Directorate Of Medical Education - Madhya Pradesh

39769516 supply of e injection, iv fluid, tablet, capsul, srup, solution, eye drop, ointment, cream, powder, gel, spray, inhaler , injection, iv fluid, capsul, syrup, solution, eye drop, ointment, cream, powder, gel, spray, inhaler , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 375 mg cap. , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , aprepitant 125 mg+aprepitant 80 mg capsule kit , calcitriol 0.25mcg soft geletine capsule , chloramphenicol 250 mg capsule , chloramphenicol 500 mg capsule , cholecalciferol ( vitamin d3 ) capsules 60000 iu , clindamycin 300mg capsule / tab ( 10x10 ) , tablet capsule , clindamycin 600mg capsule / tab ( 10x10 ) , tablet capsule , crizotinib capsules 250mg , cyclosporine 100 mg , cyclosporine 50 mg , deferiprone 500 mg cap. , doxycycline 100 mg , fluoxetine 40 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , lenalidomide ( 10mg ) , capsule , lenalidomide ( 25mg ) , capsule , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid 1.5 mcg thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) cap. , omeprazole 20 mg , orlistat capsule usp 120 mg , orlistat capsule usp 60 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , palbociclib 100 mg cap , palbociclib 125 mg cap , palbociclib 75 mg cap , pancreatic enzymes 20000 iu capsule , pancreatic enzymes 25000 iu capsule , pancreatic enzymes 8000 iu capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rabeprazole 20mg , tablet or capsule , racecadotril capsules ip 100mg , rifaximine 400 mg , sildenafil 20mg , sunitinib malate capsules 50 mg , temozolamide 100 mg , temozolamide 250 mg , tetracycline 250 mg capsule , tetracycline 500 mg capsule , topotecan hydrochloride capsules 1 mg , vitamin e usp ( 400 mg ) , capsule , acyclovir 3%w / w 5 ml vial , atropine sulphate 1% 5 ml vial , beclomethasone ( 0.025% ) + clotrimazole 1% + neomycin sulphate 0.5%5 ml ear drop , benzocaine 2.7% w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v + turpentine oil 15% w / v ear drop , carboxymethylcellulose solu. eye drop 0.5% , carboxymethylcellulose solu. eye drop 1% , ciprofloxacin eye drop 0.3% 10 ml , fluromethanol eye drop , gatifloxacin ophthalmic solution 0.3% w / v 5ml vial , gentamycin eye drop , homatropine hydrobromide 2 %w / v 10ml eye drops , homatropine hydrobromide 2 %w / v 5ml eye drops , lignocaine hcl 4% eye drop , loteprednol eye drop , methyl cellulose / visco elastic , moxifloxacin +prednisolone eye drope , moxifloxacin 0.5% eye drop , natamycin eye drop , nepafenac ophthalmic solution , ofloxacin 0.3% 5 ml vial , olopatidine hydrochloride ophthalmic solution 0.1% , pilocarpine eye drops 2% , polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml , polyvinyl alcohol 1.4% 5 ml , povidone iodine 5% solution eye drop 5ml , prednisoloneeye / drop. , proparacaine , sodium chloride opthalmic solution 5% eye drop , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , topicamide +phenylephrine eye drop , tropicamide 1% 5 ml vial , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment , tobramycin eye oint.3gm tube , medical nitrous oxide gas , benzocaine gel usp 20% w / w 15gm tube , chlorhexidine gluconate 1.0% w / w 15gm tube , choline salicylate and lignocaine hydrochloride 10 gm tube , diclofenac gel 1% 30 gm , dinoprostone 0.5 mg 3 gm pre filled syringe gel , ecg gel 250ml bottle , lignocaine hydrochloride 2% w / v gel , oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle , triamcinolone acetonide dental paste usp, 0.1% 5gm tube , ultra sonograph gel 250ml bottle , white petroleum jelly kg , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin200 mg / 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% 500 ml glass bottel with rubber cork , dextrose saline ( dns ) 5% + 0.9% 500 ml ffs bottle , dextrose with saline ( 5% + 0.45% ( 500ml ffs bottle ) ) , injection , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection type iii ip ) , type iii ip 500 ml ffs bottle , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) type i ip 500 ml ffs bottle , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion 500 ml ffs bottle , levofloxacin 500 mg / 100 mlffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 mlffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 200mg / 100 ml bottle , ornidazole iv 500mg / 100ml ( 100ml bottle ) , infusion , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle , total parenteral nutrition 1000 ml with 763 kcal dextrose 15% w / v, amino acids 10% w / v with electrolytes & intravenous fat emultion triglycerides 20% w / v ) ( all in one inthree chamber bag ) , 1000ml , total parenteral nutrition ( including carbohydrate + proteins + fats solution 2000 ml ) , infusion , budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension , sevoflurane usp inhalation anesthetic 250 ml ( 250 ml ) , bottle , desflurane 240ml bottle , formoterol + budesonide ( 6 mcg + 100 mcg / puff ( 120 mdi ) ) , inhaler , ipratropium bromide ( 250 mcg / ml respules / ampoule ) , inhalation , isoflurane inhalation 250 ml bottle , levosalbutamol ( 1.25mg ) , ipratropium ( 500mcg ) respule ( 3ml ) , ampule , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , sterile acetylcysteine solution usp 20% w / v 2ml respules , salmeterol 25 mcg + fluticasone 125 mcg ( 120mdi ) , inhaler , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actrapid penfill 100iu / 3 ml injection , acyclovir inj ( 250 mg / vial ) , injection , acyclovir inj ( 750 mg / vial ) , injection , acyclovir intervenous infusion i.p ( 500mg / vial ) , injection , adalimumab ( 20 mg / 0.4 ml vial ( pfs / vial / ampule ) ) , ampule , adalimumab ( 40 mg / 0.8 ml vial ( pfs / vial / ampule ) ) , ampule , adenosine ( 6 mg / 2ml ) , injection , ado trastuzumab emtansine 100 mg inj , adrenaline ( 1 mg / ml ( 1 ml amp ) ) , injection , aflibercept injection for intravitreal 2mg / 0.05ml vial , alamine 8.2gm+l glutamic acid 13.46gm 100 ml bottle i / v , alteplase for injection 50mg vial , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle , amikacin250mg / 2 ml 2 ml vial , amikacin ( 500mg / 2ml ( 2ml vial ) ) , injection , aminophylline ( 25 mg / ml 10 ml vial ) , injection , amiodarone 50mg / ml ( 3ml vial / amp ) , injection , amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection , amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection , amphotericin b inj ip 50 mg ( liposomal amphotericin b also acceptable ) , injection , ampicillin ( 500 mg / vial ) , injection , ampicilline 1000mg + sulbactam 500mg, injection , anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection , anti rabies vaccine i.p. inj. human ( tissue culture ) for i / d and i / m route 2.5 iu with ( 1ml diluents ) , vial , anti scorpion venominj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial , anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection , anti thymocyte globulin ( 250mg / 5ml ) , injection , anti thymocyte immunoglobulin ( rabbit ) ( 5mg / ml ( 25mg vial ) ) , injection , artesunate ( 60 mg / vial ) , injection , ascorbic acid 100mg / ml 5ml amp ( vitamin c ) inj , atracurium ( 10mg / ml ) , injection , atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection , azithromycin 100mg / 5ml inj , azithromycin 500mg / 5ml inj , bendamustine ( 100mg vial ) , injection , benfotiamine7.5mg +folic acid ip 0.75mg +methylcobalamin jp 750mcg +pregabalin ip 75mg +vitamin b6 ( pyridoxine hcl ip 1.5mg ) injection , benzathine penicilline 12 lac iu / vial ( vial ) , injection , betamethasone sodium phosphate ( ml contain betamethasone sodium phosphate equal to 4mg of betamethasone ( 1ml amp ) ) , injection , bevacizumab 100 mg ( 4 ml vial ) , injection , bleomycin ( 15 units / vial ) , injection , bortezomib ( 2.5mg ) , injection , bortezomib ( 2mg ) , injection , bortezomib ( 3.5mg ) , injection , botulinum toxin type a injection 100units / vial , botulinum toxin type a injection 200units / vial , brilliant blue g solution 0.05% w / v , brolucizumab solution for injection 120mg / ml , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp 4 ml amp , bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulfan ( 6mg / ml ( 10ml vial ) ) , injection , butorphanol 1mg / ml 1ml amp , c3r dye riboflavin hypotonic , c3r dye riboflavin isotonic , caffeine citrate inj. ( 20mg / ml 1 ml vial ) , injection , caffeine citrate inj. ( 20mg / ml 3 ml vial ) , injection , calcium carbonate 10% 10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% ( 10ml vial / amp ) , injection , calcium leucovorin ( 50 mg / vial inj ) , injection , carboplatin ( 150mg 15 ml vial ) , injection , carboplatin ( 450mg 45ml multidose vial ) , injection , carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection , carmustine injection ip 100 mg vial , cefazolin inj ( 500mg vial ) , injection , cefepime 500mg and tazobactam 125 mg inj ( vial ) , injection solution for , cefepime ( 500mg injection ) , injection , cefoperazone + sulbactam 1000 mg +500 mg vial , cefoperazone 1000mg + sulbactam 500mg inj ( vial ) , injection , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial ( 1000 mg + 500 mg ) , injection , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime inj ( 500mg / vial ) , injection , ceftazidime ( 250mg / vial ) , injection , ceftriaxone 1 gm / vial , ceftriaxone 1000 mg+disodium edetate 37 mg+sulbactam 500 mg powder for solution for infusion , ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection , ceftriaxone ( 500mg vial ) , injection , ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection , cefuroxime ( 1.5 gm ) , injection , cefuroxime ( 1000 mg ) , injection , cefuroxime ( 500 mg ) , injection , cetuximab 2mg / ml 100mg / 50ml vial , cetuximab 2mg / ml 200ml / 100 ml vial , cetuximab ( 500 mg ) , injection , chloramphenicol sodium succinate 500 mg, injection , chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection , chlorpheniramine maleate ( 10mg / ml inj 10 ml ) , vial , chlorpromazine injection ip 25mg / ml 1 ml vial , cholecalciferol 600000 iu / 2ml ( 2ml amp ) , injection , cholecalciferol 600000 iu / ml ( 2ml amp ) , injection , cis atracurium 2mg / ml ( 5ml vial ) solution for injection , cisplatin ( 10 mg ) , injection , cisplatin ( 50 mg ) , injection , cladribine injection 1mg / ml 10ml vial , clindamycin 600mg ( 150mg / ml ) , injection , clindamycin ( 150mg / ml ( 2 ml vial / amp ) ) , injection , clonidine100 mcg / ml 10 ml vial , colistimethate sodium for injection ip ( 2 m iu vial ) , injection , colistinethate sodium inj bp ( 1 million iu ) , injection , cyanoacrylate glues 120mg / ml , cyclophosphamide inj ( 1000 mg / vial ) , injection , cyclophosphamide inj ( 200 mg / vial ) , injection , cyclophosphamide inj ( 500 mg / vial ) , injection , cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid 100mg inj , cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj , cytarabine 1000 mg / ml 1ml vial , cytarabine ( 100mg ) , vial , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dactinomycin 0.5 mg inj , daunorubicin hydrochloride 20 mg / vial , daunorubicin hydrochloride 50 mg / vial , decitabine for injection 50mg / vial , desferioxamine , desferioxamine , dexamethasone intravitreal implant 0.7mg , dexamethasone sodium phosphate ( 4mg / 2ml ( 2ml vial ) ) , injection , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection , dexmedetomidine 100 mg / ml ( 1 ml amp ) , dextran injection ip 10%w / v 500ml bottle , diatrizoate meglumine 809.13 mg+diatrizoate sodium 635.90 mg 76% 20ml, injection , diatrizoic acid 60% 20ml amp , diatrizoic acid 65% 20ml amp , diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection , diclofenac sodium 25 mg / ml ( 3ml amp ) , injection , diclofenac sodium 75mg intended to use iv aqueous formulation ( 1ml amp ) , injection , dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection , digoxin i.p. 0.5mg / 2ml amp inj , diltiazem 25mg ( 5ml vial ) , injection , diphtheria antitoxin 10000 iu ( 10ml vial ) , injection , dobutamine hcl 50 mg / ml ( 5ml amp ) , injection , docetaxel ( 120mg vial ) , injection , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lyophilised ) ( 50mg vial ) , injection , doxorubicin ( lyophilized ) ( 10 mg / vial ) , injection , drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection , edaravone injection jp 1.5mg / ml ( 20ml amp ) inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection , enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection , ephedrine 30 mg / ml ( 1 ml amp ) , injection , epirubicin ( 100mg / vial ) , injection , epirubicin ( 50mg / vial ) , injection , erythropoietin ( 10000iu inj ) , injection , erythropoietin ( 4000 iu inj vial / pfs ) , injection , esmolol 100 mg / vial ( 10mg / ml ) , injection , etanercept 25mg / vial ( pack of 2 vials ) , injection , etanercept 50mg / vial ( pack of 2 vials ) , injection , ethamsylate inj ( 125mg ( 2ml amp ) ) , injection , etiophylline and theophylline ( 220 mg / 2ml ) , injection , etomidate vial ( 2mg / ml ) ( 10ml vial ) , injection , etoposide injection ip 100 mg / 5 ml , fat emulsion 20% 250 ml bottle , fentanyl citrate inj 100 mcg / ml ( 2ml ampoule ) , ampule , fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampule , filgrastim 300 mcg ( prefilled syrings ) , vial , filgrastim injection pfs 300 mcg recombinant human granulocyte colony stimulating factor ( rhu g csf ) , fludarabine phosphate 50mg ( each ) , injection , fluorescein 20% 5 ml amp , flupentixol 25 mg inj , flupentixol injection ip 20 mg / ml , fluphenazine 25 mg / ml 1 ml amp , frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000iu / ml ( 4ml amp ) , gemcitabine ( 1.4 gm vial ) , injection , gemcitabine ( 1000mg vial ) , injection , gentamicin inj ( 40 mg / ml 2 ml amp ) , injection , glargine 100 iu / ml, 3ml cartridge inj. ( firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost ) ( 100 iu / ml ) , cartridges , glutathione 600mg vial, injection , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection , granulocyte colony stimulating factor ( g csf ) 300mcg vial , haemocoagulase 1 iu ( 1ml amp ) inj , haemophilus influenzae type b vaccine 0.5ml , haloperidol inj ( 50mg / ml ) , injection , haloperidol inj ( 5mg / ml ( 1 ml amp ) ) , injection , heparin inj ( 5000iu / ml 5ml vial ) , injection , heparin ( 1000iu / ml 5ml vial ) , injection , hepatitis b immunoglobulin ( 100 iu / vial ) , vial , hepatitis b vaccine / 1ml ( 1ml ) , ampule , human albumin solution i.p. 20%w / v ( 100 ml ffs bottle / glass bottle ) , bottle , human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection , human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection , hyaluronidase 1500 iu / 2 ml ( 2 ml amp / vial ) , injection , hydrocortisone sodium succinate ( 100 mg / vial ) , injection , hydroxy propyl methyl cellulose injection 2% ( 3ml prefilled syringe ) , syrings , hydroxyprogesterone caproate inj i.p. 250mg / ml , hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection , i / v polysacchride or conjugate pneumococcal ( 0.5 ml ) , vaccine , ifosfamide for injection1 gm vial , ifosfamide for injection1 gm with mesna injection vial , ifosfamide for injection2 gm vial , imipenem 1000 mg vial / amp, injection , imipenem 500 mg with cilastatin 500mg ( vial / amp ) , injection , infliximab powder for concentrate for solution for infusion ( r dna origine ) 100mginj , insulin lispro ( insulin lispro 25% and insulin lispro protamine 75% ) ( rdna origin ) 100iu / ml , iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml ( 100 ml ) , bottle , iohexol injection 350 mg iodine / ml ( 20 ml vial ) , consumable , irinotecan hydrochloride ( 100 mg ) , injection , irinotecan ( 40mg / vial ) , injection , iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection , isobaric levobupivacaine ( 0.5% ) , injection , isoprenaline 2 mg / ml ( 1 ml ) , injection , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection , ketorolac trometamol 30 mg / ml 1ml solution for injection , l ornithine and l aspartate ( 5mg / 10 ml ) , injection , labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection , l asparaginase 10000iu / vial, injection , l asparaginase 5000 iu lyophilized ( vial ) , injection , leuprolide acetate for injection 3.75mg