristics apparatus with built in power supply , apparatus to study charging and discharging of a capacitor , desktop computer for programming practicals , complete setup to find the wave length of sodium light with the help of fresenls biprism , study of lissajous figure trainer , field effect transistor , jeet apparatus with connecting wire , npn / pnp transistor with connecting wire , analytical weigh box 0.01 to 100 gram , chemical balance , chemical weight box, 1 mg 100 gm , chromatographic cabinet ( 6 leaves ) , paper chromatography , conductivity meter digital , cork boring machine , d o meter digital , digital colorimeter , digital photoelectric colorimeter 5 filters , distillation apparatus single distillation 5 litre , electronic balance 1 600 gm , exhaust fan 12 , exhaust fan 18 , heating mentle ( 71.1t ) , heating mentle ( 21.1t ) 500 w , hot air oven 14*14 , humidity / lamp meter traceable temp range ( 0 50 c ) , kipp apparatus , kjeldal digestion apparatus , magnetic stirrer with hot plate , melting point apparatus , melting point apparatus digital , oven universal , ph meter digital , polarimeter ( half shade ) , rotary light vacuum pump 25 lit / min , soxhlet extraction apparatus with glass part , spectrophotometer , thin layer chromatography apparatus , vacuum pump , vortex mixer , water bath 6 holes , water soil testing kit , compound microscope , dissecting microscope , slide box for 50 slides , slide box for 100 slides , bionocular microscope , water bath double wall ( 6 holes ) stainless steel , water bath double wall ( 12 holes ) stainless steel , distillation apparatus single distillation capacity 5 litre , distillation apparatus single distillation capacity 3 litre , hot apparatus single distillation capacity 3 litre , hot air oven stainless steel , heating mental with regulator cap 1 litre , heating mental with regulator cap 500 mili litre , vortex shaker , water and soil testing analysis kit , ph meter , spectrophotometer 340 900 nm range , digital colony counter , rotatory microtome with accessories , autoclave portable , centrifuge machine 3500 rpm , oven , digital balance ( 0.1 mg ) , image projection system , water bath double wall ( 6 holes ) stainless stell , water bath double wall ( 12 holes ) stainless stell , spectrophotometer 340 900 nm range , rotatory microtone with accessories , centrifuge machine 3500 rpm , thin layer chromatography kit , freeze...

Department of Higher Education - Madhya Pradesh

30978730 bids are invited for autoclave ( portable ) , double distillation unit , hot air oven , heating mantle 2ltr , heating mantle 5 ltr , muffle furnace , hot plate , magnetic stirrer ( with hot plate ) , laboratory stirrer , water bath 12 holes: , incubator , centrifuge machine , electronic balance , electrophoresis unit , micropipette , ammeter , digital conductivity meter , digital photo colorimeter , digital colony counter , dissolvedoxygen meter , water / soil testing kits , digital flamephotometer , digital spectrophotometer , flask shaker ( wrist action type ) , student polarimeter , vortex shaker , thin layer chromatgraphy , microtome , studentmicroscope , dissecting microscope , binocular microscope , b.p.apparatus , insects collection net , permanent slideboq title education development equipment for science total quantity : 149...

College Of Veterinary Sicence And Animal Husbandry - Madhya Pradesh

30928929 supply of instruments 1. incubator for pediatric wild animals, 2. muffle furnace, 3. elisa plate washer 4. patient monitoring system 5. portable blood gas, electrolytes and critical care analyzer 6. applanation tonometer (tono pen vet) 7. linear probe 8. holter ecg machine 9. trap cage for carnivores 10. cow simulation/dummy cow model for ai training required technical specifications 11. poly sulfonate rat housing assembly 12. polycarbonate rat housing assembly 13. mice housing assembly 14. rabbit housing assembly 15. metabolic cages for rats 16. necropsy unit (approx. cost 2.25 lakh) 17. semi automatic microtome 18. water purification system 19. biosafety cabinet class ii, a2 20. gradient pcr machine 21. incubator shaker (orbital) 22. bod incubator 23. deep freezer (minus 400c) 24. elisa reader 25. gel doc system 26. horizontal feed mixer 27. grinder (hammer mil) 28. smart board for teaching (purchase under computer and computer stationeries in dpr)...

Medical Education Department - Madhya Pradesh

30851406 bids are invited for amyloidosis liver slide , infarction kidney slide , skin lepromatous leprosy slide , skin tuberculosis slide , actinomycosis slide , liver cvc slide , kidney renal cell carcinoma slide , adenocarcinoma colon slide , stomach chronic peptic ulcer slide , liver cirrhosis slide , seminoma testis slide , osteogenic slide , skin melanoma , rhinosporiodiosis slide , hydatid cyst slide , carcinoma lung slide , basel cell carcinoma slide , leomyosarcoma uterus slide , chronic osteomyelitis slide , fibrosarcoma slide , ameloblastoma slide , teratoma testis slide , wilms tomour slide , pleomorphic adenoma slide , gastric carcinoma slide , osteoclastoma bone slide , pinworm in appendix slide , atherosclerosis slide , carbencillin , cephalexin , cephotaxime , ciprofloxacin , cloxacillin , co trimoxazole , gentamicin , oxacillin , furazolidine , oxytertracyline , steptomycin , linezolid , ceftazidine clavulanic acid , cefefime , aztreonom , meropenam , cefotaxime , cefixime , ofloxacin , tigecycline , netimicin , fosfomycin , glusose phosphate broth ( mr vp medium ) , kovac reagent , tryptophan broth , oxidase disc , straightwire with handle , mannual blood culture bottle ( bh1 bottle ) , 40% urea , triple sugar agar , hydrogen peroxide , kohreagent , lugols iodine , peptone water , mc cartney bottle, widal antigen , aso , typhiod igg / igm , test tube stand , spirit lamp stainless steel , nichrome loop with handle , tissue paper roll , concavity slide , amber colour dropper , crystal violet powder , gram iodine bottle , cary blairtransport medium , loffler serum sloop base with horseserum medium , albert stain kits , eosin , acrylic sheet ( 1375 mm * 915 mm ) , acrylic cutter , silk thread , phpaper , benzedine powder , microtome blade ( hp 35 inch *75 mm ) , barium chloride ( bacl2 ) , disposable dropper small , paps stain kit ( rapid ) , sodium metabisulfite , albumino meter , g6 pd ( semi quantatiive ) , urin analysertrips para , ehrich reagent , hemoglobino meter ( sahils ) , slide box ( 75 mm*25 mm ) , cover slip box ( 22*22 mm ) 1 / 53 total quantity : 3793...

Indian Army - Madhya Pradesh

30832614 purchase of lab reagents and consumables as per rfp , medicines : , prothrombin time ( 12x5 ml ) , ana ( 1x5 tests ) , sterile swab stick with polypropylene tube ( 1x100 tubes ) , troponine –i ( 1x25 tests ) , appendrof tube 1ml ( 1x1000 ) , biorad level 1 chemistry control ( 12x5 ml ) , biorad level 2 chemistry control ( 12x5 ml ) , diabetes control biorad level 1 & 2 , tri control for sysmex kx 21 , slide microscope size 75x25 mmwith inter link paper ( blue star ) , reticulocyte stain ( 100 ml ) , zn stain ready to use , indian ink stain ( 50 ml ) , lacto phenol cotton blue stain , cled agar ( 500 gm ) , urochrome agar ( 500 gm ) , muller hinton agar ( 500 gm ) , blood agar base ( 500 gm ) , saburoid dextose agar ( 500 gm ) , cover slip 22x30cm , cover slip 22x40cm , cover slip 22x50cm , glycerin , paraffin wax 500 gm pack , haemotoxyllin ehrlich ( ready to use ) , haematoxillin stain harris ( ready to use ) 500 ml bottle , ethanol , methanol ( alcohol methyl ) , chloroform , microtome blade s 35 high profile type ( 50 blades pack ) feather / lica microtome , salmonella, shigella agar ( 500 gm ) , microscope bulbs , glass marking pen ( diamond marker ) , cuvette for stago start 4 , milk adulterants test kit , tourniquet , petridish disposable , pap stain , grocott stain , plastic tissue embedding ring , plastic tissue cassette => limited...

Indian Army - Madhya Pradesh

30788294 invitation of online bids for purchase of invitation of online bids for purchase of expendable medical stores out of dglp echs fund , kit ck mb erba semi autho , kit prothrombin time 1x5 ml ( tulip ) , ethyl alcohol ( std ) , kit dengue ns1ag comb card test ) ( tulip ) , cell pack pack of 20 ltr ( sysmex ) , stromatolyser 500 ml bott ( sysmex ) , cell clean 1x50 ml bott ( sysmex ) , sterile urine container10 ml , glass slides pkt of 100 ( 5 star ) , blood agar plate , mha agar plate , kit uristick ( protein & sugar ) , urine multi strip siemens bott of 100 strip , hi media zn stain ( readymade ) , hi media gram stain ( readymade ) , hi media methylene blue for retic stain , sample cup pack of 100 cup em 200 , upt ( hcg ) 2x50 test kit , kit hiv rapid 4th gen cardtest ( sd, j mitra ) , kit vdrl card test ( tulip ) , kit salmonella typhi card test ( tulip ) , kit aso titer 1x2 ml ( kit of 35 test ) ( tulip ) , print roll , anti sera a bott of 10 ml antigen igm ( tulip ) , anti sera b bott of 10 ml antigen igm ( tulip ) , anti sera ab bott of 10 ml antigen igm ( tulip ) , anti sera d bott of 10 ml antigen igm ( tulip ) , ketostick , hi media sugar set ( biochemical reaction ) , rapid covid 19 antigen test , viral transport medium 3 ml ( vtm ) , kit d dimer 1x7 ml , feder hish profile microtome blades ( 1x50 ) , edta vaccutainer ( bd ) , sodium citrate ( bd ) , gel vaccutainer sterile tube of 5 ml ( bd ) , sterilevaccutainer sterile ( bd ) , sodium flouride => limited...