depot , leuprolide acetate for injection 6.25mg depot , levetiracetam ( 100mg / ml ) , injection , levobupivacaine hyperbaric ( 0.5% ) , injection , levosulpiride injection ( 12.5 mg / ml ) amp , lidocaine hydrochloride topical solution usp 4% ( 40mg / ml ) , injection , lignocaine ( preservative free ) ( 2 % 50 ml vial ) ) , injection , lignocaine 10% ( 10mg / ml ( 30 ml vial ) ) , injection , lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , injection , lignocaine for spinal anaesthesia lignocaine 5% +destrose 7.5% 2 ml amp heavy , lignocaine hydrochloride inj ip 1% 2ml vial , liposomal amphotericin b suspension in saline 10mg , liposomal amphotericin b suspension in saline 50mg , liposomal amphotericin b ( 50 mg ) , injection , liposomal doxorubicin 20 mg or pegylated liposomal doxorubicin ( 2 mg / ml 10ml vial ) , injection , lorazepam ( 2 mg / ml 1 ml vial ) , injection , lorazepam ( 2 mg / ml 2 ml vial ) , injection , low molecular weight dextran 40000iu vial , magnesium sulphate injection ( i.p.50 % w / v 10 ml amp ) , injection , meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial , meningococcal vaccine ( group a, c, y, w ) 0.5 ml vaccine , mephentermine inj 30mg / ml ( 10 ml vial ) , injection , meropenem ( 1000 mg ( vial ) ) , injection , meropenem ( 500 mg / vial ) , injection , mesna 200mg / 2ml ( 2ml amp ) , injection , methacarbamol 100 mg. / 10ml vial , methotrexate 15 mg / ml ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methotrexate 500mg / 5ml ( 5ml in 1 vial ) , injection , methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection , methyl prednisolone sodium succinate inj ( usp 125mg ) , vial , methyl prednisolone sodium succinate inj. 40mg vial , methyl prednisolone sodium succinate inj.1000mg vial , methyl prednisolone ( 500mg ) , injection , methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue injection usp 1% ( 10mg / ml ) 10 ml amp , metoclopramide 5mg / ml ( 2 ml amp ) , injection , metoprolol inj 5 mg / ml ( 5ml vial ) , injection , micafungin sodium 100 mg / vial, injection , micronised progesterone 50mg / ml 2ml amp , micronized progesterone 100mg / ml2ml amp , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml, 5 ml amp , milrinone 1mg / ml solution for injection / infusion , mitomycin c for injection 40mg inj , mitoxantrone 2 mg / ml inj , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine sulphate 10mg / ml 1ml amp , moxifloxacin opthalmic solution 0.5ml pfs , multivitamin 10ml ( amp inj ) , injection , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for , neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection , nikethamide injection 1mg / ml ip 10 ml amp , nitrofurantoin 300mcg injection , nitroglycerine inj. 25 mg / 5ml ( 5ml ) , ampule , noradrenaline bitartrate 2 mg base / 2 ml amp injection ( 2 ml amp ) , injection , novomix 30 penfill 100 iu inj 3 ml cartridge , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg / vial inj , olanzapine depot inj , ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection , ondansetron ( 2 mg / ml ( 4 ml amp ) ) , injection , oxaliplatin ( 100mg ) , injection , oxaliplatin ( 50mg inj 25 ml vial ) , injection , oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injection , paclitaxel 260mg ( 43.34ml vial ) , injection , paclitaxel inj ( 100mg ) , injection , paclitaxel nanoparticle / protein bound particles inj. ( 100mg vial ) , vial , panitumumab 100mg / 5ml inj , paracetamol amp for i / v use ( 2ml ) , ampule , paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection , parenteral nutrition two chamber bags without lipid 2000ml , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetrexed ( 100mg ) , injection , pemetrexed ( 500mg ) , injection , penicillin v 125 mg inj , pentaprazole inj vial ( 40 mg ) , injection , pentazocin lactate 30mg / ml 1ml amp. , pentoxifylline 20 mg / ml , perfluoro n octane liquid , pertuzumab 30 mg / ml ( 420mg / 14ml ) , injection , pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection , pilocarpine nitrate inj. ip 0.5 % w / v ( 1 ml ) , injection , piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection , piperacillin + tazobactam ( 2000 mg + 250 mg 20ml vial ) , injection , piperacillin + tazobactum ( 4.5 g ) , injection , potassium chloride inj. 150mg / 10ml amp ( 150mg / 10ml amp ) , ampule , pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection , preservative free lidocaine tropicamide phenylephrine hydrochloride inj , progesterone b.p.100mg / 2ml ( 2 ml vial ) , injection , promethazine 25 mg / ml ( 2 ml amp ) , injection , propofol sodium 1%w / v ( 10mg / ml ( 20ml vial ) ) , injection , protamine sulphate 1%w / v ( 10mg / 5ml ( 5ml amp ) ) , injection , quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection , rabeprazole 20 mg injection , rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection , ranitidine ( 50mg / 2ml , 2ml amp ) , injection , recombinant anti hemophilic factor viii ( 250 iu inj / vial ) , injection , recombinant anti hemophilic factor viii ( 500 iu inj / vial ) , injection , remdesivir inj 100mg / vial , rh erythropoetin ( 2000 i.u ) , injection , rituximab ( 100mg ) , injection , rituximab ( 500mg ) , injection , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , ropivacaine 10mg / ml 2.5ml vial , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , sargramostim 500 mcg / ml inj , sildenafil 10mg i.v. 12.5ml , sildenafil citrate 10mg / ml 10ml vial , silicone oil 1500 cst , silicone oil 5000 cst , sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule , sodium thiopentone 0.5 gm powder / vial ( 20ml vial ) , injection , sodium thiopentone 1 gm powder / vial ( 20ml vial ) , injection , sodium valproate 100 mg / ml, 5 ml amp , somatropin 1.33mg 4iu injection , streptokinase inj 15 lac iu ( vial / amp ) , injection , streptomycin inj ( 0.75g ) , injection , succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection , surfactant ( porcine lung surfectant extract 80mg / ml ) , surfactant bovine ( 135 mg phopholipid per 5 ml, 5ml vial ) , suspension for intratracheal instillation ( 80mg / ml ( pack size as licensed ) ) , suspension , teicoplanin ( 200 mg / vial ) , injection , terbutaline suplhate 0.5 mg / ml ( injection 1 ml amp ) , injection , teriparatide injection ip 600mcg / 2.4 ml amp , terlipressine inj. 1mg / 10ml vial ( 1 each ) , injection , tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial , tetanus toxide 0.5ml ampoule ( 0.5ml amp ) , ampule , thiamin ( 200mg 2ml ) , 4 ml amp, injection , thiamine ( vitamin b1 ) hcl 100mg / 2ml 4ml amp, injection , tigecycline 50mg ( each ) , injection , tobramycin sulphate injection ip 80 mg / 2ml ( 2 ml vial ) , tocilizumab ( 400mg ) , injection , torsemide injection ( 10 mg / ml, 2 ml amp ) , tramadol ( 100mg / ml ( 2 ml amp ) ) , injection , tramadol ( 50mg / ml ( 2ml amp ) ) , injection , tranexamic acid injection bp / ip ( 100mg / ml ( 10ml vial ) ) , injection , tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection , trastuzumab 440 mg injection ( vial ) , injection , triamcinolone ( ( 40 mg / ml ) 1ml vial ) , injection , trypan blue opthalmic solution ( 0.06% 1 ml ) pre filled syringe , ulinastatin ( 1 lac iu ) , vial , urokinase ( 5 lac iu ) , vial , vancomycin hydrochloride ( 1000mg vial ) , injection , vancomycin hydrochloride ( 500mg ) , injection , vasopressin ( 20 iu / ml ) , injection , vasopressin ( 40 iu / ml ) , injection , vecuronium bromide ( 2mg / ml ( 2ml amp ) ) , injection , verapamil hydrochloride 2.5 mg / ml amp , vinblastine ( 10 mg / 10 ml ( 10ml amp ) ) , injection , vincristine sulphate ( 1mg / ml ( 1 ml vial ) ) , injection , vinorelbine ( 10 mg ) , injection , vinorelbine ( 50 mg ) , injection , vitamin b complex injection ( nfi formula 30ml / vial ) , injection , vitamin k1 ( 10mg / 1ml ( 1 ml amp ) ) , injection , vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection , voriconazole ( 200 mg / vials ) , injection , water for injection 10 ml amp , zoledronic acid ( 4mg vial ) , injection , zuclopenthixol acuphase 50 mg inj , zuclopenthixol decanoate 200 mg inj , abo / rh ( d ) ahg neonate group card , acetic acid solution 3% v / v100ml , acetone detection kit , acetone solution 05 litre pack , ada kit , ahg coombs test gel card , aluminium ammonium sulphate powder 500gm , amacr , ana test kit , anhydrous cuso4 powder , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti her / erbb2 monoclonal , anti human globulin ( ahg ) 05ml , anti a sera 10 ml , anti b sera 10 ml , banded use in blood bank , barium chloride 10 %500 ml , bcl 2 , benedict reagent5 lit cane , bismark brown stain 100 gm , blood culture media aerobic for adult ( bac t / alert pf plus ) , blood culture media anaerobic for pediatric ( bac t / alert pf plus ) , blotting paper 50 / pkt , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , cd 41 pc7 , cd34 , cd42b pe , cd61 pc5.5 , cd62p fitc , combined spinal epidural ( cse ) kit , coombs sera ( igg + c3d ) , coombs sera c3d , coombs sera igg , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cox 2 , csf protein kit , cyclin d 1 , cyto fix spray , cytoflex daily qc , cytokeratin ae1 / ae3 , dengue card test , desmin , disposable microtome blade ( 50 blades in one ) , disposable test tube with screw cap , dpx mount 250ml , ehlrich aldehyde reagent 125 , ema , estrogen receptor epi monoclonal , field stain a 500 ml , field stain b 500 ml , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , flow count bead , fluorospheres 2ml , forward & reverse grouping auto control gel card , fouchet reagent 250ml , glacial acetic acid 100 ml , glass pasture pippett with rubber , glial fibrillary acidic protein ( gfap ) , glucose kit god / pod , h2so4 25 % 500 ml bottle , haematoxylene 5gm , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hemoglobin test strips , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , hpr polymerr kit with dab chromogen , hydro chloride acid about 36.46% , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , immunotrol , immunotrol low , iso propyl alcohol , ki67 / mib 1 06 ml antibody kit , leishman stain 500 ml , leucoreductionfilter ( bed side ) , leucoreductionfilter ( lab side ) , light green stain 100 gm , liquid ammonia 500 ml , liss diluent for gel card , malaria parasite antigen test kit rapid , malaria parasite elisa test kit , massons trichrome stain , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , multi parameter urine strips ( 100 in 1 box ) , myogenin , n / 10 hcl 500ml , neutral gel card , nfp , nitric acid 500 ml , nkx 3 1 , p 53 , pandys reagent 125ml , pap pen , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pas stain , pasture pipette , poly l lysine solution p8920 0.1%w / v 100 ml bottle , polythene gloves , pricking lancet , progestron receptor monoclonal , retic stain 125ml , rh phelotype card with anti k , rpr test kit , s 100 , sharp collection containers disposable5 ltrs , sharp collection containers disposable 1.5 ltrs , sheath fluid , single donor platelet kit make haemonotics / terumo penpol ( close system ) , slide tray , sma , sodium chloride for analysis , steel cassets for tissue processing , stem trol , sugar albumin urine sticks ( bi parameter ) 100 strips / bottle , sulpgar powder 500 gm , sulpho salicylic acid 500ml , synaptophysin , test tube , tetrachrome , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , tissue paper roll , titriplex iii pure ( edta ) , total protein kits 100 ml , tris buffer gr 500gm , tween 20 for synthesis 500ml , vdrl elisa test kit , vdrl rapid test kit , versa lyse solution , vimentin , wafers cutting blade for tube welders , xylene lr 2.5l, packaging size: 2.5 lits. , yellow gel tube vaccum blood collection tube , yellow tip plastic , calamine lotion ( ( contains per 1000 ml: calamine 150 gm, zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml ) 50 ml bottle ) , lotion , permethrin lotion 5% w / v ( 60 ml bottle ) , lotion , hydrogen peroxide 3% w / v mouth gargle 100 ml bottle , povidine iodine ( gargle 2% w / v 100 ml bottel ) , bottle , clotrimazole 1% w / v ( 15ml ) , mouth paint , clotrimazole, baclomethasone, benzocaine mouth paint 15ml , triamcinolone acetonide paste bp 0.1 %w / w, 5gm , triamcinolone oromucosal paste bp 0.1 %w / w, 5gm , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , solution , potassium permanganate ( kmno4 ) 25 mg ( 100ml bottle ) mouth wash , xylometazoline nasal ( 0.1%w / v ( 10 ml vial ) ) , drop , saline ( sodium chloride 6.5 mg ) nasal gel 15 gm tube , saline ( sodium bicarbonate 700mg + sodium chloride 2.3gm ) nasal wash 3 gm kit , sterile haemocoagulase solution 0.2cu 10ml drop , turpentine oil 100 ml bottle , mct oil and permitted anti oxidant ( tocopheryl acetate ) 100 ml bottle , acyclovir 5%w / w ( 5gm ) , ointment or cream , amorphous hydrogel wound dressing with colloidal silver 15gm , beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream , betamethasone 0.5mg +gentamicin 1mg 20gm cream , betamethasone valerate cream 0.05% ( 15gm tube ) , ointment , betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment , centella asiatica extract based skin moisturization and antiscar gel 50gm , clindamycin phosphate gel usp 1% 30gm tube , clobetasol propionate 0.05% ( 15 gm tube ) , cream , clotrimazole i.p. 2%w / w ( 15gm tube ) , cream , fluconazole ointment 0.5% w / w 15 gm tube , framycetin sulphate 1% w / w 30 gm tube , fusidic acid cream / sodium fusidic ointment 2% ( 15gm tube ) , tube , heparin and benzyl nicotinate 20gm ointment , ketoconazole cream 2% 30gm cream , lidocaine hydrochloride ip 3%w / w + hydrocortisone ip 0.25% w / w + allantoin ip 0.5% w / w + zinc oxide 5% w / w, 15gm tube , luliconazole ( 1% w / w ) , cream 20gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment 75 gm , mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube , papain urea and silk protein based debriding ointment and cream 100 gm , papain urea and silk protein based debriding ointment and cream 25 gm , papain urea and silk protein based debriding ointment and cream 50gm , papain urea debriding ointment 15 gm tube , permethrin cream 5% w / v ( 60 gm ) , tube , placenta extract gel 20 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine and silk protein based topical antiseptic and wound healing ointment 100 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 250gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 25gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 50 gm , povidone iodine ointment 5% 250gm jar , povidone iodine ointment 7.5% 500gm jar , salicylic acid 6 %, 30 gm ointment , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 25 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 250 gm , silk protein based antimicrobial wound healing ointment loaded withasiaticoside and silver 50 gm , silver nitrate hydrogel wound dressing 0.2% w / w 25 gm tube , silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream , bacitracin zinc 400 u+neomycin sulphate 3400 u+polymyxin b sulphate 5000 u ( 10 gm powder ) , clotrimazole ( 1% 100 gm ) , powder , formula milk for infants 500gm , polyethylene glycol with electrolytes for oral solution 137gm , potassium permegnet powder 400 gm pkt , povidone iodine powder 5% w / w 10 gm powder , protien powder ( 200 gm 1x1 ) , powder , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 100 gm , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 50 gm , silk protein and antimicrobial nano silver based surgical particle wound dressing 10ml vial , silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial , formoterol 12 mcg+tiotropium bromide 18 mcg / cap powder for inhalation , collagen granules 10 ml , fosfomycin trometamol powder ( sachet of 3 gm granules ) , human milk fortifiers ( hmf sachets ) ( 1x1gm ) , sachet , l arginine 3gm + proanthocyanidin 75mg ( 10gm sachet ) , sachet , lactic acid bacillus ( 150 million spores ) , sachet , orodispersible probiotic sachets ( 2 gm sachet ) , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l ( as per attached pack specification ) , powder , acyclovir 5% ( 5gm ) , ointment or cream , alcoholic handrub with triple action:50%2 propano+25%1.propanol+2.5% chx+0.5 triclosan.500 ml , antiseptic hospital concentrate contdaining 20% chlorohexidine soln ip 7.5% v / v cetrimide ip 15%w / v iso peopyl alchohol 6 8% 1000ml. , beclomethasone dipropionate lotion 0.05% w / v 100ml bottle , caffeine citrate 20mg / ml 1.5 ml oral solution , caffeine citrate 20mg / ml 3 ml oral solution , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml , feracrylum 1% 100 ml solution , formaldehyde solution37% acq. 450 ml bottle , gentian violet solution 30ml bottle , gluteraldehyde solution 2% ( 5 litre can ) , solution , glycerine + sodium chloride enema ( 15% + 15% 20 30 ml / pack ) , enema , glycerine ip 500ml bottle , hand wash solution ( sol.isoprapanol, propanol , mecetronium, skin care additives ) 500 ml bottle , hydrogen peroxide 6% solution ( who gmp certification exempted for this item ) ( 400 ml ) , bottle , liquid paraffin ( 500 ml, bottle ) , solution , povidone iodine 10% , povidone iodine solution 5% ( 500 ml ) , bottle , povidone iodine surgical scrub solution. 