Government Medical College - Madhya Pradesh

30268661 supply of medicine supply of medicine , injection, tablet, capsul, cream, oint, eye drop, syp, solution, ointment, iv fluid, power, gel, spary, inhaler, etc , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actinomycin 0.5 mg inj , acycloir 250 mg inj , acycloir 500 mg inj , acycloir 750 mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , vial , anti hemophillic factor viii 500 iu ( vial ) , vial , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 500mg / ml 50ml vial ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml amp , azithromycin 100mg / 5ml inj , azithromycin 200mg / 5ml inj , bendamustin 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulphan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10%10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , calcium leucovorin ( folinic acid ) 50 mg / vial 5 ml vial , carboplatin 150 mg inj vial , carboplatin 450 mg injvial , carboprost promithamin 250 mcg / ml 1ml amp , carmustin 100 mg inj vial , carmustine ( bcnu ) 100 mg vial , cefaparazone with salbactum , cefazoline 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +1000 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 100mg vial , cetuximab 200mg / 100ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection , clopixol acuphase 50 mg inj , clopixol deconate 200 mg inj , collistimate sod. 1iuvial , collistimate sod. 2iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dacarbazine 500 mginj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone 4mg vial , dexamethasone 4mg / 1mlinj , dexmedetomidine100 mg / ml amp ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diazepam 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lypholozed ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edavarane60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj amp , enoxaparin 60mg inj amp , ephedrine 30mg / ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4 k inj , erythropoietin 10000iu inj 1ml pfs , erythropoietin 40000iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , ethamsylate 125 mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fluanxol depot 25 mg inj , fludarabin 50 mg vial , fluorescein 20% 5 ml amp , flupenthioxl 20 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu ( reptilase ) botropose inj , haloperidol 5 mg / iv / im inj , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium , hydroxy progesterone caproate 250mg / ml vial , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosphamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , iohexol 350 mg i / ml ( non ionic contrast medium in sterile , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia , lignocaine hydrochloride + adrenaline , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lmwh low molecular weight heparin 40mg vial , lmwh low molecular weight heparin 60mg vial , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , metaclopromide 5mg / ml 2ml amp , methacarbamol 100 mg. / 10ml vial , methotrexate 15 ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2mlamp , micronized progesterone 200 ml vial , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 10mg / 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine supaphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nabpaclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , nekethamide amp , neostigmine 0.5 mg / ml, 1ml amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml 5 ml amp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olenzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , perinorm 2ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , prolution depot 250mg inj 1ml amp , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / 20ml vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , ropivacaine 10mg / ml 2.5ml vial , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , sargramostin 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium thiopentone inj 0.5gm powder / vial 20ml vial , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial , tecoplanin 400mg vial , terbutalime 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml, 10 ml , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+niacinamide 12 , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin100 mg / 50 ml 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% , dextrose saline ( dns ) , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) , fat emulsion 20% 0.2 ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv , levofloxacin 500 mg / 100 ml 100 ml ffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 ml 100 ml ffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 100 ml / 200mg bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose , total parenteral nutrition 1000 ml with 763 kcal , tpn ( total parenteral nutrition ) including carbohydrate + proteins , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumaro / nicoumalone 2 mg tab , acetazolamide 250 mg tab ( dimox ) , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipne 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atiomoxetin 10 mg tab , atiomoxetin 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen od 20 mg , baclofen od 30 mg , baclofen od 40 mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonameserire 2 mg , blonameserire 4 mg , buprinoprhin 4mg , buprinoprhin 8 mg , bupropion150 mg , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate tab , calcium d3 / 500mg , calithromycin 250 mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine tab. 5mg , ciprofloxacin500 mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , cloimipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine100 mcg , clonidine 100 mg tab , clopidogrel75 mg , clopidogrel aspirin , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , crizotinib 250mg , cyclophosphamide 50 mg tab , deferasirox dispersible 500 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratuioeotudase 10mg , diclofenac 50mg + paracitamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , dosatinib 100mg / 50 mg , doxophylline400 mg , dudrogesterone 10mg , duloxetine 20 mg tab , duloxetine 30 mg tab , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , famutaz 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , flebuxostat 40mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluoxetine 40 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 10mg / 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+10mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , mag. oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mcg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyephendate 10 mg , methyephendate 20 mg , methyephendate 5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 , methyldopa 250 mg tab , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil 100 mg tab , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , , mycophenolate mofetil, 500 mg , n acetylcysteline 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxnide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , pacitane 2mg tab , palbociclib 100 mg , palbociclib 125 mg , palbociclib 75 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , piogliatazone 15 mg tab , piogliatazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubtril plus valsartan , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valporate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin$dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine sodium 100mg , thyroxine sodium 25 mg , thyroxine sodium 50mg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenidyl 2 mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , verapamil40 mg , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.3 mg tab , voriconazole 200 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , doxycycline 100 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , temozolamide 100 mg , temozolamide 250 mg , sildenafil 20mg , vit. e400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , hypersol s ( 5% ) , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution , pilocarpine eye drops 2% , polyvinyle alcohol 1.4% 5 ml , prednisolon eye / drop. , proparacaine , sodium chloride 5% eye drop ( nacl 5% ) , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of , prostaglandin e2 , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethosome valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , mct oil 100ml bottle , lactobacillus, 150 million spores, , arginine sachet 10gm , hmf lactocex plus sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 , antiseptic hospital concentrate contdaining 20% chlorohexidine , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam , formaldehyde ( formalin ) 37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enima , hand wash.sol . ( sol.isoprapanol, propanol, mecetronium, skin care , hydrogen peroxide soln 20% 500 ml bottle , hypo solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant , aluminium hydro gel syp ( antacid ) 100ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondenstrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , nasoclear nasal mist spray 20 ml spray , nasoclear nasal gel 15 gm tube , nasoclear nasal wash 3gm kit , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , mouth paint clotrimazole 1%15 ml , absorable cotton roll, net 500gm , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine spangstron