7.5% ( 500 ml bottle ) , solution , sodium hypochlorite solution 5% ( 500 ml bottle ) , consumable , solution heparin topical 1000iu / ml ( each ) , 5 ml vial , surface & environmental disinfectant each 100 gm contains: ( 1.6 dihydroxy, 2 5 dioxahexane 11.2 g. glutaraldehyde 5.0 g. benzalkonium chloride ip 5.0 g ) , solution , benzocaine ( 0.36% w / w ) , cetrimide ( 0.50% w / w ) 1 packet ( s ) ( 100 gm spray each ) , saline ( benzalkonium chloride 0.01%w / v + sodium chloride 0.65%w / v ) nasal spray 20 ml , methylcobalamin nasal spray 250 mcg / spray ( 5 ml bottle of nasal spray ) , budesonide nasal spray 32 mcg per spray 120 sprays 8.43 ml nasal spray , fluticasone 50mcg / spray ( 70 120 meter dose nasal ) , spray , lignocaine spray 10% ( 100ml ) , spray , absorbable 2 0 endo suture cartridge 48 length , advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , advance rf energy hand instrument of 5 mm shaft diameter for laproscopicprocedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , disposable circular stapler 25 / 26mm diameter , disposable circular stapler 28 / 29mm diameter , disposable trocar 05mm , disposable trocar 10mm , disposable trocar 12mm , disposable trocar 15mm , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable clipapplier medium 10mm with 20 clips , disposable clip applier medium 5mm with 16 clips , disposable curved cutter stapler 1.44 mm , disposable curved cutter stapler 2.0 mm , disposable hemorrhoidal stapler 32 mm , disposable hemorrhoidal stapler iii rows , disposable hemorrhoidal stapler stapler 33 mm diameter with detachable anvil ( staple height 3.5 mm ) , disposable linear stapler with fixed staple height 75mm 90mm size , disposable linear stapler with fixed staple height 55mm 60mm size , disposble skin stapler ( 35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure ( 7.2 x 4.3 mm ) , consumable , distal tip closure titanium ligation clip large size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip small size , endoscopic cutter & stapler60mmregular length , endoscopic cutter & stapler60mmlonglength , endosuturing device 10mm with toggle lever , handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh , handpiece ( transducer ) compatible with ultrasonic vessel sealing dissectorinstalled in myh , hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc , locking clip cartridge medium / large , mesh fixation device with 15 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with 30 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with non absorbable titanium tacks 15mm , mesh fixation device with non absorbable titanium tacks 20mm , mesh fixation device with non absorbable titanium tacks 30mm , multifire clip applier long size 15 clip , multifire clip applier small size 20 clip , non absorbable 2 0 endo suture cartridge 48 length , open clip applicator 100 20cm length , open clip applicator 200 20cm length , open clip applicator 300 20cm length , open clip applicator 400 20cm length , partially absorbable mesh with absorable & semi absorbable sides 15cm x 15cm , partially absorbable mesh with absorable & semi absorbable sides 10cm x 15cm , plastic locking clip applicator medium / large , polycearbonte bladeless trocarwith reducer seal 10mm , polycearbonte bladeless trocarwith reducer seal 12mm , polycearbonte bladeless trocar with reducer seal 5mm , polyproplene with polyglecaprone 25 partially absorbable mesh 10cmx 15cm , polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cmx 15cm , reload 55 60mm for medium thick tissue blue compatible with linear cutter. , reload 55 60mm for thin / vascular tissue white compatible with linear cutter. , reload 75 80mm for medium thick tissue blue compatible with linear cutter. , reload 75 80mm for thick tissue green compatible with linear cutter. , reload compatible with curved cutter 40mmx3.5mm , reload endoscopic cutter & stapler45mm purple , reload endoscopic cutter & stapler60mm purple , reload endoscopic cutter & staplter45mm blue , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm white , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload forlinear cutter 90mm 100 mm size green , reload for linear cutter 55mm 60mm size blue , reload for linear cutter 90mm 100 mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size green , reload for linear stapler with fixed staple height 55mm 60mm size blue , reload for linear stapler with fixed staple height 55mm 60mm size green , reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length , reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly , reusable laparoscopic clip applicator for large titanium clips. , reusable laparoscopic clip applicator for medium large titanium clips with28cm 30 cm length , reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , skin staple remover with plastic handle , suture locking autolock , titanium clip 100mm , titanium clip 200mm , titanium clip 300mm , titanium clip 400mm , universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. , universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. , hemorrhoid stapler 29 34 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc , 11 cell panels for antibody screening & identification , 1pc pedia stoma kit: colostomy / lleostomy 1pcsystem flat transparent open paediatric stoma bag with spiral adhesive, and clip locking drainage. cutablesize 10 to 35mm 5 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , 2.2 mm disposable keratome blade , 3 cell panels for antibody screening & identification , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 10cmx10cm , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 15cmx15cm , 3d hydrocellular microbicidal, composite dressing anti microbial chronic wound dressing, 3d hydrocellular dressing for exudate and moisture management, non adherent for easy removal size: 7.5cmx7.5cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 15 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 20 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 25 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 30 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 10 x 35 cm , 3d microbicidal composite dressing broad spectrum anti microbial, transparent water proof dressing, non adherent for easy removal size: 6 x 7 cm , abdominal belt ( 34 inch each ) , consumable , abdominal drain kit sizes :14fg, 16fg, 20fg, 22fg, 24fg , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine sponge ( ip 80mm x 50mm x 10mm ) , consumable , absorbent cotton wool ip 500 grms ( each ) roll ( iso:13485:2016 ) , consumable , accessory spikes ( 1x1 pis ) , consumable , adhesive plasters usp 7.5 cm x 10 mts / roll , adult diaper size l ( each ) , consumable , ag ion impregnated central venous double lumen polyurethane catheter, 7.5 fr, g 16x18 length 16cm , ag ion impregnated central venous triple lumen polyurethane catheter, 7.5 fr, g 14x18x18 length 16cm , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, l 15cm, with polyurethan extention tube, flow rate per lumen –320 ml / min , ahmed valve drainage device for glaucoma surgery , air bed mattress ( with complete set ) , consumable , air blanket compatible with bair hugger , alcohal based hand sanitizer ( 500ml bottle with dispenser ) , consumable , ambu bag ( silicon type ) paediatrics each 300 500 ml with oxygen connecting tube, should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories ( should have silicon rubber bellow to withstand autoclave at 134 degree c, should be autoclavable upto 40 times ) , consumable , ambu bag / adult each 1000 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c ) should be multiple times autoclavable ) , consumable , anesthesia kit spinal & epidural with balloon indicator lor syringe type 16g / 25g ( 80mm*113mm / 90mm*123mm ) , 18g / 27g ( 80mm*113mm / 90mm*123mm ) , anterior vitrectomy pack for centurion gold phaco machine , anti bacterial coated double lumen central line paediatric , anti bacterial coated foleys catheter 12f , 14f , anti bacterial coated triple lumen central line adult , antibacterial impregnated evd cathetor evd cathetor set and csf collection bag , antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 18x18, l 15 / 16cm. peadiatric , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 18x18, l 15 / 16cm. , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 6 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 6.5 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 7 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 7.5 , anti microbial gloves sterile disposable latex surgical gloves pre powdered conformity surgical rubber gloves meets all the requirements of international and national std.astm d 3577, en 455, iso 10282 & 13422 standard size available 8 , antimicrobial incise drape 3 meter , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 16*18x18, l 15 / 16cm. peadiatric , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 16*18x18, l 15 / 16cm. , antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm , aquacel dressing size 4x4 / 10cmx10xm , armored cuffed tube made of 100% silicon, radio opaque, should have prefilled stylet mounted connector, piot balloon with universal port. size. fr 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9 should be fda / ce approved , av blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzer ) with side tubing ( for heparinization and av pressure monitorig ) blood tubing set dialysis , baby diapers small ( 10 diaper per pkt ) , consumable , baby drape sheets , backflush blunt tip needle 23 g , backflush soft tip needle 23 g , backflush soft tip needle 25 g , bandage contact lens , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bhex ring with forcep ( flexible hexagonal plastic ( polyimide ) ring with 75 micron profile having notches at corner and flanges at sides, size 6.5 mm, providing pupillary expansion 5.5 mm ) , bicanalicular ( jacks on ) lacrimal intubation set , bio flat reel 25cmx200 mtr , bionet machine connector , biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered , biopsy gun ( 16 20 gauge ) , consumable , bipap mask size large , bipap mask size medium , bipap mask size small , bipolar cable , bipolar cable 12 ft silicone constellation vitrectomy , bipolar cable 12 ft silicone for centurion gold phaco , bipolar cable 12 ft. silicone , bipolar cord with bipolar electyrocautery pencil , bipolar forceps cable , bipolar forceps su coap.steril , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag double 350ml ( as per attached specification ) , each , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag top to bottom quadruple 450 ml , blood bag transfer 350 ml , blood bag triple 350ml as per attached specification ( each ) , bag , blood bag triple sagam 350ml ( each ) , bag , blood collection tube clot activator with rubber cap 13x75 , blood culture bottle ( glass autoclavable 100ml ) , consumable , blood pressure cuff adult 25cm 40cm , blood pressure cuff pediatric 19cm 27.5cm , blood transfusion set double moldedchamber without airway , blood transfusion set single molded chamber without airway , bone marrow aspiration needles ( 13g ) , bone marrow aspiration needles ( 14g ) , bone marrow aspiration needles ( 15g ) , bone marrow aspiration needles ( 16g ) , bone marrow biopsy needle 13g , bone marrow biopsy needle size 11gx10cm , bone wax sterilised ( 2.5 gm / packet ) , consumable , calcium hypochlorite containing not less than 0.25% w / v of available chlorine buffered with boric acid ( 1:1 ) to a ph of 7.5 8.5 solution , cannula fixer set , carbolic acid 500 ml , cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) , c arm cover disposable , catheter double lumen7.7 no , catheter mount ( adult size ) , consumable , catheter mount ( pediatric size ) , consumable , catheter single lumen4.7 no , catheter single lumen6.6 no , catheter single lumen7.7 no , cautery pencil disposable ( each ) , consumable , cautery plate disposable ( each ) , consumable , central line double lumen 16 fr , central line single lumen , central venous catheter 4fr , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , cerebral catheter reservoir large 18mm diameter chamber , cerebral catheter reservoir small 12mm diameter chamber , cervical collar soft , chemical enzyme based cleaner non ionic, amphoteric surfactants, solvents, complexing agents, amino acid derivative, corrosion inhibitors, anti foaming agent , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine antiseptic sterile gauze dressing 10 cm x 10 cm ( 10 pouches ) gauze , chlorhexidine gluconate dressing material , circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm , circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm , circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm , circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm , cling drape drape size: 15 x 500 cm. , closed suction tracheostomy suction tube with pros , collagen patch , collagen sheet , colostomy kit , combined pack of iol , keratome2.2 / 2.8 mm , sideport blade 1.2 mm, balanced salt solution, viscoat, disposable cassette with 45 degrees flared phacotip with sleeve , iol cartridge , condom catheter , contured titanium mesh for cranioplasty 15x12cm , cord clamp , corrugated drainage sheet , cotton crape bandage 05cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cotton crape bandage 10cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cotton crape bandage 15cm x 4m ( box of 10 bandages ) ( no. ) , consumable , cr system digital film ( size 10x12 ) carestream, consumable , cr system digital film ( size 14x17 ) carestream, consumable , cr system digital film ( size 8x10 ) carestream, consumable , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , craniotomy drape sheet size 2.6x3.6 m, 50gsm , cresol with soap solution ip ( 5 liter jar ) , consumable , cvc line double lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7fr, g 16x16 length 15cm , cvc line triple lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7.5 fr, g 14x18x18, length 15cm, 20cm ( anti microbial coated ) , cvl dressing07 cm x 8.5 cm for central line , cvl dressing10 cm x 12 cm pad for central line , cvp ( central venous pressure ) manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j. stent ( 3 fr ) , ( 4 fr ) , ( 5 fr ) , ( 6 fr ) , consumable , dermatome blades 50 mm , dialyzers 1.5 / 1.6 multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) , consumable , diathermy probe 25 g constellation vitrectomy , differential pressure flow sensor for savina 300 drager ventilator , dispoable raney clip strelized pack of 10 nos , disposable c arm cover , disposable camera cover , disposable curved scissor 23 g , disposable endgrasping forcep 23 g , disposable eye drape 120x120 nonwooven precut with drainage pouch , disposable eye drape 70x70 nonwooven precut with drainage pouch , disposable eye shield u / v light protector for infants & neonates. sterile single pack. , disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 , disposable hiv kit sterile:full gown 1 ( wrap around gown made water ressistant ) ( disposable bag 1, 120x210 cm plain sheet large 1, water proof lagging 1 pair, cap 1, mask 1, sterile rubber gloves 1 pair, goggle 1pc. ) , consumable , disposable ilm forcep 23 g , disposable ilm forcep 25 g , disposable iris retractor , disposable membrane scraper 23 g , disposable membrane scraper 25 g , disposable microscope cover , disposable n 95 mask , disposable needle 18g ( single use ) , disposable needle 18g x 1 1 / 2 ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26g x 1 1 / 2 , disposable needle no 26g x 1 / 2 , disposable paper gloves size 7, 7.5, 8 , disposable perforator with hudson end 12 mm , disposable phaco set for cnturion gold phaco machine , disposable phaco set with phaco tip and sleevefor cnturion gold phaco machine , disposable plastic appron ( full size ) , consumable , disposable plastic apron material 25 microne polyethylene , disposable shoe cover , disposable shunt drepe size 120x210 cm, incise area 70x15 cm , disposable soft tip needle 23 g , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7.5 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 8 inch / pair ( pair ) , consumable , disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 6.5 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 8 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free6.5 inch / pair ( pair ) , consumable , disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free7.5 inch / pair ( pair ) , consumable , disposable sterile gown , disposable suction catheter all size , disposable surgeon cap ( box of 100 caps ) , consumable , disposable three layer surgical mask , disposable trolly drape 18x120 cm , disposable trphine 10 , disposable trphine 10.5 , disposable trphine 11 , disposable trphine 11.5 , disposable trphine 12 , disposable trphine 13 , disposable trphine 3 , disposable trphine 6 , disposable trphine 6.5 , disposable trphine 7 , disposable trphine 7.5 , disposable trphine 8 , disposable trphine 8.5 , disposable trphine 9 , disposable trphine 9.5 , disposable wrap around ot gown with 2 nos hand towel , distilled water 5 litre ( each ) , consumable , dj stent / double j stents size 3fr 7fr, 10 26cm , dome valve hydrocephalous shunt system bacterial resistant high pressure , dome valve hydrocephalous shunt system bacterial resistant low pressure , dome valve hydrocephalous shunt system bacterial resistant medium pressure , dome valve hydrocephalous shunt system high pressure , dome valve hydrocephalous shunt system low pressure , dome valve hydrocephalous shunt system medium pressure , double lumen peripherally inserted central venous silicon catheter ( 7fr, 9fr, 11fr, 14fr ) length 90cm, with subcutaneous cuff for long term venous access , double lumen peripherally inserted central venous silicon catheter ( 3fr, 4fr, 4.5fr, 5fr ) length 60cm , drap sheeth 120cm x 210cm sterile , draw sheet ( each ) , consumable , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. , dura repair patch made of poly propylene non woven extra large 15x20cm , dura repair patch made of poly propylene non woven large 10x12cm , dura repair patch made of poly propylene non woven small 8x10cm , ear buds ( plastic one ) , ear cotton swab ( each ) , consumable , ecg electrodes ( each ) , consumable , ecg paper computerized triple channel 20m , ecg paper roll 210 mm x 20 mtr ( each ) , consumable , ecg paper roll 80 mm x 20 mtr ( each ) , consumable , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , electrocautery plate , emg ( electromyography ) needle , endo stich lap suturing device 10 mm , endo stitching / suturing instrument, endo suturing instruments for endoscopic suturing and knot tying, with one handed operation along with easy needle transfer between jaws. maximum jaw opening of 19 mm with an option to hold different sutures. should fit through a 10 mm trocar , endocapsular ring ( capsular tensionring ) 11mm , endocapsular ring ( capsular tensionring ) 12mm , endocapsular ring ( capsular tensionring ) 13mm , endoscopic suture product endo stitch 10 mm cartidges, disposable suture loading units for endostitch instrument with sizes of 2 0 endostitch and 2 0 , endotracheal tube cuffed size 3 , endotracheal tube cuffed size 3.5 , endotracheal tube cuffed size 4 , endotracheal tube cuffed size 5 , endotracheal tube cuffed size 6 , endotracheal tube cuffed size 6.5 , endotracheal tube cuffed size 7 , endotracheal tube cuffed size 7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size 8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffed size 9.5 , endotracheal tube introducer ( bougie ) adult 5 , endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 , endotracheal tubes plain without cuff size 2, 2.5, 3, 3.5, 4, 4.5 , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle 16g, 18g ( each ) , consumable , eto chemical indicator , eto gas cartridges , eto tape indicator , examination gloves size large ( 100 pcs / pkt ) , examination gloves size medium ( 100 pcs / pkt ) , examination gloves size small ( 100 pcs / pkt ) , exchange transfusion catheter with four way adaptor size 4 cm, l 40 cm , extarnal lumber cfs drainage system , extarnal ventricular cfs drainage system , extention line ( 10 cm ) , consumable , extention line ( 100 cm ) , consumable , extention line ( 150 cm ) , consumable , extention line ( 200 cm ) , consumable , extention line ( 50 cm ) , consumable , extra ventricular drain ( evd ) , eye shield transperant , feeding tube size 3, 4, 5, 6, 7, 8 , feeding tube size 9, 10, 12, 14 , fibrin glue , films of size 10x12 inches compatible films to dr system ( 10x12 inches ) , prognosys medical systems film , films of size 11x14 inches compatible films to dr system ( 11x14 inches ) , prognosys medical systems film , films of size 14x17 inches compatible films to dr system ( 14x17 inches ) , prognosys medical systems film , films of size 8x10 inches compatible films to dr system ( 8x10 inches ) , prognosys medical systems film , flexo metallic tube no. 6, 6.5, 7, 7.5, 8, 8.5 , flourescein strips , flow sensor for bellavista ventilator , fluorescein strips pkt , foam sclerotherapy fibre , fogarty embolectomy catheter, size: 4fr , fogharty catheter ( size 20 two way ) , consumable , foleys catheter 3 way 22 size , foleys catheter latex based baloon capacity ( 30 50ml ) three way ( a ) fg 16, 18, 20, 22 , foleys catheter size 12 2 way ( 10 each ) , consumable , foleys catheter size 14 2 way , foleys catheter size 16 2 way ( 11 each ) , consumable , foleys catheter size 18 2 way , foleys catheter size 20 2 way ( 12 each ) , consumable , foleys urinary catheter pediatrics ( size 8 10 ) , each , forcep for raney clip , fuji digital film ( size 10x12 ) , consumable , fuji digital film ( size 11x14 ) , consumable , fuji digital film ( size 14x17 ) , consumable , fuji digital film ( size 8x10 ) , consumable , gasket forvaccume jar 1000 ml , gasket forvaccume jar 600 ml , gasket for humidifier bottel , gigli saw wire , glass slide iso mark no 12mm , glass tube 125x150 , glucometer strips pkt ( 50 strip / pkt ) , guedel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , guidewire lengths: 50 cm 0.035? ( 0.89 mm + 0.01 mm ) * / 0.038? ( 0.97 mm + 0.02 mm ) * , h2o2 catridge , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hip u drape * hygiene sheet * adhesive, size 180 x160 , hme filter , humbysknife disposable blade , hydrocephalous shunt system bacterial resistant high pressure , hydrocephalous shunt system bacterial resistant low pressure , hydrocephalous shunt system bacterial resistant medium pressure , hydrocephalous shunt system high pressure , hydrocephalous shunt system low pressure , hydrocephalous shunt system medium pressure , hydrocephalus shunt medium pressur ( vp shunt ) , hyperextension bracemedium size , icd bag 1000 ml with trocar adult size , icd bag 1000 ml with trocar pediatric size , implantable pain port with epidural catheter for long term pain management , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml , impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml , infant mucus extractor sterile pvc ( each ) , surgical material , insulin syringe sterile disposable each ( graduation upto 100 units ) 30g needle ( 40 units / ml ( 30 g needle, 40units / ml ) ) , syrings , intraocular lens 14 30d dioptre , intravenous set with airway and needle ( ( adult ) ) , surgical material , intravenous set with airway and needle ( ( pediatric ) ) , surgical material , intrepid i / a tip bent , intrepid i / a tip straight , introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm , introducer sheath 6fr , iodine drape with frame size 30x25 cm , iodine drape with frame size 35x35 cm , iodine drape with frame size 60x45 cm , iris claw iol ( pmma lens optic size 5 5.5mm overall size 8 9mm without any dialing hole, biconvex ) , iv cannula size with injection valve ( port ) ( 16g ) , consumable , iv cannula size with injection valve ( port ) ( 18g ) , consumable , iv cannula size with injection valve ( port ) ( 20g ) , consumable , iv cannula size with injection valve ( port ) ( 22g ) , consumable , iv cannula size with injection valve ( port ) ( 24g ) , consumable , iv cannula size with injection valve ( port ) ( 26g ) , consumable , iv regulator set ( control drop set each ) , consumable , j r c bag 1 ltr , j r c bag 1.5 ltr , j r c bag 500 ml , j tip 0.035 mm guidewire , jugular catheter ( 12fr ( adult ) ) , consumable , jugular catheter ( 8fr ( pediatric ) ) , consumable , k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable , k 90 catheter ( each ) , consumable , kellys pad disposable , lamino spinal drape sheet size 1.5x3 m, 50 gsm , laryngeal mask airway ( lma ) ( no. 4 ) , consumable , laryngeal mask airway ( lma ) ( no. 5 ) , consumable , laryngeal mask airway classic size 1, 1.5, 2, 2.5, 3, 4, 5 , laser radial fibre 600 micron and 400 micron , liga clip 200mm, 300mm, 400mm , lissamine green strip , litmus paper strip , liver biopsy gun size 19g , lma reusable pro seal second generation with gastric drain tube and reinforcement airway tube. size 1, 1.5, 2, 2.5, 3, 4, 5. , long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm , loop nylon suture black monofilament 1 ( 4.0 metric ) 96 ( 244 cm ) tp 1 65mm 1 / 2c taper , low adherent absorbent wound dressing with a polyester perforated wound contact layer size 50cm 7mtr roll , lung exersizer ( each ) , consumable , mackintosh double colour water proof roll ( 20 meter per roll ) , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , medical dry imaging film size 10x12 , medical dry imaging film size 14x17 , medical dry imaging film size 8x10 , megil forcep with stylet adult size 5 set , mesure volume set soft chamber, with bulb latex 110ml , methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 , micro drip set with bulb latex , micro vitreo retinal blade 20 g , microlaryngeal surgery tube no 5 , microsensor basic kit for icp monitor , mio 1 pc flat base colostomy ki: colostomy / lleostomy 1pc system flat transparent stoma bag with body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barier foil a oekotex certified and a woven water repellent textile grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection cutable size 10 to 55mm 5 pc, c shaped hydrocolide elastic tape with bevelled edges 10pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base colostomy kit: colostomy / lleostomy 60 mm aperture light convex with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, woven water repellent textile material neutral grey colour for optimal discretion 60 mm stoma transparent bag consists one barrier foil and a oekotex certified with full circle filter and wave shaped locking with highlighted colour lock button 5 pc, neutral grey colour standard size ostomy belt compatible for bags having 4 ear hooks 1 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, waterbase gaur gum and alcohol free adhesive paste 60gm 1 pc. contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues bulding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of lsopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base colostomy kit: colostomy / lleostomy 70 mm aperture light convex with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, woven water repellent textile material neutral grey colour for optimal discretion 60 mm stoma transparent bag consists one barrier foil and a oekotex certified with full circle filter and wave shaped locking with highlighted colour lock button 5 pc, neutral grey colour standard size ostomy belt compatible for bags having 4 ear hooks 1 pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, waterbase gaur gum and alcohol free adhesive paste 60gm 1 pc. contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues bulding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of lsopropyl alcohol, allantoin, natural coconut oil 5 pc , mio 2pc system convex base urostomy kit: urostomy 50mm 2pc system 6 mm aperture light convex plate with integrated flex line base plate with body fit technology additional elastic adhesive ( triple layer ) and with 4 ears belt lock 5 pc, 50 mm transparent bag, consists one barrier foil and a non woven water repellent textile grey colour material. soft locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. size 50mm 5 pc, neutral grey colour standard size ostomy belt compatible for bags having4 ear hooks 1pc, c shaped hydrocolide elastic tape with bevelled edges 10 pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmcguar gum andxanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , monopolar cautry wire disposable , monopolar electrocautery pencil with cord , mucus extractor with connector for bronchoscope capacity 70 ml , multienzymatic instrument cleaner concentrate with protease, lipase, amylase, cellulase disinfection solution ( 1 litre solution ) , multifocal / trifocal foldable iol , multifunctional mask with the attachment of nebulizer mask, venture mask, oxygen mask, aerosol mask, with 7 oxygen tube.adult and paediatric. , naso pharyngeal airway adult all size , naso pharyngeal airway paediatric all size , natural hydrowxyapatite wirh natural collagen block size 30x15x6mm , natural hydrowxyapatite wirh natural collagen block size 30x15x7mm , natural hydrowxyapatite wirh natural collagen block size 30x15x8mm , nebulization mask kit ( pediatrics ) , consumable , nebulization mask kit ( adult ) , consumable , needle 30g 1 / 2 inch bd , neonatal urine collection and measurement bag 100 ml , nitrile gloves size small / medium / large ( each ) , consumable , non absorbalble surgical suture , sterilised surgical needled suture ( coated braded polyster green ) 45cm oph 5 0 8mm 1 / 4 circle spatulated micropoint double , non oxidized, non regenarated cellulose hemostat 10x10cm , non oxidized, non regenarated cellulose hemostat 5x10cm , non oxidized, non regenarated cellulose hemostat 5x7.5cm , non oxidized, non regenarated cellulose hemostat 8x100cm , non oxidized, non regenarated cellulose hemostat 8x20cm , non rebreathing mask ( oxygen mask with reservoir bag ) , consumable , non sterile surgical rubber gloves 6.5 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , non sterile surgical rubber gloves 7 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , non sterile surgical rubber gloves 7.5 no. ( pair ) ( made of natural latex micro rough finish for better grip ) , consumable , ommaya resrvoir small , ommaya reswervoir large , one piece flat colostomy trp bag: one piece flat colostomy bag body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barrier foil and a oekotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent. experience of managing stoma care clinic. , open disposable clip applier for medium clip size 9.75 having 20 clips , open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length , open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length , open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length , open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length , ophthalmic mvr blade 20 g , ophthalmic mvr blade 23 g , oxygen adaptor 5 type , oxygen catheter , oxygen connection with flow meter for central line , oxygen connection with flow meter for cylinder , oxygen high pressure hose pipe , oxygen mask adult ( standard size ) , mask , oxygen mask pediatrics ( standard size ) , mask , oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) , oxygen regulator for control penal board ( oxygen pipe line ) , oxygen regulator for jambo cylender , oxygen tailpipe ( flexible