ip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , ag ion impregnated central venous double lumen , ag ion impregnated central venous triple lumen , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, , air bed matterses with complete set , airway size 3, 4, 5, 5.5 , airway size 6, 7.5 , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , antimicrobial incise drape 3 m , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps , biopsy gun , bipap mask , biploar forceps cable , bipolar cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set , bone marrow aspiration needles ( 14 ) ( medevolution ltd ) , bone marrow aspiration needles ( 15 ) ( medevolution ltd ) , bone marrow aspiration needles ( 16 ) ( medevolution ltd ) , bone marrow aspiration needles13 g ( medevolution ltd ) , bone marrow biopsy needle , bone wax , bp cuff adult & pead. , camera cover , cannula fixer set , carbolic acid 500 ml , c arm cover , catheter mount adult size , catheter mount peadiatric size , cautery pencil , cautery plate ( reusable ) , central line double luman 16g , central line singal luman , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine gauze dresssing b.p antiseptic tulle gas dressing , collagen patch 30x30 , colostomy kit , computer radiography x ray film ( fuji ) 10x12 pkt , computer radiography x ray film ( fuji ) 14x17 pkt , computer radiography x ray film ( fuji ) 8x10 pkt , condom catheter , card clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crape bandage 2 , crape bandage 4 , crape bandage 6 , cvc line double lumen polyurethane catheter ( flexon , cvc line triple lumen polyurethane catheter ( flexon material ) with , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dengue card test 100 test kit , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or , disp paper gloves , dispo cap , dispo face mask triple layer ( standard ) , dispo hivfull protecatin kit , dispo. n95 mask , disposable needle 18g ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx1 / 2 , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , distilled water 5 lit. , double lumen peripherally inserted central venous silicon , double lumen peripherally inserted central venous silicon , drap sheeth 120cm x 210cm sterile , ear buds , ecg disposabile electrode , ecg paper ( wax coated ) 50mmx30 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed4 , endotracheal tube cuffed5 , endotracheal tube cuffed 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffedsize 9.5 , endotracheal tubes plain without cuff size 2, , endotracheal tubes plain without cuff size2.5, , endotracheal tubes plain without cuff size3 , endotracheal tubes plain without cuff size3.5, , endotracheal tubes plain without cuff size 4 , endotracheal tubes plain without cuff size 4.5 , endotracheal tube with secondary lumen for , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination glovesmedium pair , examination glovessmall pair , examination gloves large pair , exchange transfusion catheter with four way adaptor size 4cm, l , extention line 10cm , extention line 50cm , extention line 100cm , extention line 150cm , extention line 200 cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluroscein strips pkt , fogharty cathetor 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley triway no 20 two way , foley urinary catheter size 8 10 pediatrics , gigli saw wire , glass slide , glass tube 125x150 , glucometer strips , gudel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hickman catheter double lumen7.7 no , hickman catheter single lumen4.7 no , hickman catheter single lumen6.6 no , hickman catheter single lumen7.7 no , hme filter , humbeysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain , insulin syringe , intravenous drip set adult size , intravenous drip set pediatric size , iv .regulator set ( control drop set ) , iv cannula size 16 g , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , juglarcatheter 12 fr ( adult ) , juglar catheter 8fr ( pediatric ) , k 90 catheter , kallis pad disposable , liga clip 200, 300, 400 , long length quincke spinal needle for pain management, size – g , lung excersizer , lysol ( cresol with soap solution ) 5ltr jar , mackintosh double colour water proof , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , mesure volume set soft chamber, with bulb latex 110ml , micro drip set with bulb latex , micropore 6” , monopolar coutry wire , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , nebulazation mask ( set ) adult & pediatric , neonatal urine collection and measurement bag , niv mask venti cpap ( large & medium ) , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural , non sterile surgical rubber gloves 7 no. ( pair ) made of natural , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural , o maya large / small , oxygen catheter , oxygen connection for central line , oxygen connection for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , paediatric double lumen polyurethan cvc line, 3 fr, l , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g , paediatric triple lumen polyurethan cvc line with nitinol j guide , paper adhesive plaster microporous surgical tape 2inch x 10mt , paper adhesive plaster microporous surgical tape 3inch x 10mt , paper adhesive plaster microporous surgical tape 4inch x 10mt , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm peadiatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , pt vial / tube ( prothrombin vial / tube ) , radial a catheter , rectified sprit 4.5 ltr. , ryles tube size 10, 12, 14, 16, 18 , schirmer strips , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes. , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , sterilant cold disinfectant for dialysis containing peraetic acid , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile gauze swab / pad packets , sterile hypodermic syringe with needle 03 ml , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 2ml , sterile hypodermic syringe with needle 50ml / 60ml , sterile hypodermic syringe with needle 5ml , sterile luerlock syringe 10 ml , sterile luerlock syringe 5 ml , sterile leurlock syringe 20ml , sterile leurlock syringe 50ml , sterlie gloves isi 6.5 made of natural latex, micro rough finish , sterlie gloves isi size7.5 made of natural latex, micro rough , sterlie gloves isi size8 made of natural latex, micro rough , sterlie gloves isi size 7 made of natural latex, micro rough , sterlie powder free glovessize6.5 made of natural latex, micro , sterlie powder free glovessize7 made of natural latex, micro , sterlie powder free glovessize7.5 made of natural latex, micro , sterlie powder free glovessize8 made of natural latex, micro , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tegaderm ( cvl dressing ) 10 cm*12 cm , tegaderm ( cvl dressing ) 7 cm* 8.5 cm , tegaderm ( samll ) i / v , thermometer , thomas splint , transducer set for invasive b.p. , three way stop cock , tmt paper , tounge depresser , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula paed. , urine collecting bag , urine collecting bag with urometer , urine sugar diagnostic stick , vaccum jar 1000 ml , vaccum jar 2000 ml , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt , x ray films size 12x15 50film per pkt , x ray films size 8x10 50film per pkt , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankar suction catheter ( complit set ) , pacing leads 6 fr , introducer sheath 6fr , pigtail catheter 6 fr ( 150 cm ) , j tip 0.035 mm guidewire , black braided silk eyeless needled suture usp, code 5036 size 2 , black braided silk eyeless needled suture usp, code 5082 size 4 , black braided silk eyeless needled suture usp, code 5333 size 2 , blackbraided silk eyeless needled suture usp, size 5 0 , blackbraided silk eyeless needled suture usp, size 6 0 , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 , braided synthetic absorbable eyeless needled suture usp code , braided synthetic absorbable eyeless needled suture uspbraided , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in , oxidized regenerated cellulose based topical absorbable hemostar , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , surgical silk braded ( sutupack ) sterile foilover wrappack code 213 , surgical silk braded ( sutupack ) sterile foilover wrappack code 214 , surgical silk braded ( sutupack ) sterile foilover wrappack code 215 , vicryl 2.0 round body needle , 20g round body cutting needle 1 / 2 circle , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , monofilament glycomer 631* 3 0 75cm, undyed24mm3 / 8 , monofilament glycomer 631* 3 0 75cm, violet22mm1 / 2 , monofilament glycomer 631* 1 , 90cm, violet40mm1 / 2 circle , monofilament glycomer 631* 2 0 , 75cm, violet27mm1 / 2 , monofilament glycomer 631* 0, 90cm, violet40mm1 / 2 circle , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , poliglecaprone 25 undyed with irgcare mp3 0, 3 / 8 circle reverse , polydioxanone lrgacare mp coated 150cm usp1 0 rb ctx, 1 / 2 , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle , 180 absorbablepolyglyconate knotless wound closure device with , 180 absorbablepolyglyconate knotless wound closure device with , 90 glycomer 631knotless wound closure device with , 90 glycomer 631knotless wound closure device with , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , synthetic absorbable surgical suture , polyglactin 910 with irgacare , synthetic absorbable surgical suture irgacare coated monofilament , absorbable