metalic ) , p t tubes 3.8% sodium citrate ( prothrombin tube ) , pacing leads 6 fr , paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g – 20x20 length – 6cm, 12.5cm , paediatric epidural set ( with 19g needle with matel stylet 22g catheter 0.22 micron epidural catheter andsyringes , paediatric triple lumen polyurethan cvc line with nitinol j guide wire, 4.5 fr, g 20*23*23, l 6cm, 8cm, 10cm, 12.5cm , paper adhesive plaster microporous surgical tape 2inch x 10mt roll , paper adhesive plaster microporous surgical tape 3inch x 10mt roll , paper adhesive plaster microporous surgical tape 4inch x 10mt roll , paper adhesive plaster microporous surgical tape 6inch x 10mt roll , paraffin gauze dressing 10cms x10cms , pec haemostatic patch for post renal dialysis size 5cm x 7cm , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm pediatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter 6 fr ( 150 cm ) , pigtail catheter no 10 , pigtail catheter no 14 , plain sheet material 25 micron thick pe hygiene film size 210x120 cm , plain vial with screw cap size 12x75 , plaster of paris bandage 10 cm x 2.7 mtr / roll ( roll ) , bandage , plaster of paris bandage 15cm x 2.7mtr / roll ( roll ) , bandage , plaster of paris powder ( 1 kg ) , consumable , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , presbyopic correcting iol , pressure regulated v p shunt , probe for oxygen , programable valve with variable pressure settings ranges from 30 m h20 to 200 cm h20 and having interval of10 cm h20. should supply ventricular cathetor 14 cm long and distal cathetor 120 cm long , proseal lma ( plma ) size 1, 1.5, 2, 2.5, 3, 4, 5 , pulmonary artery catheter , punctual plug large , punctual plug medium , punctual plug small , pva sheets , radial a catheter , rectified sprit 4.5 ltr. , reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. , reservoir large size , retina laser pack 23 g straight constellation vitrectomy , rose bengal dye strip 500 , ryles tube size 10, 12, 14, 16, 18 , scar free silicon nasal pad , scleral buckle no 276 , scleral buckle no 277 , scleral buckle no. 240 , scleral fixated iol , scrotal support size: ?xl ( 46 52 ) inches adult , self adhering silicon external catheter should be built in band, clear odorless single sterilized pack, 100% latex free. size 25 / 29 / 32 / 36 / 41mm. , semi automatic core biopsy instrument set with 2 throw length of 10 mm and 20 mm in a single device along with a throw length indicator window and a fire ready indicator mark compatible adjustable coaxial and a blunt tip stylet. should be usfda approved 18g*10cm, 18g*16cm & 18g*20cm, 20g*10cm, 20g*16cm , shirmers strip , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , should have dual hook for zero migration post deployment should have the option of repositioning after deployment should have dustable twisted wire construction for durability. 20g*107mm , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes , silicon cautery plate , silicon drain tube / chest tube securement device all size , silicon mask size 0, 1, 2, 3, 4 & 5 , silicone foley catheter 2 way 12 fr , silicone foley catheter 2 way 14 fr , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 10 cmx 10 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 20 cmx 20cm , silk protein based sterile surgicalwound dressing sheet20 cmx 40 cm , silk protein based sterile surgical pu foam dressing 20cmx20cm , silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilizedsizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr , single piece aspheric foldable iol hydrophobic acrylic hydrophobic acrylic, aspheric, single piece foldable, uv absorbing with blue light filter, 13mm length, 6.0mm optic diameter anterior asymmetric biconvex optic, l shape stable force planar haptic 0.04% covalently bonded yellowchromophore refractive index 1.46 1.55 compatible injector system a constant 118 118.8 , single piece hydrophobic acrylic foldable iol uv absorbing posterior chamber iol with haptic 13.0mm, biconvex6.00mm optic, refractive index 1.46 1.55, a constant 118 118.8 , single piece preloaded foldable iol preloaded with 2 2.2mm delivery port and depth guard controlled by tension glide plunger with hydrophobic acrylic foldable, aspheric , single piece , uv absorbing with blue light filter , 13mm length , 6.0mm optic diameter anterior asymmetric biconvex optic, l shape stable force planar haptic, 0.04% covalently bonded yellowchromophore, refractive index 1.46 1.55, us fda approved. a constant 118 118.8 , single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip , skin protective sheet 20mx20m: skin barrier for healthy peristomal skin or risk of skin damage due to badly secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmg, sis ( 20cm20cm ) , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , spring loaded automatic biopsy gun one handed cocking machanism with non roll handle design. angle sample notch for enhance needle action choice of two firing buttons.should be usfda approved 16g* 10cm, 16g* 16 cm, 18g* 10cm, 18g* 16cm, 18g* 20cm, 18g* 25cm , stellate for e.t. tube , sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. , sterile adhesive iodine drape size: 35x44 cm , sterile adhesive iodine drape size: 45x66 cm , sterile alcohol swabs , sterile disposable syringe 1ml , sterile disposable syringe with needle 2ml , sterile disposable syringe with needle 3 ml , sterile disposable syringe with needle 5ml , sterile gauze swab / pad , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 50ml , sterile leur lock syringe 20ml , sterile leur lock syringe 50ml , sterile luer lock syringe 10 ml , sterile luer lock syringe 5 ml , sterile wet eye wipes , sterlization roll for plasma sterlizer 100 mm , sterlization roll for plasma sterlizer 150 mm , sterlization roll for plasma sterlizer 250 mm , subcutaneous catheter passer adult , subcutaneous catheter passer pediatric , suction pro kit for closed suction of tracheostomy with 12f catheter , supreme lma ( slma ) , surgical blade isi marked, size 11 ( 100 per packet ) , surgical material , surgical blade isi marked, size 15 ( 100 per packet ) , surgical material , surgical blade isi marked, size 22 ( 100 per packet ) , surgical material , surgical blade isi marked, size 24 ( 100 per packet ) , surgical material , surgical eye sponge spear , surgical kitdrape gown , surgical spirit ip ( 500 ml ) , bottle , sutureless dural substitute 4*6 cm , sutureless dural substitute 8*8 cm , t.piece circuit with oxygen tubing set ( complete set ) , tear test strip ( 100 strips in box ) , terumo guide wire m 0.035” 260cm j angled tip , thermometer digital , thomas splint , three piece iol with acrylic optic and pmma heptic acrylic multipiece sterile pcl ( iol / pc ) , 13.0mm length, 6.0mm optic diameter anterior asymmetric biconvex optic, 10 degree haptic, refractive index 1.46 1.55, a constant 118 118.8 , three way foley catheter, 10 fr , three way stop cock , tissue adhesives , titanium curved cranial mesh 100x100mm , titanium curved cranial mesh 120x120mm , titanium curved cranial mesh 120x150mm , titanium curved cranial mesh 120x180mm , titanium curved cranial mesh 60x60mm , titanium curved cranial mesh 60x80mm , titanium mesh for cranioplasty mesh 40x40mm curved , titanium self tapping screw 4 / 5mm , tmt graph paper , tounge depresser wooden , tracheostomy filter ( each ) , consumable , tracheostomy tube cuffed plastic size 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , tracheostomy tube with suction aid size: 8 and 8.5 , transbronchial needle aspiration , transducer set for invasive b.p. , translucent soft polyfilm surgery drape size 120x120 cm, incise area 25x20cm , triway with extention size 10, 50, 100, 150 , t tube size: 10, 12, 14, 16 &18 , turp set , twin nasal cannula adult , twin nasal cannula padiatric , ureteral catheter set , urine collecting bag 2 ltr. , urine collecting bag with urometer 1 ltr. , urine sugar diagnostic stip , vaccum adaptor 5 type , vaccum jar 1000 ml with regulator , vaccum jar 2000 ml with regulator , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , vascular haemostatic pad to stop external bleeding and catheterization site bleeding, chitosin material size 5x5 single pack. sterilized , vdrl rpr test kit , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter mount+bacteria filter ) , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , vfc ( viscous fluid control ) pack constellation vitrectomy , video camera cable cover length 2.5m width 15cm , vitrectomy set 23 g 10 k valve std total plus constellation vitrectomy , vitrectomy set 25 g 7.5 valve std total plus constellation vitrectomy , water bed , wipes , wound manager: large, diameter 208x297mm self adhesive, with flexible lid, which contain a drain port to remove the effluent from the bag, antireflux valve & inflatable ring which can be filled with air so that the lid should not touch the wound, unique daisy flower shaped base plate for better fit to body contours. one transparent window for easy inspection which can be remove time and again for inspection. the system should contain one transparent marking sheet so as to mark the required shap and size for cutting area 1pc, water base gaur gum and alcohol free adhesive paste 60gm 1 pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to maintain 5.5 skin ph 1pc, cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound manager: medium, diameter 156x228mm self adhesive, with flexible lid, which contain a drain port to remove the effluent from the bag, antireflux valve & inflatable ring which can be filed with air so that the lid should not touch the wound, unique daisy flower shapedbase plate for better fit to body contours. one transparent windowfor easy inspection which can be remove time and again for inspection. the item should contain one transparent markingsheet so as to mark the required shap and size for cuting area 1pc, water base gaur gum and alcohol free adhesive paste 60gm 1pc, contain magnesium citrate, glycerine, petrolatum, citric acid skin barrier cream to mairntain 5.5 skin ph 1pc. cmc guar gum and xanthan gum base stoma powder 25gm 1pc, hexamethyldisiloxane cyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barrier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residues building up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound manager: small, diameter 104x159mm self adhesive, with lexible lid, whichcontain adrain port to remove the effluent from the bag, antirefluxvalve &inflatable ring which can be filled with alr so that the lidshould not touch the wound, unique daisy flower shaped base platefor better fit to body contours, one transparent window for easyinspection which can be remove time and again for inspection. thesystem should contain one transparent marking sheet so as tomark the required shap and size for cutting area 1pc, water basegaur gum and alcohol free adhesive paste 60gm 1 pc, containmagnesium citrate, glycerine, petrolatum, citric acid skin barriercream to maintain 5.5 skin ph 1pc. cmc guar gum and xanthangum base stoma powder 25gm 1pc, hexamethyldisiloxanecyclonentasiloxane and silicone base adhesive remover spray 1pc, silicon based non alcoholic skin barier spray contain hexamethyldisiloxane cyclonentasiloxane to avoid residuesbuilding up by creating theam breathable film on the skin 50ml, cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil 5 pc , wound protector extra small incision size 2 4 cm , wound protector large incision size 9 14 cm , wound protector large incision size 9 14 cm with retraction ring , wound protector medium incision size 5 9 cm , wound protector small incision size 2.5 6 cm , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray cassets ( 10x12 ) , consumable , x ray cassets ( 12x15 ) , consumable , x ray cassets ( 8x10 ) , consumable , x ray developer ( 22.5 ltr ) , consumable , x ray film fixer ( powder to make 22.5 liters pkt ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 10x12 ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 12x15 ) , consumable , x ray film ( blue sensitivity ) 50 sheet packet ( size 8x10 ) , consumable , x ray hangers ( clip type ) size 10x12 , x ray hangers ( clip type ) size 12x15 , x ray hangers ( clip type ) size 8x10 , x ray screen high speed size 12x15 , x ray screen high speed size 8x10 , x rayscreen high speed size 10x12 , y connector with extra long ventricular catheter , yankauer suction catheter ( complet set ) , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 1 0 30cm, green 37mm 1 / 2 circle taper point , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 2 0 30cm, green 37mm 1 / 2 circle taper point , 20g round body cutting needle 1 / 2 circle , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm , 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm , 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks , 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks , absorbable adhesion barrier in the form of off white knitted fabric prepared by oxidized regenerated cellulose indicated for both open and laparoscopic procedures , absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle fda approved , absorbable polycryl suture 7 0 3 / 8 circle spatulated micropoint needle polyglactin 910 usp , absorbable surgical suture ( synthetic ) sterilised surgicalneedled suture ( monofilament polydioxanone violet ) 70cm , absorbable unidirectional barbed devicepolydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm , black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm , black braided silk eyeless needled suture usp, code 5036 size 2 0 suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 45mm , black braided silk eyeless needled suture usp, code 5082 size 4 0 suture length76cm, needle length & description 3 / 8 circle round bodied 16mm , black braided silk eyeless needled suture usp, code 5333 size 2 0 suture length 76cm, needle length & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 5 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 16mm , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 25mm , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 suture length76cm, needle length & description 1 / 2 circle round bodied 20mm , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in , braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) , braided synthetic absorbable eyeless needled suture uspbraided ab. suture 6 0 rc 1 / 4 circle 45cm needle 8 mm , braided synthetic absorbable polyglactin 910 eyeless needled suture size 6 0 round body needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2341, size 2 0 suture length in 70cm 1 / 2 circle round bodied 30mm , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2346, size 1 0 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2347, size 1 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2421, size 1 suture length in 90cm 1 / 2 circle rc 40mm os needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2534, size 1 0 suture 90cms, 1 / 2 circle rc 36mm, os6 needle , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 20mm length 75cm size 3 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 30mm length 100cm size 2 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 36mm length 90cm size 3 / 0 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 / 0 , complete absorbable mesh fixation device with minimum strap length 7.0 mm2 point fixation to hold the mesh and device with 25 tacks only. , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. , disposable sterile perforator 14mm , knotless wound closure device with unidirectional 2 0 45cm, undyed24mm3 / 8 circlereverse cutting , knotless wound closure device with unidirectional 3 0 58cm, undyed24mm3 / 8 circlereverse cutting , macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm , monofilament glycomer0, 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer1, 90cm, violet 40mm 1 / 2 circle taper point , monofilament glycomer2 0 , 75cm, violet27mm1 / 2 circletaper point , monofilament glycomer3 0 75cm, undyed24mm3 / 8 circle reverse cutting , monofilament glycomer3 0 75cm, violet22mm1 / 2 circletaper point , non absorbable 4 0 polyester green braided 76cm , non absorbable pre shaped polypropylene mesh large size , non absorbable pre shaped polypropylene mesh medium size , non absorbable pre shaped polypropylene mesh small size , non absorbable prolene suture 6 0 polypropylene blue monofilament 3 / 8 round body needle 60cm , non absorbable surgical suture polypropylene 5 0 suture with reverse cutting needle 3 / 8 circle, 13.1mm, blue monofilament for scleral buckle , non absorbable surgical suture usp sterilised surgical suture ( braided silk black ) 38 cm 6 0 ( 0.7 metric ) 8mm 1 / 4 circle reverse cutting micropoint , non absorbable surgical suture usp sterilised surgical suture ( braided silk black ) 90 cm 5 0 ( 1 metric ) 12mm 3 / 8 circle reverse cutting , non absorbable suture polyester green 4 0 suture with 8mm 1 / 4 circle round body micropoint needle , non absorbable suture polyester green 4 0 suture with 8mm 1 / 4 circle spatulated micropoint needle , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 2 0 ( 3 metric ) 30mm 1 / 2 circle reverse body 90cm , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 2 0 ( 3 metric ) 30mm 1 / 2 circle round bodied 90cm , non absorbalble surgical suture usp sterilised surgical needled suture ( braided silk black ) 5 0 ( 3 metric ) 30mm 1 / 2 circle reverse body 90cm , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in x 2 in ( 2.5cm x 5.1cm ) , oxidized regenerated cellulose based topical absorbable hemostar thicker weave 4x8 , oxidized regenerated cellulose based topical absorbable hemostat, fibrillar / layer form, with bactericidal property. fibril material ( 7layers ) for broad surface area coverage. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 4x4 inch , oxldlzed regenerated cellulose; rayon fiberas per us phrmcopela standards enforceable by us fda with bactericidal property 2x3 , oxldlzed regenerated cellulose; rayon fiber as per us phrmcopela standards enforceable by us fda with bactericidal property 3x4 , patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or andus fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. , pigtail catheter with needle length: 30cms size: 10fr, 12fr., 14fr, 16fr, 18fr , pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system , poliglecaprone 25 undyed 3 0, 3 / 8 circle reverse cutting26mm 70cm. , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , polydioxanone122cm, no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. , polydioxanone150cm usp1 0 rb ctx, 1 / 2 circle, 48mm , polydioxanone suture violet monofilament 1 ( 4.0 metric ) 96 ( 244 cm ) tp 1 65mm 1 / 2c taper , polydioxanone suture violet monofilament 2 0 ( 3.0 metric ) 27 ( 70 cm ) double armed trocar point stp 10 ( 10 ) needle straight 254mm , polydioxanone suture violet monofilament 3 0 ( 2.0 metric ) 36 90cm sh 26mm 1 / 2c taper , polydioxanone suture violet monofilament 4 ( 1.5 metric ) 36 90cm v 5 17mm 1 / 2c taper , polydioxanone suture violet monofilament 4 0 ( 1.5 metric ) 36 90cm v 5 17mm 1 / 2c taper , polyester suture no. 2 x 100 45mm hc tc , polyester suture no. 5 x 75 55mm hc tc , polyglactin 910 1 x 100 45mm hc rb , polyglactin 910 fast und 0 x 110 40mm hc rb , polyglactin 910 fast und 2 0 x 100 36mm hc rb , polyglactin 910 suture violet braided 4 0 ( 1.5 metric ) 18 ( 45cm ) tf 13mm 1 / 2c taper , polyglactin 910 with triclosan no. 0 x 90 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 100 55mm hc rb , polyglactin 910 with triclosan no. 1 x 90 36mm hc tc , polyglactin 910 with triclosan no. 1 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 x 90 40mm hc rb , polyglactin 910 with triclosan no. 2 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 0 x 90 30mm hc rb , polyglactin 910 with triclosan no. 2 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 20mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 36mm hc tc , polyglactin 910 with triclosan no. 4 0 x 70 20mm hc rb , polyglactin 910 with triclosan no. 5 0 x 45 16mm hc rb , polyglactin 910 with triclosan no.1 0x 90 36mm hc rc , polyglactin 910 with triclosan no.1 0x 90 40mm hc rb , polyglactin 910 with triclosan no.1 0x 90 40mm hc tc , polyglycolic acid no. 1 x 180 50 / 40mm cu rb hc tc dn , polypropylene 6 0x60 10mm hcrb dntp3 , polypropylene 7 0x60 09mm hcrb dntp3 , polypropylene 9 0 suture double arm reverse cutting straight needle color blue 8in , polypropylene blue monofilament p 3 13mm 3 / 8c reverse cutting 6 0 ( 0.7 metric ) 18 ( 45cm ) , polypropylene clear monofilament non absorbable cp 2 reverse cutting 1 / 2 circle 26mm 1 0 ( 4.0 metric ) 14cmx14cm bi directional, suture , polyster braided1 / 2 circle tapercut double needle with 17 mm needle and suture lenght 90cm , progrip self fixating mesh 12*08cm , progrip self fixating mesh 14*9cm , progrip self fixating mesh 15*15cm , progrip self fixating mesh 20*15cm , progrip self fixating mesh 30*15cm , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved , scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved , self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved , sterlizedabsorbable eyeless needled suture usp, code 2341, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlizedabsorbable eyeless needled suture usp, code 2345, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm , sterlizedabsorbableeyeless needled suture usp, code 2304, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbableeyeless needled suture usp, code 2317, size 2 0 suture length in cm 90cm needle length & description 1 / 2 circle round 30mm , sterlizedabsorbableeyeless needled suture usp, code 2437, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2303, size 5 0 suture length in cm 45cm needle length & description 1 / 2 circle round bodied 16mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2442, size 5 0 suture length in cm 45cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3318, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circlecutting cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3328, size 3 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 26mm , sterlized monofilament polyamide eyeless needled suture usp, code 3336, size 2 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 45mm , sterlized monofilament polyamide eyeless needled suture usp, code 3347, size 1 suture length in cm 100cm needle length & description 1 / 2 circleround bodied 40mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 7003, size 10 0 suture length in cm 30cm needle length & description 3 / 8 circledouble arm 6mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 3317, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 829, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 13mm double armed. , sterlized monofilament polypropyleneeyeless needled suture usp, code 841, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 842, size 1 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropylene eyeless needled suture usp, code 823, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle slim blade cutting 15mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 843, size 1 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm heavy , sterlized monofilament polypropylene eyeless needled suture usp, code 849, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 870, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 881, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 882, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm.double 16mm armed , sterlized surgical chromic gutsutue eyeless needied usp, code 4201, size3 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle cutting 22mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4216, size2 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4217, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4221, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 40mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4227, size 1, suture length in cm 100cm needle length & descriptio 1 / 2 circle round bodied 45mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4237, size3 / 0, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4259, size1, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 40mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. , surgical silk bradedsterile foilover wrappack code 213 size 2 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 214 size 1 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 215 size 1 suture length in 2 x 75cm , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. , synthetic absorbable surgical suturetriclosancoated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved , synthetic absorbable surgical suture , polyglactin 910 with triclosan coated, undyed 3 0, 3 / 8 circle cutting ps1 prime, multi pass ethalloy, 24mm, 70 cm undyed , synthetic absorbable surgical suture , polyglactin 910 with triclosan coated undyed 2 0, 1 / 2 circle round body taper point ct 1 36 mm , 90 cm undyed , synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm , synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved , synthetic absorbable surgical suture, polyglactin 910 with triclosan coated undyed1, 1 / 2 circle round body taper point ct 1 36mm, 90cm undyed. , transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system , triclosan antibacterial coated polyglactin with 23 mm needle suture length 70cm, reverse cutting portt heavy needle size 1 no. , v shape clip applicators large , v shape clip applicators medium , v shape clip applicators medium large , v shape clip applicators small , v shape ligation clip large , v shape ligation clip medium , v shape ligation clip medium large , v shape ligation clip small , aciclovir 200mg / 5ml oral suspension 100ml bottle , albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( ( additional composition of menthol also acceptable ) 100ml bottle ) , syrup , ammonium chloride+ diphenhydramine+sodium citrate+menthol ( 138mg+14.08mg+57.03mg+2.5mg each 5ml cough syrup ) 100 ml, syrup , amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , syrup , amoxicillin ( 125 mg / 5ml ( 30 ml bottle ) ) , suspension , azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , syrup , baclofen 5 mg / 5ml ( 100 ml bottle ) , bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup , calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , syrup , calcium phosphate ( 2 : 1 ratio ( 100 ml bottle ) ) , syrup ( each 5 ml contains : calcium 82 mg + vitamin d3 ( cholecalciferol ) 200 iu + vitamin b12 ( cynocobalamin ) 2.5 mcg ) , syrup , carbamazepine 100 mg / 5 ml oral suspension 100ml bottle , cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension , cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup , chloramphenicol 125 mg / 5ml 60ml syrup , chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole oral suspension i.p. 50 ml bottle , cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml 200ml bottle , cyclosporine oran solution usp 100mg / ml 50 ml bottle, syrup , cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup , cyproheptadine hcl l lysine multivitamin syrup 200 ml syrup , dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup , disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup , domperidone suspension 1mg / ml ( 30ml bottle ) , suspension , etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup , glycerin ( glycerol ) oral liquid ip ( 100 ml bottle ) , ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup , ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) , syrup , iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg ( per 5ml ) ( iron syrup 200 ml ) , bottle , lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution , levetiracetam 100mg / ml syrup / solution ( 100ml bottle ) , syrup , magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup , metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension , milk of magnesia+liquid paraffin 11.25ml+3.75ml ) 15ml ) , syrup ( 200ml bottle ) , syrup , multivitamin multimineral with antioxidant ( ascorbic acid 40 mg+cyanocobalamin 1 mcg+d panthenol 5 mg+folic acid 0.1 mg+l isoleucine 6.195 mg+l leucine 19.21 mg+l lysine 26.25 mg+l phenylalanine 5.25 mg+l threonine 4.41 mg+l valine 7.035 mg+methionine 9.66 mg+niacinamide 12 mg+pyridoxine 1.5 mg+riboflavine 1.1 mg+thiamine mononitrate 1 mg+tryptophan 5.25 mg / 15ml ) 200 ml syrup , nitazoxanide ( 100mg / 5ml ) 30 ml bottle , norfloxacin suspension ( 100 mg / 5 ml 30ml syrup ) , syrup , ofloxacin suspension 50mg / 5 ml ( 60 ml bottle ) , suspension , omega 3 fatty acid with vitamin d3 emulsion 150 ml bottle , ondansetron ( 2mg / 5ml 30ml bottle ) , syrup , paracetamol 150 mg / ml ( 15 ml bottle with dropper ) , drop , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) ( syrup ) , syrup , phenobarbitone ( 20 mg / 5ml 100 ml bottle ) , syrup , phenytoin sodium oral suspension 30mg / 5ml 100 ml bottle , potassium chloride oral solution 100mg / ml ( 200ml bottle ) , bottle , prednisolone 5 mg / 5ml 60 ml syrup , salbutamol sulphate ( 2mg / 5ml 60ml ) ( 60ml bottle ) , syrup , sodium valproate oral solution ( 200 mg / 5 ml ) 200 ml bottle, solution , sodium valproate oral solution ( 200 mg / 5 ml ) , solution 100ml syrup , sorbitol 7.15 gm+tricholine citrate 0.55 gm 200ml bottle , sucralfate ( 1gm / 5ml ) 100 ml bottle, syrup or suspension , sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 ml suspension ( 50 ml bottle ) , suspension , vitamin a syrup ( 100000 iu / ml with 1ml and 2 ml ( 100 ml bottle ) ) , syrup or solution , vitamin b complex nfi formula ( 100ml bottle ) , syrup , zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup , 6 mercaptopurine tablets ip 50mg , acamprosate ( 333 mg ) , tablet , acarbose 25 mg tablet , aceclofenac +thiocolchicoside ( 100mg+8mg ) , tablet , aceclofenac 100 mg +paracetamol 325 mg +chlorzoxazone 250 mg ( 100mg+325mg+250mg ) , tablet , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 15mg ( 10x10 ) , tablet , aceclofenac 100mg+paracetamol 325mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 500mg , tablet , aceclofenac 100mg+serratiopeptidase 10mg ( 10x10 ) , tablet , aceclofenac ( 100mg ) , tablet , acenocoumarol 1mg , acenocoumarol ( 2 mg ) , tablet , acetazolamide tab ( 250mg ) , tablet , aciclovir tab 400 mg, tablet , acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet , acyclovir ( 800mg ) , tablet , ademetionine ( 400mg ) , tablet , afatinib 40 mg tablet , agomelatine 25 mg tab , albendazole + ivermectin ( 400mg + 6mg ) , tablet , albendazole ip ( 400mg ) , tablet , alendronate ( 70 mg ) , tablet , alfuzocin hcl 10mg tablet , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg , alprazolam 0.25 mg , amantadine hydrochloride 100 mg tablet , ambroxyl 30mg tab , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline tab. ip ( 25 mg ) , tablet , amitriptyline ( 10 mg ) , tablet , amitryptiline tab ( 50 mg ) , tablet , amitryptiline ( 75 mg ) , tablet , amlodipin tab ( 10mg ) , tablet , amlodipin tab ( 2.5mg ) , tablet , amlodipin tab ( 5mg ) , tablet , amlodipine ( 5 mg ) + metoprolol ( 50 mg ) , amlodipine ( 5 mg ) + telmisartan ( 40 mg ) , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , armodafinil 50 mg tablet , artemether 80mg lumefantrine 480mg tablets. packing 10x1x6 , artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg + pyrimethamine 25 mg ( 1 tab ) ( age group between 1 4 year ) , combi blister pack , ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet , aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg , aspirin 75 mg+prasugrel 10 mg , aspirin low dose ( 150mg tab ) , tablet , aspirin low dose ( 75mg tab ) , tablet , atenolol ( 25 mg ) , tablet , atenolol ( 50 mg ) , tablet , atomoxetine 10 mg tab , atomoxetine 25 mg tab , atorvastatin 10 mg , atorvastatin 10 mg+aspirin 75 mg. , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tablet combikit , baclofen ( 10 mg tab ) , tablet , baclofen ( 20 mg tab ) , tablet , baclofen ( 30 mg tab ) , tablet , baclofen ( 40 mg tab ) , tablet , baclofen ( 5 mg tab ) , tablet , benfothiamin 150mg , betahistine ( 16 mg ) , tablet , betahistine ( 4 mg ) , tablet , betahistine ( 8 mg ) , tablet , betamethasone ( 0.5 mg ) , tablet , bicalutamide 50 mg, tablet , bisacodyl ( 5mg tab ) , tablet , bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg , bisoprolol 5 mg+amlodipine 5 mg , blonanserin 2 mg , blonanserin 4 mg , bosentan 62.5 mg tab , briveracetum 50mg tab , bromocriptine 2.5mg tab , buprinorphine 4mg , buprinorphine 8 mg , bupropion150 mg , bupropion300 mg , buspirone 10 mg , buspirone 5 mg , cabergoline tablets ip 0.25 mg , cabergoline tablets ip 0.5 mg , calcitriol 0.25mcg + calcium carbonate 500mg + zinc sulfate 7.5 mg , tablet , calcium acetate 667 mg tab , calcium carbonate ( 500 mg ) , tablet , calcium with vitamin d3 tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet , capecitabine ( 500mg ) , tablet , carbamazepine sr100 mg, tablet , carbamazepine sr200 mg, tablet , carbamazepine sr400 mg, tablet , carbamazepine ( 200 mg ) , tablet , carbimazole 20 mg tablet , carbimazole ( 5 mg ) , tablet , carvedilol ( 3.125 mg ) , tablet , carvedilol ( 6.250 mg ) , tablet , cefadroxil 500 mg , cefixime 200 mg + clavulanic acid 125 mg ( tab ) , tablet , cefixime tab ip ( 100mg ) , tablet , cefixime tab ip ( 200mg ) , tablet , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet , cefuroxime 500 mg 10 x 10 ( 500 mg ) , tablet , cetirizine10 mg , chlordiazepoxide ( 10 mg ) , tablet , chlordiazepoxide ( 25 mg ) , tablet , chloroquine phosphate tab. ( 250mg ) , tablet , chlorpheniramine maleate 2 mg+phenylephrine 10 mg+nimesulide 100mg +caffeine 30 mg , chlorpheniramine maleate ( 4mg ) , tablet , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidone ( 50mg ) , tablet , chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tablet , cilostazole 100 mg tablets , cilostazole 200 mg tablets , cinnarizine 20 mg and dimenhydrinate 40 mg , cinnarizine ( 25 mg ) , tablet , cinnarizine ( 5 mg ) , tablet , ciprofloxacin ( 500mg ) , tablet , citicoline ( 500mg ) , tablet , clarithromycin ( 250 mg ) , tablet , clobazam ( 10 mg ) , tablet , clobazam ( 5 mg ) , tablet , clomipramine 50 mg, tablet , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine 100 mcg tablet , clopidogrel75 mg , clopidogrel 150mg+ aspirin 75 mg , clopidogrel 75 mg+aspirin 75 mg , clopidogrel 75 mg+atorvastatin 20 mg , clotrimazole antifungal 400mg tablet , clotrimazole vaginal tablet i.p. 500mg , clozapine ( 100 mg ) , tablet , clozapine ( 25 mg ) , tablet , clozapine ( 50 mg ) , tablet , coenzyme q 10 120 mg , cyanocobalamin 2 mg with folic acid 2.5 mg tablets , cyclophosphamide 50 mg tab , dapagliflozin 5 mg tablet , dapsone 100 mg tablet , dasatinib 50 mg , deferasirox dispersible 250 mg tab , deferasirox dispersible 500 mg tab , deflazacort 30 mg tab , deflazacort ( 6mg ) , tablet , desmopressin acetate 0.5mg tablet , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet , diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet , diclofenac sodium 50mg + paracetamol ( 500mg ) , tablet , diclofenac sodium ( 50 mg ) , tablet , dicyclomine ( 10mg ) , tablet , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg + ranitidine 150mg tablets , domperidone 10 mg tab , donepezil10 mg , donepezil 5 mg , doxophylline400 mg tablet , drotaverine ( 40 mg ) , tablet , drotaverine ( 80 mg ) , tablet , duloxetine 20 mg tab , duloxetine 30 mg tab , duloxetine ( 40 mg ) , tablet , dydrogesterone 10mg , eltrombopag olamine 50 mg tablet , empagliflozin 25mg tablet , enalapril maleate 2.5 mg , enalapril maleate 5 mg , entecavir ( 0.5 mg tablet / capsule ) , tablet or capsule , entecavir ( 1 mg tablet / capsule ) , tablet or capsule , eplerenone 25mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , esomeprazole 40mg , ethambutol tablets 400 mg , ethambutol tablets 800 mg , ethamsylate 500 mg , etizolam 0.25 mg+propranolol 20 mg, tablets , etizolam ( 0.5mg ) , tablet , etophylline ( 77 mg ) + theophylline ( 23 mg ) , tablet , etoposide 50 mg , etoricoxib 90mg , everolimus 5 mg tablets , farmalin 1gm tab ( 100 tab per box ) , febuxostat 40 mg , fenofibrate 160 mg tablets , ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet , ferrous sulphate ip equivalent to 60 mg elemental iron & 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet , flavoxate hcl 200mg , fluconazole 150 mg , fludrocortisone 100 mcg tablet , flunarizine 10 mg , flunarizine 10 mg+propranolol 40 mg , flunarizine 5 mg , fluvoxamine 50 mg , folic acid 5 mg , folic acid 800 mcg , formalin 1000 mg tablet , frusemide40 mg , fungal diastase 100 mg+papain 60 mg , gabapentin 400 mg+nortriptyline 10 mg , gabapentin ( 100mg ) , tablet , gabapentin ( 300mg ) , tablet , ganciclovir 1000 mg tablet , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 60mg , gliclazide 80 mg , glimepiride + metformin hydrocloride sr ( 1 mg + 500 mg ) , tablet , glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg , glimepiride 2 mg+metformin 500 , glimepiride ( 1 mg ) , tablet , glimepiride ( 2 mg ) , tablet , glipizide 5 mg+metformin 500 mg , glucosamine and chondroitin sulfate ( 750 mg tablet ) , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg tablet , hydrocortisone tablets for usp, 20mg , hydroxychloroquine ( 200 mg ) , tablet , hydroxychloroquine ( 400 mg ) , tablet , hydroxyzine hcl 10 mg tablet , hyoscine butylbromide tab 10mg , ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet , ibuprofen ( 400mg ) , tablet , imatinib ( 100 mg tab ) , tablet , imatinib ( 400 mg tab ) , tablet , imipramine ( 25mg ) , tablet , imipramine ( 75mg ) , tablet , indapamide hemihydrate 1.5mg , iron folic acid tab ferrous sulfate desiccated ip 333 335 mg equivalent to 100mg of elemental iron +folic acid ip 0.5mg tab ferrous sulphate of elemental iron +folic acid ip 0.5tab ferrous sulphate dessicated ip equivalent to 20mg , isoniazid 300mg tablet , isosorbide dinitrate tab ip ( 5mg ) , tablet , isosorbide mononitrate 30 mg , isosorbide 5 mononitrate ( tab.20 mg ) , tablet , itopride 150mg , itopride hydrochloride 25 mg tablets , itopride hydrochloride 50 mg tablets , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactic acid bacillus ( 120m ) , lactic acid bacillus ( 60 million spores ) , tablet , lamotrigine dt tab ( 100 mg ) , tablet , lamotrigine dt tab ( 50 mg ) , tablet , lamotrigine dt ( 25 mg ) , tablet , lansoprazole 15 mg, tablet , lapatinib 250 mg , l carnosine 200 mg tablet , letrozole ( 2.5 mg ) , tablet , levetiracetam 250 mg , levetiracetam 500 mg , levetiracetam 750 mg tablet , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa 100 mg + carbidopa 25mg, tablets , levofloxacin tab 500mg , levofloxacin ( 750mg ) , tablet , linezolid tab ( 600 mg ) , tablet , lithium carbonate 300 mg , lithium carbonate 400 mg , loperamide hydrochloride 8 mg tablet , lorazepam ( 1 mg ) , tablet , lorazepam ( 2 mg ) , tablet , lorcaserine hydrochloride tablets ip 10 mg , losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , lurasidone hydrochloride 20mg tablet , lurasidone hydrochloride 40mg tablet , magnesium oxide 200 mg , magnesium valproate 400 mg , mebendazole 100 mg tab , meclizine hydrochloride 25 mg tablet , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg+80 mg ) , tablet , megestrol acetate 40mg tablets , melatonin 3mg , melatonin 6mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin ( 1000 mg ) + vildagliptin ( 50 mg ) , metformin + glimepiride ( 500 mg + 2 mg tablet ( sr form also acceptable ) ) , tablet , metformin 500 mg+voglibose 0.3 mg , metformin ( 1000mg ) , sr tablet , metformin ( 500 mg ) , tablet , metformine 500 mg+ gliclazide 80 mg tab , metformine 500mg + glibenclamide 5mg ( tab ) , tablet , methimazole 10 mg tab , methocarbamol500 mg tablet , methotrexate ( 10 mg ) , tablet , methotrexate ( 2.5 mg ) , tablet , methotrexate ( 5 mg ) , tablet , methotrexate ( 7.5 mg ) , tablet , methyl prednisolone ( 16mg ) , tablet , methyl prednisolone ( 4mg ) , tablet , methyl prednisolone ( 8mg ) , tablet , methylcobalamin ( 1500 mcg ) , tablet , methylcobalamin ( 1500 mcg ) + folic acid 5 mg , tablet , methylcobalamin / mecobalamin ( 500 mcg ) , tablet , methyldopa 250 mg tablet , methylphenidate 10 mg , methylphenidate 20 mg , methylphenidate 5 mg , metoclopramide ( 10mg ) , tablet , metoclopramide ( 5mg ) , tablet , metolazone 5 mg tablet , metoprolol 12.5 mg , metoprolol 50 mg+ramipril 5 mg , metoprolol ( 50mg ) , tablet , metronidazole tab ( 400mg ) , tablet , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet kit , mirtazapine ( 15 mg ) , tablet , mirtazapine ( 30 mg ) , tablet , mirtazapine ( 7.5 mg ) , tablet , misoprostol ( 200mcg ) , tablet , modafinil100 mg tablet , modafinil200 mg tablet , morphine sulphate ( 10 mg ) , tablet , moxonidine 0.3 mg , multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12, vit b 6, 0.5 mg, vit c 50mg, vit d3 250iu, niacinamide 25mg, folic acid 0.2mg ( with approximateoverages ) , mycophenolate mofetil ( 250mg ) , tablet , mycophenolate mofetil ( 500mg ) , tablet , n acetyl cysteine 600 mg tablet , n acetylcysteine 300 mg , naltrexone ( 50 mg ) , tablet , naproxen 250 mg tablet , naproxen 500 mg tablet , naproxen 500mg domperidone 10mg tablets , nebivolol 5mg , nicorandil 5 mg tab , nicotinamide ( tablet 25 mg ) , tablet , nicotinamide ( tablet 50 mg ) , tablet , nicoumalone 1 mg , nicoumalone 2mg tablet , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nimesulide 100 mg , nimodipine 30 mg tablet , nitazoxanide 500mg tablet , nitazoxanide dispersible 200 mg tablet , nitrocontin 2.6mg , nitrofurantoin ( 100mg ) , tablet / capsule , nitroglycerin 2.5 mg , nitroglycerine ( glyceryl trinitrate ) ( sublingual tab 0.5 mg ) , tablet , norfloxacin tab. 400mg , norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet , ofloxacin + ornidazole ( 200mg and 500mg ) , tablet , ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet , ofloxacin tab 400 mg , olanzapine ( 10 mg ) , tablet , olanzapine ( 2.5 mg ) , tablet , olanzapine ( 20 mg ) , tablet , olanzapine ( 5 mg ) , tablet , olanzapine ( 7.5 mg ) , tablet , olmesartan 10 mg , olmesartan 20mg , olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg , olmesartan medoxomil 40 mg+amlodipine 5 mg , olmesartan medoxomil ( 40 mg ) , tablet , ondansetron ( tab 4 mg ) , tablet , ondansetron ( tab 8 mg ) , tablet , ornidazole tab ( 500 mg ) , tablet , oxcarbazepine ( 150 mg ) , tablet , oxcarbazepine ( 300 mg ) , tablet , oxcarbazepine ( 600 mg ) , tablet , oxybutynin hydrochloride 2.5mg tablets , paliperidone extended release 1.5 mg tablet , paliperidone extended release 3 mg tablet , pantaprazole ( 40mg tab ) , tablet , pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet , pantoprazole 40 mg+domperidone 30 mg , paracetamol suppositories 250mg , paracetamol ( 500mg ) , tablet , paracetamol ( 650mg ) , tablet , paroxetine cr ( 12.5 mg ) , tablet , pazopanib 200 mg tablet , penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet , pentoxyfylline ( 400 mg ) , tablet , pentoxyfylline ( 400 mg ) , tablet , perampanel film coated tablets 4mg , phenobarbitone ( 30 mg ) , tablet , phenobarbitone ( 60 mg ) , tablet , phenytoin sodium ( 100mg ) , tablet , pioglitazone ( 15 mg ) , tablet , pioglitazone ( 30 mg ) , tablet , piracetam ( 400mg ) , tablet , piracetam ( 800mg ) , tablet , posaconazole 100 mg tablet , pramipexol 0.50 mg tablet , pramipexole prolonged release 0.26 mg tablet , prazosin tab ( 10 mg ) , tablet , prazosin tab ( 5 mg ) , tablet , prednisolone ( 10 mg ( dt also acceptable ) ) , tablet , prednisolone ( 5 mg ( dt also acceptable ) ) , tablet , pregabalin ( 75mg ) , capsule , primaquin ( 15mg ) , tablet , primaquin ( 7.5mg ) , tablet , procyclidine hydrochloride 5 mg tablet , promethazine 25 mg tablet , propranolol ( 10 mg ) , tablet , propranolol ( 20 mg ) , tablet , propranolol la ( 40 mg ) , tablet , propylthiouracil tablets ip 50mg , prucalopride 2 mg film coated tablets , pyridoxine ( 40 mg ) , tablet , quetiapine ( 100 mg ) , tablet , quetiapine ( 200 mg ) , tablet , quetiapine ( 50 mg ) , tablet , quinine sulphate ( 300mg ) , tablet , ramipril ( 2.5 mg ) , tablet , ramipril ( 5 mg ) , tablet , ranitidine ( 150mg ) , tablet , ranolazine er 500 mg tablet , rifaximin 550 mg tablets , risperidone ( 0.5 mg ) , tablet , risperidone ( 2 mg ) , tablet , risperidone ( 4 mg ) , tablet , rivaroxaban 10 mg tablet , rivaroxaban 15 mg tablet , rivaroxaban 5 mg tablet , rivaroxaban film coated tablets 20 mg , rosuvastatin 20 mg , rosuvastatin ( 10 mg ) , tablet , sacubitril 24 mg+valsartan 26 mg , secnidazole film coated tablets 500 mg , sertraline ( 100 mg ) , tablet , sertraline ( 50 mg ) , tablet , sevelamer ( 400 mg ) , tablet , sevelamer ( 800 mg ) , tablet , sildenafil 25 mg , sildenafil ( 50 mg ) , tablet , silodosin ( 4 mg ) , tablet or capsule , silodosin ( 8 mg ) , tablet or capsule , sitagliptin 50 mg+metformin 500 mg , sitagliptin ( 100 mg ) , tablet , sitagliptin ( 50 mg ) , tablet , sodium bicarbonate 500 mg , sodium valproate ( 200mg ) , tablet , sodium valproate ( 300mg ) , tablet , sodium valproate ( 500mg ) , tablet , solifenacin succinate 5 mg , sorafenib ( 200mg ) , tablet , spironolactone 50mg + frusemide 20mg ( tablet ) , tablet , spironolactone ( 100mg ) , tablet , spironolactone ( 25mg ) , tablet , sulfamethoxazole and trimethoprim ( 100mg + 20mg ) , tablet , sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet , sulfasalazine 500 mg tablet , sulphamethoxazole 800mg + trimethoprim 160mg , tadalafil tablets ip 10 mg , tadalafil tablets ip 20 mg , tamoxifen ( 10 mg ) , tablet , tamoxifen ( 20 mg ) , tablet , tamsulosin + dutasteride 0.4 mg + 0.5 mg, tablet , tamsulosin ( 0.4mg ) , tablet , tapentadol 50 mg tablet , telmisartan 40 mg+amlodipine 5 mg , telmisartan 80 mg+amlodipine 5 mg , telmisartan 80 mg+hydrochlorothiazide 12.5 mg , telmisartan ( 40 mg ) , tablet , telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet , teneligliptin 20 mg , tenofovir disoproxil fumarate 300 mg , terbutaline sulphate 2.5 mg tablet , tetrabenazine 12.5mg tablet , tetrabenazine 20 mg tablet , tetrabenazine 25mg tablet , thiamine hydrochloride 200 mg tablet , thyroxine sodium tab 100 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 12.5 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 125 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 137 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 150 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 25 mcg ( 100 per bottle ) , tablet , thyroxine sodium tab 50 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 62.5 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 75 mcg ( 100 tab bottle ) , tablet , thyroxine sodium tab 88 mcg ( 100 tab bottle ) , tablet , tianeptine sodium tablets 12.5 mg , tofacitinib 5mg tablet , tofacitinib extended release 11mg tablet , tolperisone hydrochloride 150 mg tablets , tolvaptan 15 mg , topiramate 100 mg , tablet , topiramate 25 mg , tablet , topiramate 50 mg , tablet , torsemide 10 mg+spironolactone 50 mg , torsemide ( 10mg ) , tablet , tramadol hydrochloride 37.5 mg / acetaminophen 325 mg tablets , tramadol ( 100mg ) , tablet , tramadol ( 50mg ) , tablet , tranexamic acid ( 500 mg tab ) , tablet , trifluoperazine tablets ip5 mg , trihexyphenidyl ( 2mg ) , tablet , trypsin 48 mg+bromelain 90mg+rutoside trihydrate 100mg tablet , ulipristal acetate 5 mg , ursodeoxy cholic acid 300 mg tablet , valganciclovir usp 450 mg tablet , valganciclovir usp 500 mg tablet , valganciclovir usp 900 mg tablet , valsartan 40 mg , venlafaxine er / pr ( 37.5 mg ) , tablet or capsule , venlafaxine hydrochloride extended release 150 mg capsule , venlafaxine hydrochloride extended release 75 mg capsule , venlafaxine ( 75 mg ) , capsule , verapamil hydrochloride prolonged release 120 mg , verapamil ( 40 mg ) , tablet , vilazodone hydrochloride tablets 20 mg , vilazodone hydrochloride tablets 40 mg , vildagliptin + metformin ( 50mg + 500mg ) , tablet , vildagliptin 100 mg tablet , vildagliptin 80mg , vildagliptin tab ( 50 mg ) , tablet , vitamin b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet , vitamin b1 ( thiamine 100 mg ) , tablet , vitamin b1 ( thiamine 75 mg ) , tablet , voglibose ( 0.2 mg ) , tablet , voglibose ( 0.3 mg ) , tablet , voriconazole ( 200mg ) , tablet , voriconazole ( 100mg ) , tablet , voriconazole ( 50mg ) , tablet , vortioxetine hydrobromide tablets 10 mg , vortioxetine hydrobromide tablets 20 mg , vortioxetine hydrobromide tablets 5 mg , warfarin sodium ( 5 mg ) , tablet , zinc sulphate dispersible ( 20mg ) , tablet , zolpidem 10 mg, tablet , zonisamide 100 mg tablets , zonisamide 50 mg tablets...