unidirectional barbed device symmetric anchoring , absorbable adhesion barrier in the form of off white knitted fabric , polyster braided polybutylatecodated 1 / 2 circle tapercut double , triclosan antibacterial coated polyglactin 910 with 23 mm needle , protective disk with chg hydrophilic polyurethane absorptive foam , protective disk with chg hydrophilic polyurethane absorptive foam , self gripping polyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , absorbable intraperitoneal umbilical patch of polyester mesh with , absorbable intraperitoneal umbilical patch of polyester mesh with , ada kit , aluminium ammonium sulphate powder 500gm , ana 96 well , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera , anti ab sera , anti a lactin , anti b sera , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , diagnostic strip for urine ( sugar and albumin ) , diamond pencil , dpx mount 250ml ( urgent ) , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , glass slide iso mark no 12mm , haematoxylene 5gm ( urgent ) , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , m .p elisa , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , mp antigen test kit rapid , n / 10 hcl 500ml , nitrile gloves size small / medium / large , p t tubes 3.8% sodium citrate , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test strip , vdrl rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , surgical blade 22 no carbon steel , sugar albumin uristics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for pediatric ( bac t / alert pf , blood culture media anaerobic for pediatric ( bac t / alert , ki67 / mib 106 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close , disposable circular stapler 26mm diameter , disposable circular stapler 29mm diameter , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable linear stapler with fixed staple height 55mm 60mm , disposable linear stapler with fixed staple height 75mm , reload 55 60mm for thin / vascular tissue white compatible , reload 55 60mm for medium thick tissue blue compatible , reload 75 80mm for medium thick tissue blue compatible , reload 75 80mm for thick tissue green compatible with , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposble skin stapler with pins , disposable hemorrhoidal stapler with detachable anvil. , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 55mm 60mm , reload for linear stapler with fixed staple height 55mm 60mm , disposable curved cutter stapler , polycearbonte bladeless frocar with reducer seal 5mm , polycearbonte bladeless frocar with reducer seal 10mm , polycearbonte bladeless frocar with reducer seal 12mm , reload for linear cutter 55mm 60mm size blue , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload for linear cutter 90mm 100 mm size blue , reload forlinear cutter 90mm 100 mm size green , reusable laparoscopic clip applicator for medium large titanium , reusable laparoscopic clip applicator for large titanium clips with , mesh fixation device with non absorbable titatinum tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , mesh fixation device with 30 poly ( lactide co glycolide ) , mesh fixation device with 15 poly ( lactide co glycolide ) , partially absorbable mesh with absorable & semi , partially absorbable mesh with absorable & semi absorbable , polyprplene with polyglecaprone 25 partially absorbable mesh , polyprplene with polyglecaprone 25 partially absorbable mesh , skin staple remover with plastic handle , distal tip closure titanium ligation clip small size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip medium large size , distal tip closure titanium ligation clip large size , reusable laparoscopic clip applicator for large titanium , reusable laparoscopic clip applicator for medium large , reusable laparoscopic clip applicator for large titanium , dispoable trocar 05mm , dispoable trocar 10mm , dispoable trocar 12mm , dispoable trocar 15mm , disposable curved cutter stapler , reload compatible with curved cutter , endoscopic cutter & staplter60mmlong , endoscopic cutter & staplter60mm , reload endoscopic cutter & staplter60mm white / , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter45mm blue , endosuturing device 10mm with toggle lever , absorbable 2 0 endo suture cartridge 48 length , non absorbable 2 0 endo suture cartridge 48 length , disposable clip applier medium 5mm with 16 clips , disposable clipapplier medium 10mm with 20 clips , multifire clip applier small size 20 clip , multifire cliip applier long size 15 clips , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , suture locking , plastic locking clip applicator medium / large , locking clip cartridge medium / large , open clip appkicator 100 lt / 200 lt / 300 lt / 400 lt , titanium clip 100 lt / 200 lt / 300 lt / 400 , instrument tray 8×6 inch , instrument tray 9×6 inch , instrument tray 10×8 inch , instrument tray 11×7 inch , instrument tray 12×10 inch , instrument tray 14×10inch , instrument tray 15×12 inch , instrument tray 18×12 inch , instrument / dressing drum 9×5 inch , instrument / dressing drum 9×9 inch , instrument / dressing drum 10×8 inch , instrument / dressing drum 11×9 inch , instrument / dressing drum 14×9 inch , instrument / dressing drum 15×12 inch , formalin chamber 20 inch ( 20x8x8 ) 3 tray , formalin chamber 14inch 3 tray , formalin chamber 10 inch 2 tray , kidney tray set ( 150mmx200mmx250mmx300 mm ) , stainless steel cidex box with lid 10 lits ( 27x6x5 “ ) , ulv fogging machine , sanishieldsolution , ot slipper orthopedic soft , s.s sterilization autoclave , square box 20cmx20cm , s.s sterilization autoclave , square box 20cmx10cm , ent surgical micromotor drill system , micro ear burr tungsten carbide cutting 70mm , micro ear burr tungsten carbide cutting 0.5 mm , micro ear burr tungsten carbide cutting 0.60mm , micro ear burr tungsten carbide cutting 1 mm , micro ear burr tungsten carbide cutting 1.50 mm , micro ear burr tungsten carbide cutting 2.00 mm , micro ear burr tungsten carbide cutting 2.50 mm , micro ear burr tungsten carbide cutting 3.00 mm , micro ear burr tungsten carbide cutting 3.50 mm , micro ear burr tungsten carbide cutting 4.00 mm , micro ear burr tungsten carbide cutting 4.50 mm , micro ear burr tungsten carbide cutting 5.00 mm , micro ear burr tungsten carbide cutting 5.50 mm , micro ear burr tungsten carbide cutting 6.00 mm , micro ear burr tungsten carbide cutting 6.50 mm , micro ear burr tungsten carbide cutting 7.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.60 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 1 mm , micro ear burr tungsten carbide diamond / polishing 70mm length1.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 2.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length2.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length3.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 3.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 7.00 mm , bulls lampstand &100watt bulbs , head mirror , otoscope ( heine fibro optic ) , thudicum nasal speculum , lac’s tongue depressor ( metalic reuseable ) , in direct laryngoscopy mirrors , st clairs tompsons posterior rhinoscopy mirrors , hartmann aural speculum , shea aural speculum , tumarkin aural speculum , verhoeven micro ear suction tip , ear microsuction tip adapter , nasal suction tip , suction apparatus , siegles speculum , tuning fork ( 256hz, 512hz, 1024hz ) , bayonet forceps , jobson horne probe , steilizer ( boiler ) , bp apparatus , stethoscope , tilleys nasal dressing forcep , hartman nasal packing forcep , loop vectix wire , instrument tray 10inch x 15 inch , ent opd led head light , metalic washerless aural syringe ( simpson’s ) , tilley lichwitz s trocar&canula , tongue tie release butterfly forcep all size , sprit lamp , barany noise box , ear vectis with cerumen spud , hartmann aural forceps , trocltsch aural forceps , lucas curved aural forceps , eustachian tube catheter , mac ewen cell seeker and curette , alligator forceps , nasal foreign body hook , higginson syringe , tilleys antral harpoon , myle nasoantral perforator , st clair thompson quinys forceps , cidex box 45 cm and 35 cm and 24 cm , formalinchamber ( 35 cm & 45 cm ) , cheatle sterilizerforceps , cheatle forceps jar , bandage cutting scissors , x ray view box , opd sterlizing fogger machine , ultrasonic instrument cleaner , curved scissor 6 inch , formalin chamber 24 cm , savalon solution , bowl , romposon suction tube , nasal suction tip , tilleys forcep , lidocaine 4% solution 30 ml , gauze cloth 91 cm / 20 m , macintos 20×1 mtr , surgical mopping pad , adk drain 24 no , adk drain 28 no , chest tube with trocar 20 no , chest bag under waterseal 26 no , romovac suction drain 16 no , romovac suction drain 14 no , romsons corrugated drain , harnia mesh kit 3×6 inch , intraoclar lens ( 15 no to 27 no ) , viscoelastic substance , balanced salt solution , formalin solution , acetone solution , inj. hylase ( hyluronidase ) , lignocaine 2%+ adrenaline , inj.gentamicin , inj. phenylephrine 10 mg / 1 ml , cuticell10*10 cm , cuticell 10*30 cm , hand wash soln 500 ml , microgen d 125 , iv ns3 % 100 ml , iso p 500 ml , iv ns 0.45% 500 ml , guedal airway size 000, , guedal airway size 00, , silicon mask adult size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , ansthesia work station disposable circuit ( adult ) , laryngoscope ( paedeatric ) a machintosh size 00, , laryngoscope ( paedeatric ) b miller blade size , 0, , laryngoscope ( paedeatric ) a machintosh size , 1, , laryngoscope ( paedeatric ) b miller blade size size , 1, , laryngoscope ( paedeatric ) b miller blade size , 2 , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , maccoy laryngoscope with bladesize 5 , lma ( proseal ) size 1, , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , lma ( i gel ) size 1 , lma ( i gel ) size 1.5 , lma ( i gel ) size 2 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 6.5 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating bougie , ventilating bougie , ansathesia face mask silicone transparentsize 00 , ambu bag ( padeatric ) 150 ml , micropore 0.5inch , micropore 1 inch , magill forcep ( adult ) , magill forcep ( padeatric ) , video laryngoscope with blade 2 ( c mac ) , video laryngoscope with blade 3 ( c mac ) , video laryngoscope with blade 4 ( c mac ) , centralvenous catheterkit ( paedeatric ) , pressure bag 1000 ml , pressure bag 500 ml , nebulizer machine , head ring ( peadia ) , head ring ( adult ) , hot air warmer , 3 way extension 25 cm , needle cutter , 3 way extension 100 cm , electric surgical instrument boiler ( 24*8*8 ) inch , electric surgical instrument boiler ( 20*8*7.5 ) inch , tee oxygenator ( t piece ) , tub big50 litr , detergent powder 500 gm , rubber sheet macintos20m roll , capmask / cloth based , towels ( small ) , towels ( large ) ) , shoe cover / cloth based , disposablesurgical gown , combined epidural spinal set ( 18g ) , hernia mes ( polypropylene ) 3*6 inch , north & southpole indotracheal tube ( rate tube ) size 3.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 04 ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 4.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 05, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 5.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 06, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 6.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 07, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 7.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 08 ( ring adair elwiny ) , betadine scrub ( 500 ml ) , betadine solution ( 500 ml ) , nylon 2.0 ( cutting needle ) suture , ethilone 2.0 , condom , g bone , mirena 50 , bupevacine inj ( 20 ml ) , pregnancy kit , infrared thermometer gun , nebuliser mask ( paedia ) , needle cutter electrical , steam disinfectant system, ( fumigation machine ) , surgical poly wrap , tripple lumen central line adult , uroflometer , pulse oxymeter , nasopharyngealairway size 5.5 , nasopharyngealairway size 6 , nasopharyngealairway size 7 , nasopharyngealairway size6.5 , nasopharyngealairway size7.5 , steel scissor 10 no , steel tray ( small ) , steel tray ( large ) , steel tray ( medium ) , bb splint , disposable catheter mount , tooke corneal knife ( num ) , inj. adenosine 6 mg / 2 ml , inj. adrenaline 1 mg / ml , inj. adrenaline 1 mg , inj. alamine 200 ml , inj. albumin iv 20% 100 ml , inj. amikacin500 mg , inj. amikacin ( 250mg / 2ml ) , inj. amiodarone 150 mg , inj. amoxycillin + clav. acid1.2 g , inj. amoxycillin + clavulanic acid 1.2 gm , inj. amoxycillin 500 + clavulanic acid 100 mg , inj. amphotericin b 50 mg , inj. anti rabis immunoglobulin ( inj. arv ) , inj. antisnake venom 10 ml , inj. artemether 80 mg , inj. artesunate 60 mg , inj. artesunate 60mg , inj. arv / antirabies vaccine , inj. atracurium50 mg ( 5 ml ) , inj. atracurium 10 mg ( 2.5ml ) , inj. atropin 1 ml / 0.6 mg , inj. atropine 0.6 mg , inj. bupivacaine 0.5 % 20 ml , inj. bupivacaine 0.5 % 4 ml ( heavy ) spinal , inj. bupivacaine hydrochloride 0.25% 20 ml , inj. calcium gluconate 10% ( 10 mg ) , inj. calcium gluconate 10% 10ml , inj. carboprost 250 mg , inj. cefazolin1 gm , inj. cefoperazone 1000mg + sulbactam 1000mg , inj. cefotaxime sodium500 mg , inj. cefotaxime sodium500 mg / vial , inj. cefotaxime sodium 1 gm , inj. ceftriaxone500mg vial , inj. ceftriaxone ( 250mg vial ) , injection , inj. ceftriaxone+ sulbactam , inj. chlorpheniramine 25 mg , inj. ciprofloxacin 200 mg , inj. clindamycin 600 mg , inj. clindamycin 300 mg , inj. clindamycin 900 mg , inj. colistin3 miu , inj. colistin4.5miu , inj. colistin 2miu , inj. colistin 9miu , inj. deriphyline , inj. dexamethasone 8 mg , inj. dexmeditomidine 100 mcg / 1 ml , inj. diazepam 10mg , inj. diazepam 5mg , inj. diclofenac 25 mg , inj. dicyclomin 10 mg , inj. dicyclomine 10 mg , inj. digoxin 0.5 mg / 2 ml , inj. dilitiazemiv 25 mg , inj. dobutamine 250 mg , inj. dobutamine 250 mg ( 5ml ) , inj. dopamine 40 mg , inj. dopamine 5ml , inj. enoxaparine 40 mg , inj. enoxaparine 60 mg , inj. ephedrine30 mg / 1 ml , inj. esmolol 100 mg , inj. ethamsylate250mg , inj. etomidate 10 ml ( 2 mg / ml ) , inj. fentanyl 2 ml ( 50 mg / ml ) , inj. flumazenil 0.5 mg , inj. fortwin ( pentazocin ) 30mg , inj. frusemide 10 mg , inj. furosemide 40 mg , inj. gentamicin 80 mg , inj. gentamicin40 mg / ml , inj. gentamicin 40 mg , inj. gentamycin 80 mg / 2 ml , inj. glargin insulin 100 iu / ml , inj. glucagon 1 mg , inj. glycopyrrolate 1 ml / 0.2 mg , inj. haloperidol 2mg / ml , inj. hydralazine 10 mg , inj. hydrocortisone 100 mg , inj. hyoscine 20 mg / ml , inj. hyoscine butyl bromide 20 mg , inj. hyydrocortisone 100mg , inj. insulin nph , inj. insulin regular , inj. iron sucrose 100 mg iv 5 ml , inj. iron sucrose 50 mg / ml iv , inj. kcl 10 ml / 150 mg , inj. ketamine10 ml ( 50 mg / ml ) , inj. labetalol20 mg , inj. levetiracetam 500 mg , inj. levofloxcillin100 ml , inj. lignocaine 2 % ( 21.3 mg / ml 30 ml vial , inj. lignocaine 2%iv ( 30 ml ) , inj. linezolid 600 mg , inj. linezolid 600 mg 300 ml , inj. l orithine l asportate 5 gm , inj. loxicard 2% 20 ml iv , inj. mannitol 100 ml , inj. mannitol 100 ml , inj. mephentermine 30 mg / 1 ml , inj. meropenam + sulbactam1 gm , inj. methargine 0.5 mg , inj. methotrexate 100mg / ml , inj. methylcobalamin 500 mcg / 3ml , inj. methylprednisdone 500 mg , inj. methylprednisolone 1 gm , inj. metoclopramidehcl 5 mg / ml , inj. metoclopramide 5 mg / ml , inj. metoprolol 1 mg / ml ( 5 ml ) , inj. metoprolol 1mg / 5mliv , inj. metrogyl 100 ml , inj. mgso4 1 gm / ml ( 50% ) , inj. midazolam 1 mg / ml ( 5ml ) , inj. midazolam 1mg / 5ml , inj. mixtard insulin 100 iu / 10 ml , inj. morphine 1 ml / 10 mg , inj. moxiflox 400 mg iv , inj. multivitamin iv , inj. nalaxone 400 mg , inj. nefenamic acid 500 mg , inj. neostigmine +glycopyrrolate ( 2.5mg + 0.5mg ) 5 ml , inj. neostigmine 1 ml / 0.5 mg , inj. nitroglycerin25 mg / 5 ml , inj. noradrenaline 1ml , inj. noradrenaline 2 mg , inj. ondansetron2 mg / ml , inj. ondensetrone 8 mg / 2 ml , inj. oxytocine 10 iu , inj. pantaprazole 40 mg , inj. paracetamol 150 mg , inj. pheniramine 75mg ( 2ml ) , inj. phenylephrine 10 mg / 1 ml , inj. phenytoin 50mg , inj. phenytoin 50mg / ml , inj. pilocarpine nitrate ip 0.5 % w / v ( 1 ml ) , inj. piperacillin +tazobactam4.5 gm , inj. potassium chlorideiv 150 mg / 10 ml , inj. promethazine25 mg / 7.84 ml , inj. promethazine 25mg , inj. propofol 20 ml ( 10 mg / ml ) , inj. protamine sulfate 10 mg , inj. quinine 600 mg , inj. regular insulin 100 iu , inj. ropivacaine 0.7 % / 20 ml , inj. sodabicarbonate 10 ml , inj. streptokinase 1.2 mu , inj. succynyl choline 10 ml ( 50 mg / ml ) , inj. tecoplanin 200 mg , inj. tecoplanin 400 mg , inj. terlipressiniv 1 mg / 10 ml , inj. tetanns toxcid 5 ml , inj. thiopentanil sodium 500 mg , inj. tramadol 50 mg , inj. tranexamic acid 500 mg , inj. tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , inj. triamcinolone acetate 40mg / ml , inj. triamcinolone acetate 40mg / ml , inj. valethamate 10 mg , inj. vancomycin 1 gm , inj. vecuronium 10 mg , inj.botropase ( ( haemocoagulase 1cu ) 1ml ) , inj. verapamil 5 mg , inj. vit d33 l , inj. vit d3 6l , inj. vitamin k 10 mg , inj. xylocaine 2% intravenous , inj.adrenaline 1 ml , inj.dmpa 150 mg , tabmethyl prednisolone 16 mg , tab deriphylline ( etophylino 77mg + theophyline 23mg ) , tab fluconazole150 mg , tab fluconazole 100 mg , tab fluconazole 200 mg , tab fluconazole 300 mg , tab fluconazole400 mg , tab fluconazole 50 mg , tab hydroxyzine25mg , tab hydroxyzine 10 mg , tab.acebrophyllin + n acetyl cystine , tab.aceclofanc + paracetamol , tab.aceclofenac 100 mg , tab.amlodipine2.5 mg , tab.amlodipine5 mg , tab.amoxycillin + clavulanic acid625 mg , tab.amoxycillin 500mg , tab.aspirin 75 mg , tab.atorvastatin20 mg , tab.azithromycin 500 mg , tab.azithromycin 500mg , tab.buscopan 10 mg , tab.carvedilol 3.125 mg , tab.cefixime 200mg , tab.cepodoxime 200mg , tab.cepodoxime+clavulanic acid 325 mg , tab.cinnarizine + dimehydrate , tab.cinnarizine 25 mg , tab.clopidogrel 75 mg , tab.diclofanac+ paracetamol , tab.diclofenac 50 mg , tab.digoxin0.25 mg , tab.ethamsylate 250 mg , tab.fluconazole 150 mg , tab.furazolidone100mg , tab.glimeperide2mg , tab.glimeperide 1mg , tab.iron folic acid 400 mg , tab.lefulonamide10mg , tab.lefulonamide20 mg , tab.levocetrizine + montelukast , tab.levofloxacin 500 mg , tab.metformin 500 mg , tab.metoprolol 50 mg , tab.metronidazole 400mg , tab.nifedipine 10 mg , tab.nitrofurantoin 100 mg , tab.ofloxacine + ornidazole , tab.ofloxacine 200mg , tab.paracetamol 500mg , tab.paracetamol 650mg , tab.pheniramine maleate4 mg , tab.rabeprazole 20 mg , tab.telmisartan 40 mg , tab.thyroxine 25mg , tab.thyroxine 50mg , tab.thyroxine 75mg , tab.vildagliptin 50 mg , tab. acebrophyllin 100 , tab. acetazolamide 250mg , tab. acetylcysteine ( mucinac ) 600 mg , tab. acyclovir 800mg , tab. alprazolam0.5mg , tab. alprazolam 0.25 mg , tab. alprzolam 0.25mg , tab. amiodarone 100 mg , tab. amitriptyline 10 mg , tab. amitriptyline 25 mg , tab. amlodipin 5 mg , tab. amoxycillin + clavulanic acid625 mg , tab. arltemrthev+ lumefantrine , tab. ascorbic acid ( vitamin c ) 500mg , tab. asprin 150 mg , tab. asprin 75 mg , tab. atorvastatin 40mg , tab. azathioprine 100 mg , tab. azithromycin 500mg , tab. betahistine 8mg , tab. cabergoline 0.5 mg , tab. calcium + vit d3 500 mg , tab. carbamazepine 400mg , tab. carbimazole 10 , tab. cefelexin 500 mg , tab. cefixime 200 mg , tab. cefpodoxime200 mg , tab. cetrizine5mg , tab. cetrizine 10 mg , tab. chlordiazepoxide 10 mg , tab. chloroquine 500 mg , tab. cinnarizine ( 25 mg ) , tab. ciprofloxacin500 mg , tab. ciprofloxacin 250 mg , tab. clonazepam 0.5 mg , tab. clonazepam 0.25 mg , tab. cyclophosphamide 50 mg , tab. dapsone 100 mg , tab. dexamethasone 2 mg , tab. dexamethasone 4 mg , tab. dexamethasone 8 mg , tab. diclofenac + serratiopeptidase 10 mg , tab. dicyclomine 10 mg , tab. dicylomine 20 mg , tab. diltiazem 30 mg , tab. divalprox sodium 250 , tab. domperidone 10 mg , tab. drotaverine 40 mg , tab. escitalopram 10 mg , tab. etiophyllin + theophyllin 50 mg , tab. etizolam0.5mg , tab. etizolam 0.25 mg , tab. fexofenadine 120 mg , tab. fexofenadine 180 mg , tab. fluconazole 150mg , tab. furosemide 10 mg , tab. haloperidol 0.5mg , tab. hydrocortisone 100 mg , tab. hyoscine butyl bromide 10 mg , tab. ibuprofen 400 mg , tab. iron folic acid ( 100 mg +5 mg ) , tab. ivabradin 5mg , tab. labetalol 100 mg , tab. labetalol 200 mg , tab. levetriacetam 500 , tab. levocetrizine 10 mg , tab. levocetrizine 5 mg , tab. levocetrizine 5mg , tab. levofloxacin 250 mg , tab. levofloxacin 500 mg , tab. linezolid 600 mg , tab. mala n , tab. metformin 500mg , tab. methargine 0.2mg , tab. methotrexate 10mg , tab. methotrexate5mg , tab. methotrexate7.5 mg , tab. methotrexate 2.5 mg , tab. methyl prednisolone 32mg , tab. methylcobalamin / mecobalamin 500 mcg , tab. metoclopramide 10 mg , tab. metoprolol 25 mg , tab. metoprolol 50 mg , tab. metorolol 25mg , tab. metronidazole 200 mg , tab. misoprostol200 mg , tab. misoprostol 25 mg , tab. mv / b complex , tab. nefenamic acid&diclocylomine ( 500mg+ 20 mg ) , tab. nifidipin10 mg , tab. nintedanib 100 mg , tab. nintedanib 150 mg , tab. nitrofurantion 100 mg , tab. norethisterone 5mg , tab. norfloxacin 400 mg , tab. ofloxacin 200 mg , tab. olanzapine10 mg , tab. olanzapine 10mg , tab. olanzapine 5 mg , tab. ondensetron 4 mg , tab. oremeloxifene ( chhaya ) 30 mg , tab. oseltamivir 30mg , tab. oseltamivir75mg , tab. oseltamivir 45 mg , tab. pantaprazole+ domperidone , tab. pantaprazole 40 mg , tab. pheniramine 25mg , tab. phenytoin 100 mg , tab. pirfenidone200 mg , tab. pirfenidone400 mg , tab. prednisolone20 mg , tab. prednisolone 10mg , tab. prednisolone 10 mg , tab. prednisolone 5 mg , tab. prednisolone 5mg , tab. pregabatin + methylcobalamin 75 / 1500 , tab. pregasterone susline 200 mg , tab. propanolol 40 mg , tab. pyoridoxine sr 100 mg , tab. pyroxicame 10 / 20 mg , tab. pyroxicame 20 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. roflumilast 250 mg , tab. roflumilast 500 mg , tab. sodium valproate 500 , tab. thyrox12.5mg , tab. thyrox 100 mg , tab. thyrox 25 mg , tab. thyrox 75mg , l arginine + proanthocinidin ( argipreg ) sachet granules , tab. tramadol 100 mg , tab. toclizumab5 mg , tab. torsemide 10 mg , tab. tramadol50mg , tab. trypsin / chymotrypsine colloidal / sessatiopeptidase 100000 au , tab. ursodeoxycholic acid 300 mg , tab. verapamil 40 mg , tab. vitd3 60 k , tab. vitamin. b complex ( nfi ( prophylactic ) ) , tab. zinc oxide 20 mg , tab.doxyllamine+pyridoxine , tab.dydrogesterone 10 mg , tab.misoprostol 600 mcg , tab.ofloxacin+ornidazole , tab.thyrox 50mg , betadine pessary 200mg , tab. mtp kit ( mifepristone 200 mg+misoprostol 200 mg ) , tab.trenexa+ethamsylate , ors sachet , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , glucose powder , hiv kit / hbs ag ( surgical ppe kit ) , ketopatch , diclofenac patch , cholecalciferol granules 60000 iu , cap. ampicillin ( 250 mg ) , cap. b complex minerals with zinc , cap. doxycycllin 100 mg , cap. itraconazole200 mg , cap. methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg , cap. itraconazole 100 mg , cap. vit e 200 , cap. vit e 400 , cap. vitamin a 1 lakh iu , creamliquidparaffin , cream clotrimazole 1% 30 gm tube , cream soframycin , creambeclomethasone 30 gm tube , creambetamethasone20 gm tube , creamfusidic acid 15 gm tube , creamketoconazole 15 gm tube , cream clobetasol propionate0.5 % , cream acyclovir 5% ( 5gm ) , cream estriol 1% ( 1.5 gm ) , diclofenacgel 30 gm tube , dinoprostron gel 0.5 mg , neomycin sulphate+bacitracin zinc5mg+500 iu / gm ointment15gm tube , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment 15gm tube , oint. choline salicylate + benzalkonium chloride9% + 0.02% ( 10 gm ) , oint acyclovir. 5g , oint soframycin 10 gm , oint. chloramphenicol +dexamethasone ( 1%+0.1% ) , oint. choline salicylate + lidocaine , oint. clobectasol + salycylic acid 3 % , oint. mupirocin 2% , oint. neosporin5 gm tube , oint. povidone15 gm tube , oint. silver nitrate 15g , oint.mupirocin ( 2% w / w ( 5 gm tube ) , oint. mupirocin ( 2% w / w ( 5 gm tube ) , oint. lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) , ointment betadine 2% 5gm , placenta extract gel 20g , eye ointment ciprofloxacin0.3% ( 3gm tube ) , oint. clindamycin gel 5 gm , oint. gentamycin sulphate 0.1% ( 15gm tube ) , , ointment metrogyll p 2% , xylocaine spray 10 % , eye drop cyclopentolate 1% w / v ( 5 ml ) , , eye drop dexamethasone + gentamycin 0.1%+0.3% , eye drop carboxymethylcellulose sodium 0.5% ( 10ml ) , eye drop sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop timolol maleate0.5 %w / v ( 5 ml vial ) , eye drop gatifloxacin 0.3% 5ml , eye drop. phenylepherine hcl & tropicamide 5% + 1% 5 ml , eye drop tobramycin ( 0.3% 5ml ) , eye drop proparacaine 0.50% 5 ml / vial , eye drop. carboxymethylcellulose ip 1% w / v 10ml vial , hydroxypropyl methylcellulose ophthalmic solution 2% , hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop , eye drop olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , , eye drop providone iodine 1% ( 5 ml ) , eye drop fluconazole 3 mg ( 10 ml vial ) , eye drops pilocarpine 4% , eye drops pilocarpine hydrochloridebp 2% , eye drop ciprofloxacin+ dexamethosone ( 0.3%+0.1% ) , eye drop ofloxacin 0.3% w / v ( 5 ml vial ) , eye drop. lignocaine hydrochloride ( 4% ( 5 ml vial ) , eye dropmoxifloxacin + prednisolone 5 mg + 3 mg / 5 ml , eye dropmoxifloxacin 0.5% w / v ( 5 ml ) , , ear wax cerumenolyticeach 10 ml , nasal drop xylometazoline ( 0.1%w / v 10 ml vial , nasal spray calcitonin30 mcg , bss solution for opthalmic use ( 500ml ) , solution , eye drop atropine sulphate 1% ( 5 ml vial , ear drops gentamycin + hydrocortisone 0.3% + 1% , eye drophomatropine 2 % ( 5 ml ) , , eye drop ciprofloxacin 0.3% ( 5ml vial ) , ciprofloxacin eye ointment 0.3% ( 3gm tube ) , syp.b complex 100 ml , syp. alkacitral ( disodium hydrogen citrate ) 1.4g / ml , syp. cyproheptadine 100 ml , syp. dextrometharphin 100 ml , syp. lactulose 150 ml , syp. liv 52250 ml , syp. prednisolone 10 mg , syp. prednisolone 20 mg , syp. prednisolone 5 mg , syp. vitamin a ( 10000o iu ) 100 ml , syrp. paracetamol 125 mg ( 60ml bottle ) , syringe 50 ml , syrp. alkalizer100 ml , syrp. anti oxidant lycopen 200 ml , syrp. dextromethorphan + chlorpheniramine , syrp. dextromethorphan 10mg / 5ml ( 100ml bottle , syrp. lactulose 60 ml , syrp. potassium chloride 100mg / ml , syrp. potassium chloride 200 ml , syrp. sucralfate + oxetacaine , syrp. ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 100ml , syrp. amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) , syrup antacid , clotrimazole pessary 100 mg , clotrimazole pessary 500 mg , budecort inhaler200 mcg , budesonide inhaler ( foracort ) 0.5 mg , budesonide respules 0.5 mg , buprenorphine patch , tiotropium 18ugmdi / dpi , tiotropium 9ugmdi / dpi , xylocaine viscoussolution 4% , total parentral nutrition ( tpn ) 1 litr. , total parentral nutrition ( tpn ) 500mlperiferal , sporolac sachet ( 5 millions lactobacillus ) , soda lime granule5 kg , sodium phosphateenema 100 ml , hydrogen peroxide 3% ( 500 ml ) , surgical spirit500 ml , sevoflurane inhalation , salbutamol respules 5ml ( asthalin ) , sanitizer 500 ml , savlon solution500 ml , povidonelotion10 % 500 ml , povidonelotion5 %500 ml , povidonelotion7.5% 500 ml , peglec sachet , nebul.levosalbutamol+ipratopium bromide , liquid paraffin500 ml, bottle ) , solution , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial , lignocaine 2% jelly , iv d10% 500 ml , iv d25% 100 ml , iv ns3 % 100 ml , iv ns 0.45% 500 ml , iv. fluiddns 500ml , iv. fluidringer lactate500ml , iv fluid normal saline 500 ml , iv infusion volulyte 6 % ( hestarch ) 500 ml , iv. normal saline 0.9 % 100 ml , iv isolyte m 500 ml , iv isolyte p 500 ml , iv intralipid 20 % 100 ml , iv. intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs , isoflurane refiller 250 ml , insulin syring 40 iu 1 ml , hydrogen peroxide soln 100 ml , iv. hexa starch / voluvin 500 ml , hand sanitizer 1 ltr. , glutraldehyde 2.45 % , iv glycerine ip ( 100ml bottle ) , iv. glycerine / acriflaxin 100 ml , formetrol6 mcg + budesonide400 mcgmdi / dpi , formetrol6 mcg + budesonide 200 mcgmdi / dpi , formalin soln37 to 41 % ( 5 litr ) , enterogermina , disposable syringe 10 ml , disposable syringe 20 ml , disposable syringe 5 ml , disposablesyringe2 ml , disposable syringe50 ml , disposable needles26g , disposable needles24g , disposable needles22g , disposable needles20g , disposable needles18g , disposable needles16g , double arm nylon monofilament with 8 0 ( 3 / 8circle taper point needle ) , , disposable surgicalgloves6 no , disposable surgicalgloves6.5 no , disposable surgicalgloves 7no , disposable surgicalgloves 7.5no , disposable surgicalgloves 8no , latex examination gloves large , latex examination gloves medium , dynaplast 2 inch adhesive bandage , dynaplast 3 inchadhesive bandage , dynaplast bandage 10 cm * 4 m , disposable surgical mask , dustbin big 60 litr ( red / blue / black ) , dustbin small 30 litr ( red / blue / black ) , cotton cloth guaze than , cotton crape bandage 10cm x 4m , cotton crape bandage 15cm x 4m , cotton khadi curtain, 1.75 mt, , cotton khadi matress, 3x6 feet, 10.0kg, , cotton roll 500 gm , chadar check rangeen 84 inch x 48 inch , chadar rangeen 60 inch x 90 inch , blanket jammu woolen plane, 54x90 inch, , endotracheal cuff pressure manometer , endotracheal tube introducer ( stylet ) adult , endotrachial tube ( protex ) size 6, ( cuffed ) , endotrachial tube ( protex ) size 6, ( uncuffed ) , endotrachial tube ( protex ) adult size , 7 ( cuffed ) , endotrachial tube ( protex ) adult size , 6.5 ( cuffed ) , endotrachial tube ( protex ) adult size 7.5 ( cuffed ) , endotrachial tube ( protex ) adult size 8, ( cuffed ) , endotrachial tube ( protex ) adult size 8.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size 5.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size , 3 ( uncuffed ) , endotrachial tube ( protex ) padeatric size 2.5, ( uncuffed ) , endotrachial tube ( protex ) padeatric size 5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 3.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4, ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 5, ( cuffed ) , epidural needle with catheter ( mini pack ) size 18 g , et tube ( cuffed ) 7no , et tube ( cuffed ) 6.5 no , et tube ( cuffed ) 7.5 no , et tube ( cuffed ) 8no , et tube ( cuffed ) 8.5 no , et tube 6 no. uncuffed , et tube 7 no. uncuffed , ethibond ( polyster suture ) 1 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 2 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 3 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 5 0 round body 1 / 2 circle 75 cm , nylon clear monofilament 1 024 mm reverse cutting 75 cm , nylon clear monofilament 2 0 24 mm reverse cutting 75 cm , nylon clear monofilament 3 0 24 mm reverse cutting 75 cm , nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , poly propylene monofilament 0, 30mm 1 / 2 circle75 cm , poly propylene monofilament 1, 30mm 1 / 2 circle75 cm , polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , polyglactin 0, 31mm 1 / 2 circle 70 cmreverse cutting , polyglactin 1 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 2 0, 31mm1 / 2 circle 90 cm round bodied , polyglactin 2 0, 31mm 1 / 2 circle 70 cm reverse cutting , polyglactin 3 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 4 0, 31mm 1 / 2 circle 70 cm round bodied , polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , catgut 1 0 round bodied 1 / 2 circle 76 cm , catgut 2 0 round bodied 1 / 2 circle 76 cm , polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm length 75 cm, 12 foils per packet , b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical suture , synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) , silk suture 1 01 / 2 round circle black braided 24 mm 76 cm , silk suture 2 01 / 2 round circle black braided 24 mm 76 cm , silk suture 3 01 / 2 round circle black braided 24 mm 76 cm , absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 , silk suture 4 01 / 2 round circle black braided 24 mm 76 cm , roll bandage 05 cm x 05 m , roll bandage 10 cm x 05 m , roll bandage 15 cm x 05 m , roll bandage 7.5 cm x 05 m , ryles tube10 no. , ryles tube 12 no. , ryles tube size 14 , ryles tube size 16 , ryles tube size 18 , schantz pin 4 mm , schantz pin 4.5 mm , schantz pin 5mm , romo vac set 14 , romo vac set 16 , rubber sheet ( small ) , rubber sheet ( large ) , silicon mask adult size 0 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 01 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 02 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 03with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 04with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 05 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask paediatric size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask size 0 paediatric with connection tube, reservoir bag and valvepaediatric ( jackson rees circuit ) , silicon mask size 1 paediatric with connection tube, reservoir bag and valve, paediatric ( jackson rees circuit ) , , oxygen mask adult , non rebreathing mask , sics blade cresent ( 15 degree ) , simcoe i / a cannula, direct , skeletal traction kit , skin grafting blade ( downys blade ) , skin traction kit , spinal needle size 25 g , spinal needle size 26 g , spinal needle size 27 g , ss wire20g , ss wire 18 g , ss wire 22g , st pin 4 mm , st pin5 mm , st pin 4.5 mm , suction catheter 10 no , suction catheter 12 no , suction catheter 14 no , suction catheter 16 no , suction catheter 18 , suction tube10no , suction tube12no , suction tube14no , suction tube 8no , surgical steel drum 11*9inch , surgical steel drum 12*10inch , surgical steel drum 15*12 inch , surgical steel drum 6*6inch , surgical steel drum 6*9inch , surgical steel drum 9*9inch , surgical bladesize 15 , surgical blade , size 22 , surgical bladesize 23 , surgical blade , size 24 , surgical blade, size 11 , surgical cap disposable , ultrasoundjelly 250 gm , ecg jelly 250 gm , echo cardiography250 gm , view box size 14x17 , view box size 8x17 , weighingmachine mechenical , white ( sharp container ) 10 litr , whole sheet 35 inch x 35 inch , wound suction catheter ( no 18 ) , each , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , laryngoscope ( adult ) with bladesize 2, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 1, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 0, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 2 , laryngoscope ( paedeatric ) a machintoshb miller blade size 00, , laryngoscope ( paedeatric ) a machintosh blade size 0, , laryngoscope ( paedeatric ) a machintosh blade size , 1, , lma ( i gel ) size 1.5 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , lma ( i gel ) size 1 , lma ( i gel ) size 2 , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size 1, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , ( c mac ) video laryngoscope with complete blade set , maccoy laryngoscope with bladesize 5 , magill forcep ( adult ) , magill forcep ( padeatric ) , iv cannula ( two way ) size 24 , iv cannula 16 no. , iv cannula 18 no. , iv cannula 20 no. , iv cannula 22 no. , k wire1.6mm , k wire2mm , k wire2.5 mm , k wire 1 mm , k wire 3mm , kit 1 , kit 2 , kit 6 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating lma ( i lma ) fastrac 6.5 , intubating bougie , hernia mesh 15x15 , hernia mesh 3x6 , head ring ( adult ) , head ring ( peadia ) , guedalsairway size , 0, , guedalsairway size , 2, , guedalsairway size , 5 , guedalsairway size 00, , guedalsairway size 000, , guedalsairway size 1, , guedals airway size , 4, , guedals airway size 3, , glucometer , glucometer strips , hmef, filter, heat and moisture exchanger with viral filter ( hmef ) , formalin chamberthree tray ( 24*8*8 ) inch , formalin chamber three tray ( 20*8*8 ) inch. , formalin chamber two tray ( 16*8*8 ) inch. , foley catheter 20 no. 3 way , foley catheter 22 no. 3 way , foley’s catheter 16 no. , foley’s catheter12 no. , foley’s catheter14 no. , foleys catheter size10 , foleys catheter size18 , foldable iol sterile lens + 19.5d , foldable iol sterile lens + 19d , foldable iol sterile lens + 20.5d , foldable iol sterile lens + 20d , flexometallictube ( armored tube ) , 6.5 , flexometallictube ( armored tube ) , 7 , flexometallictube ( armored tube ) , 7.5 , flexometallictube ( armored tube ) , 8 , flexometallictube ( armored tube ) 6, , flexometallictube ( armored tube ) 8.5 , electric surgical instrument boiler ( 20*8*7.5 ) inch , electric surgical instrument boiler ( 24*8*8 ) inch , ecg paper a4 size , echo cardiography rollpaper , 3 way cannula ( triway ) , 3 way extension 100 cm , 3 way extension 25 cm , abdominaldrain adk drain no. 28 , abdominaldrain adk drain no. 30 , ansathesia face mask silicone transparentsize , 4 , ansathesia face mask silicone transparentsize , 5 , ansathesia face mask silicone transparentsize 0 , ansathesia face mask silicone transparentsize 00 , ansathesia face mask silicone transparentsize 1 , ansathesia face mask silicone transparentsize 2 , ansathesia face mask silicone transparentsize 3 , ansthesia work station disposable circuit ( adult ) , ansthesia work station disposable circuit ( paedeatric ) , centralvenous catheterkit ( adult ) , centralvenous catheterkit ( paedeatric ) , ambu bag ( padeatric ) 150 ml , ambu bag ( padeatric ) 250 ml , stethograph , analytical digital balance , perimeter ( priestley smith ) s / lp.984 b & t , long knee brace , knee cap , finger splint , wrist hand stabillizer , cock up splint , thumb spica splint , arm pouch , universal shoulder immobillzer , clavicular brace , neck collar soft , nack collar hard , l s belt , forearm brace , anklet , crepe bandage 4 inch , crepe bandage 6inch , dynaplast , stockinette / soft roll , walker , sodium borate 1 kg , sodium citrate 1 kg , pipracelline+tezobactum inj ( 4.5 gm ) , inj. tranexamic acid 500 mg , inj. lebetalol 5 ml , inj. magnesium sulfate , kelleys pad , povidone solution 5% 500 ml , inj methergine 0.2 mg , inj mgso4 50% , catgut 1 no suture , vicryl 1 no ( round bodied needle ) suture , inj epidosin , inj drotaverine , urine for albumin strip , cerviprime gel 0.5 mg , inj anti d ( 300 microgram ) , edta vial , b.p. instumanet with all size cuf , anterior vaginal wall retractor , ovum forceps ( medium size 05 ) ( small size 05 ) , blakes uterine curette , karmans cannula set ( 05 no ) , karmans cannula set ( 06 no ) , karmans cannula set ( 08 no ) , karmans cannula set ( 12 no ) , hegars cervical dilator set , mva syringe along with cannula , uterine sound , vullselum , tab. tranexa , tab. misopristol , cotton guaze pad , nylon suture 3 0 , nylon suture 4 0 , suction catheter 06 no , suction catheter 07 no , suction catheter 08 no , iv metronidazole 100 ml , iv ringer lactate 500 ml , iv normal saline 100 ml , mackintosh sheet , laryngo scope neonate blade size 0 / 1 , cidex solution 5 ltr , surgical drum 12×15 , surgical drum 11×13 , surgical drum 9×11 , surgical tray medium , surgical tray large , povidone onitment 250 gm , digital fuji x ray film 8*10 ( 1×150 ) , posterior chamber intra ocular lens ( pciol ) ( pmma, single piece, size 6mm optics total 13mm ) 10 d , pciol / / 12 d , pciol / / 14 d , pciol / / 16 d , pciol / / 17 d , pciol / / 17.5 d , pciol / / 18 d , pciol / / 18.5 d , pciol / / 19 d , pciol / / 19.5 d , pciol / / 20 d , pciol / / 20.5 d , pciol / / 21 d , pciol / / 21.5 d , pciol / / 22 d , pciol / / 22.5 d , pciol / / 23 d , pciol / / 23.5 d , pciol / / 24 d , pciol / / 25 d , pciol / / 26 d , pciol / / 27 d , pciol / / 28 d , pciol / / 29 d , pciol / / 30 d , anterior chamber intra ocular lens ( aciol ) , kelman multiflex model ( pmma, single piece, size 6mm optics total 13mm ) 16 d , aciol / / 17 d , aciol / / 18 d , aciol / / 19 d , aciol / / 20 d , viscoelastic substance ( pre filled syringe ) , trypan blue dye , hylase injection , lignocaine 4% drops , pilocarpine injection , epitrate injection , virgin silk suture6 0 , monofillanent nylon suture ( double ended ) , surgical blade 15 number , vicryl suture 6 0 , keratome blade , crescent blade , side port , tab. diamox , spirit lamp , r.o. machine for washing and scrubings , formiline chamber , white and green cloth , uv sterilizer , color vision chart – original ishihara , near vision chart with different languages , torch with yellow light , maddoxrod , maddox wing , diplopia goggles , bipolar wetfield cautry , placido disc , prism bar , cryo unit , non contact tonometer , multi media projector with screen , hess screen chart , usg –a scan , corneal loupe , indirect ophthalmoscope with +20 and +30 volk lenses , direct ophthalmoscope , snellen’s chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , streak retinoscope , keratometer , synaptophore , chalazion set , autoclave , drum ( large, medium, small ) , kidney tray ( large , medium , small ) , bowl , infrared thermometer , chittle forceps , boiler ( small and large ) , stainless steel traywith cover ( small and large ) , schiotz tonometer , intraocular lens 15 no to 27 no , intraocular lens 27 no , methylene blue dye , balancde salt solution , dextrose 5 % , dextrose 10 % , inj. epitate , inj.derriphyline , inj.botroclot , xylocaine jelly , inj.mitomycin c , thread ( 100 no ) , ethilon suture ( 4 0 ) , ethilon suture ( 6 0 ) , i / v set , needle ( 26.5 ) , syringes ( 5 ml ) , syringes ( 10 ml ) , syringes ( 20 ml ) , syringes ( 5 ml ) , n 95 mask , disposable eye drape , eye towel , intracatheter , inj mannitol , inj avil , chlorine solution 500 ml , betadene solution , ppe kit , betadene scrub , hydrogen peroxide solution , inj. betamethasone 4 mg , inj oxytocin 10 iu , drotaverine 40 mg / 2ml , inj. vit k , inj. dizepam , inj iron sucrose , tab. misoprostol 200 mg ( 4 tab. pack ) , baby tag , tab. tranexamic acid 500 mg , umblical cord clamp large size , rubber catheter plain , yankurs suction tube , weight machine neonatal , weight machine adult , dressing steel tray 12×15 , dressing steel tray medium , dressing steel tray small , dressing drum 12×15 , dressing drum 13×11 , electric sterlizer 20×8×6 , dettol shop 20 gm , polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm length 90 cm size 1 ) vicryl , prolene 1 rb 1 / 2 circle 30 mm l 70 cm ( 12 foils / pkt ) needle , ethicon 2 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , ethicon 3 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , b.b silk ( 12 foils / pkt ) ( 1 / 2 rcut needle 45 mm length 76 cm size 2 / 0 ) , stylet ( adult ) , stylet ( paedia ) , enema port , phosphate enema , methanol ( 50 ltr. per container packing ) , glycerin ( 50 ltr. per container packing ) , phenol , thymol crystals , 1 % eosin , winter green perfume ( oil of winter green ) , gasket , microbiological filter , printer paper , heater , hepa filter , printer ink ribbon , bowie & dick test strip , biological indicator , documentation label ( 1 roll of 750 ) , packaging indicator , cleaning indicator , ink roll labelling gun , chemical indicator ltsf , biological indicator ltsf , sterilization reel 50×200 mtrs ltsf , sterilization reel 75×200 mtrs ltsf , sterilization reel 100×200 mtrs ltsf , sterilization reel 200×200 mtrs ltsf , sterilization reel 250×200 mtrs ltsf , sterilization reel 300×200 mtrs ltsf , cartridge filter , antiscalant chemical ( cane of 40 ltr ) , calcitonin nasal spray 30 mcg , tab. lefulonamide 10 / 20 mg , tab. pyroxicame 10 / 20 mg , tab.toclizumab 5 mg , k wire 1 mm , k wire 1 .5 mm , k wire 1 .5 mm , k wire 2 mm , k wire 2.5 mm , k wire 3 mm , st pin 4 mm , st pin 4.5 mm , st pin 5 mm , ss wire 18 g , ss wire 20 g , ss wire22 g , stirrup , vicryl 2.0 rc , vicryl 3.0 rc , vicryl os 8 , vicryl os 6 , ethibond 2 no , ethibond 5 no , ethilone 1.0 , ethilone 2.0 , ethilone 3.0 , nylon 1.0 , nylon 2.0 , nasal prong , infant feeding tube 5 , infant feeding tube 6 , infant feeding tube 7 , infant feeding tube 8 , infant feeding tube 9 , diaper , identification band , disposable sheets , umblical catheter , centralline 3 fr , centralline 4 fr , centralline 5 fr , peadia set , alcohol based hand rub , formalin ( 50 ml bottel ) , phenyl ( 500ml ) , liquid handwash ( 500ml ) , disposable mark , disposable cap , sleeper , oxygen connecting tube , steel spoon , steel bowl , inj. normal saline ( 500 ml ) , inj. normal saline ( 200 ml ) , inj. isolyte p ( 500 ml ) , inj. ringer lactate ( 500 ml ) , inj. adreraline , inj. sodium valproate , inj. levepril ( levetirautam ) , inj. cefotaxim ( 250 mg ) , inj. cefepine , inj. pantop , inj. aciloc , ivig , inj. methyprednisolone , inj. mepropencm ( 235 mg ) , inj. sodabicarb ( 10ml ) , inj. capnea , inj. metronidazol ( 100 ml ) , inj. fluconzole , inj.botropose , inj. ampicilin , inj. teicoplanin , inj. 3% normal saline , inj. aminoveir , levosalbutamol respule , budecort respule , inj. amphotericin , syp paracitamol ( 5ml=125 mg ) , syp. ibuprofen , syp. dextromethorphen , syp. bromohexine , syp. calcium , drop multivitamin , syp. phenobarbitone , syp. cefixim ( 5ml=50 mg ) , drop domperidone , drop paracetamol , saline nasal drops , tobramnycin eye drop , hmf sachet ( lactodex ) , tab paracetamol , tab. amoxyclav , syp. amoxycalv , syp cetrizine , syrup zinc ( 20 mg ) , syrup phenytoin , syrup multivitamin , formalin ( 5 ltr packing ) , formalin ( 1 ltr packing ) , formalin ( 50 ltr per container packing ) , color vision chart —original ishihara , near vision chart with different languages , torchwith yellow light , maddox wing , diplopia goggles , placido disc , corneal loupe , snellens chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , chalazion set , stainless steel tray with cover ( small and large ) , schiotztonometer , cotton absorbent ( 1 / 2 kg ) , blood group antisera ( abd ) , potassium nitrate , potassium acetate , sodium acetate , inj. acyclovir , inj. surfactant ( serventa ) ...

Department of Higher Education - Madhya Pradesh

29978881 bids are invited for dissecting microscope as per specification , water bath 12 holes as per specification , magnetic stirrer as per specification , digital spectrophotometer as per specification , rotary microtome erma type as per specification , centrifuge machine as per specification , water and soil analysis kit as per specification , inclined monocular microscope as per specification , heating mantles as per specification , vertical slab gel system with supply as per specification , binocular microscope as per specification , fume hood size 3’x2’x2’ as per specification , paper electrophoresis unit as per specification , digital weighing scale as per specification , uv lamp for tlc analysis as per specification total quantity : 1...

Madhya Pradesh Public Health Services Corporation Limited - Madhya Pradesh

29849850 rate contract of anatomy department equipment to be supplied and installed at various hospitals of government of madhya pradesh for a period of 18 months , anatomy department equipment , hand drill , articulated skeleton set , bones ( dis articulated ) sets , microtomes, sledge, large cutting...