Medical Education Department - Madhya Pradesh

39419109 bids are invited for acetone , xylene , liquor ammonia , egg albumin , dpx , carbal fuschine powder , h2so4 , crystal violet , sefranin , phenol , ethanol , reagent bottle 250 ml , reagent bottle 125 ml , sodium hydroxide , test tube 15150mm , test tube 15125mm , lodine powder , alpha , ammonium hydroxide , ammonium sulphate , benzene , diacetylmonoxime , ether , nitric acid , oleic acid , palemitic acid , peptone powder , phosphoric acid , miro pipette variable volume , bilirubin total plus , calcuium , lipase xl , ck mb , ck nac , gamma gt , microprotein with cal , micro albumin with cal , micro albumin control , magnesium , xl hba1c with cali set , hba1c cali set , hba1c con l , hba1c con h , erba norm , erba path , xl multical , erba autowash system pack , 4 channel ise cleaning solution 5421 , 4 channel ise , xl 1000 sample cups , pm kit 40 lph incl , pm kit 40 lph incl , 10 ltr super charged resin , ro membrane , primary antibody , primary anitbody , env flex minikit high ph , polylysine coated slide , buffer solution , pipette , ihc marking pen total quantity : 811...

Medical Education Department - Madhya Pradesh

39153546 bids are invited for 1 acetone 2 paraffin wax 3 xylene cover slip (size22x50mm) 4 200gm 5 eosin (liquid) 6 hematoxylin 7 liquor ammonia 8 egg albumin 9 dpx 10 diamond pencil 11 block holder 12 distilled water filter paper (whattman 13 125mmx100 circles) forceps (small, medium, 14 large) each of five 15 grossing knife 16 stainless chopper surgical scissors (small, 17 medium & large) lmoulds (small, medium) 18 brass 19 antisera a,b,d 20 test tubes 21 test tube holder ...

Indian Council Of Forestry Research And Education - Madhya Pradesh

39053621 bids are invited for chemicals srl make sodium carbonate , sodium potassium tartrate , d sorbitol powder , folin phenol regent , dimethyle sulphoxide , ammonia solution ar , sodium nitroprusside , acetone extra pure ar , xylene extrapure ar , glycerol anhydrous , sodium tungstate dehydrate , phosphomolybdic acid ar , carboxy methyl cellulose na salt , propylene glycol , cupric acetate monohydrate ar total quantity : 15...

Government Medical College - Madhya Pradesh

39035473 tender for re tender for chemical and reagents chemical and reagent ( microbiology and histopathology service lab ) 2 gram stain kit 125 ml ( crystal violet, iodine, acetone & safranin ) 3 carbon fuschin 500ml 4 zn staining kit 5 lugols iodine 500 ml 6 glass petri plates ( 95 100 mm ) autoclavable 7 test tubes ( 120*13 mm size ) 8 test tubes ( 140*16 mm size ) 9 test tubes rack ( 120*13 mm & 140*16 mm size ) 10 durham tube 11 glass bottle with rubber caps for blood culture ( 30ml , 50 ml ) 12 nichrome wire loopbig & small with handle 13 albert stain a & b 14 antibiotic disc ampicillin 10 ⴎg / disc 15 antibiotic disc amoxicillin 20 ⴎg / disc 16 antibiotic disc ampicillin / sulbactam 10 / 10 ⴎg / disc 17 antibiotic disc ampicillin / clavulanic acid20 ⴎg / 10 ⴎg / disc 18 antibiotic disc piperacillin 20 ⴎg / disc 19 antibiotic disc piperacillin / tazobactam 100 / 10 ⴎg / disc 20 antibiotic disc co trimoxazole 25ⴎg / disc 21 antibiotic disc vancomycin 30 mcg / disc 22 antibiotic disc linezolid 30 mcg / disc 23 antibiotic disc cefoxitin 30 mcg / disc 24 antibiotic disc erythromycin 15mcg / disc 25 antibiotic disc azithromycin 15mcg / disc 26 antibiotic disc doxycycline hydrocloride 10 mcg / disc 27 antibiotic disc minocycline 30 mcg / disc 28 antibiotic disc clindamycine 10 mcg / disc 29 antibiotic disc chloramphenicol 30 mcg / disc 30 antibiotic disc ciprofloxacin 05 mcg / disc 31 antibiotic disc ofloxacin 05 mcg / disc 32 antibiotic disc levofloxacin 05 mcg / disc 33 antibiotic disc cefixime 05 mcg / disc 34 antibiotic disc cefixime / calvulanic acid 5 / 10 mcg / disc 35 antibiotic disc ceftriaxone30mcg / disc 36 antibiotic disc ceftriaxone / sulbactam 30 / 15 mcg / disc 37 antibiotic disc cefotaxim30mcg / disc 38 antibiotic disc cefotaxim / calvulanic acid 30 / 10 mcg / disc 39 antibiotic disc ceftodoxime 10 mcg / disc 40 antibiotic disc ceftazidime 30 mcg / disc 41 antibiotic disc cefepime 30 mcg / disc 42 antibiotic disc imipenam / cilastin10 / 10 mcg / disc 43 antibiotic disc imipenam 10 mcg / disc 44 antibiotic disc imipenam + edta10 mcg / disc + 750 mcg / disc 45 antibiotic disc meropenam 46 antibiotic disc etrapenam10 mcg / disc 47 antibiotic disc nitrofurantoin 200 mcg / disc 48 antibiotic disc netillin 30 mcg / disc 49 antibiotic disc amikacin 30 mcg / disc 50 antibiotic disc gentamicin 10 mcg / disc 51 antibiotic disc gentamicin 120mcg / disc 52 antibiotic disc streptomycinhls 300mcg 53 disc bacitracin b 54 disc otochin 55 disc novoblocin 5 mcg / disc ) 56 vancomycin 57 levofloxacin 58 amoxyclav 59 sterile cotton swab 60 slide store box ( plastic ) 61 culture glass bottel with cap 62 measuring cylinder 10, 100, 500ml 63 xylene 100 ml 64 dpx 500gm 65 tuberculin syringe 66 ppd 5tu, 10 tu 67 glass slide ( 75*25 mm size ) isi mark 1.35 thickness frosted micro slide 68 coverslip 22x22 mm size ) blue star 69 coverslip ( 22x50 mm size thickness no. 1, 0.13 0.16 blue star ) 70 discarding bag 71 distill water ( 1 litre ) 72 anaerobic gas pack for anaerobic culture 73 borosil conical flask ( 100, 250, 500, 1000 ml ) 74 forceps big & small 75 paraffin oil ( 1 litre ) 76 dispensing dropper 3 ml sterlle ( 1 pack of 1000 ) 77 normal saline 78 cotton bundle 79 testtube brush 80 peptone water ( 500 gm ) 81 mac conkey agar ( 500 gm ) 82 cled agar ( 500 gm ) 83 nutrient agar ( 500 gm ) 84 blood agar base ( 500 gm ) 85 muller hinton agar ( 500 gm ) 86 t.c.b.s. agar ( 100 gm ) 87 oxidase discs 88 mr vp medium ( glucose phosphate broth ) 500 gm 89 triple sugar iron agar medium500 gm 90 simmons citrate agar 500 gm 91 urea agar base ( christensen ) 500 gm 92 kovacs indole reagent 100 ml 93 methyl red indicator100 ml 94 barritt reagent a ( for vp test ) 100 ml 95 barritt reagent b ( for vp test ) 100 ml 96 autoclave tape 97 bacillus thermophillus spore ( steam sterilization monitor strip ) 98 anaerobic jar 99 plastic tray ( 37*28*7 cm ) 100 disposable jar 101 hand wash 1 ltr 102 room freshner 103 sterile swab stick wooden stick, individually packed of size150* 2.50 mm, 500pcs / pack 104 sterile sample collection container 30ml 105 spatula 106 koh 40 % ( 5 litre ) 107 sabouraud dextrose agar base, emmons modified ( 500 gms ) 108 sabouraud dextrose agar base with chloramphenicol ( 500 gms ) 109 potato dextrose agar ( 500 gms ) 110 corn meal agar ( 500 gms ) 111 potasium tellurite agar 112 selenite f broth 113 tween 80 114 deoxycholate citrate agar ( dca ) 115 salmonella shigella agar 116 lactophenol cotton blue stain 117 india ink stain 100ml 118 stool container 119 slide box ( 1 packet ) 120 filter paper 121 robertson cooked minced meat media 122 1% glucose reagent 123 1% lactosereagent 124 1% menltolreagent 125 1% sucrosereagent 126 urease reagent 127 clay 128 oxidase reagent 129 wilson & blair medium 130 loffiers serum slope 131 test tube ( 10ml, 20 ml, 30 ml ) 132 glass marker pen 133 beaker ( 100ml, 250 ml & 500ml, 1000ml ) 134 5% o napthon 135 pottassium hydro.pell. ( 500gm ) 136 syringe ( 1 10 ml ) 137 falcon tube rack big 138 falcon tube 139 methynol ( 1 litre ) 140 phenol ( 1 litre ) 141 paraffin roll 142 spirit 143 petridish plate 90 ml ( glass ) autoclavable 144 inoculating, loop holder 145 inoculating wire 146 test tube holder 147 autoclave drum 148 spray bottle 149 nutrient broth 150 brain heart infusion ( bhi ) broth 151 bromocresol purple lactose agar 152 sillons citrate agar ( 500 gms ) 153 sxt ( trimethiprin plus slufamethxazole ) text 154 mopility agar test 155 nitrate broth 156 hydrogen peroxide 500 ml 157 salt tolerance text 158 congo red capsule stain 159 wirtzs endospore stain 160 tryptona soya broth 161 varivol ii micropipette ( 10 ul ) 162 varivol ii micropipette ( 200ul ) 163 varivol ii micropipette ( 1000ul ) 164 nitric acid 10% 500 ml 165 glacial actic acid 500 ml 166 hemotoxylin 5 gms 167 mercuric oxide100 gms 168 paraffin wax ( melting point 58 62 c ) per 2kg 169 surgical blade long cutting ) 170 blade holder scalpel ( 6*4 inch ) 171 blade holder scalpel ( 3*2 inch ) 172 base mold for embedding ring ( 22*22* 6 mm ) 173 base mold for embedding ring ( 32*25* 6 mm ) 174 base mold for embedding ring ( 38*25* 6 mm ) 175 steel tissue cassettes ( big ) 176 steel tissue cassettes ( small ) 177 glass jar with lid 178 staining basket ( stainless steel ) ( 25 slides ) 179 carriers ( slide ) rack50 slides 180 carriers ( slide ) rack 20 slides 181 l mold with plate ( brass ) small 16*16*12 mm 182 l mold with plate ( brass ) medium 22*22*12 mm 183 l mold with plate ( brass ) big 32*25*12 mm 184 eosin powder 185 aluminum ammonia sulphate 186 hcl 187 diamond pencil 188 isopropyl alcohol 189 formlin solution 190 stalnless steel instrument tray 12*11 191 rapid pap stain kit 192 rapid giemsastain kit 193 disposableneedle 23g, 24 g 194 disposable syring with needle 10 ml & 5 ml 195 aluminum slide carring tray horizontal for 20 slide 196 fnac plunger 197 reticulocyte stain 100 ml 198 glycerin ( 1 lit ) 199 pop ( plaster of paris 01 kg pkt ) ( 01 kg ) 200 phenol crystal ( 500 gm ) 201 thymolcrystal ( 500 gm ) 202 plane slide ( 2.5*7.5 cm ) ( pkt ) 203 wide mouth bottle ( dimensions 10.5*5.5*5.5 ) 204 slide holder ( 1 pcs ) 205 cover slip ( 2*2 cm ) 206 cuplin jar ( 1 pcs ) 207 anti d antisera10 ml 208 anti a antisera10 ml 209 anti b antisera 10 ml 210 sulphosalicylic acid ( 500 ml ) 211 capillary tube 90 mm 212 n / 10 hci ( 500 ml ) 213 rbc diluting fluid ( 500 ml ) 214 wbc diluting fluid ( 500 ml ) 215 leishman stain ( 500 ml ) 216 field a stain ( 500 ml ) 217 field b stain ( 500 ml ) 218 benedicts reagent ( 10 lit ) 219 sodium nitroprusside ( 100 gm ) 220 fouchets reagents ( 150 ml ) 221 sulphur powder ( 500gm ) 222 immersion oil ( 25 ml ) 223 liqour ammonia 25 % ( 500 ml ) 224 acetone99 % ( 500 ml ) 225 disposable needle 226 pas stain 227 buffer solution ( 500 ml ) 228 pricking lancet disposable 229 glass capillary tubes 230 wintrobe&westergrentubes 231 ecg roll 232 ecg jelly 233 savlon solution ( 500ml ) 234 edta solution 235 double oxalate solution 236 1.3% sodium citrate solution 237 graph paper sheets 238 rectified spirit ( alcohol ) ( 500ml ) 239 platelet diluting fluid ( rees ecker ) 240 sodium glycocholate500gm 241 ammonia solution 500ml 242 acetic acid 500ml 243 jack been meal 500gm 244 silver nitrate 500ml 245 picric acid 500ml 246 magnesium sulphate 500gm 247 calcium chloride 500gm 248 ammonium sulphate 500gm 249 creatinine powder 25gm 250 bovine albumin powder 25gm 251 pure phosphate powder 500gm 252 glass reagent bottle ( 1000ml ) 253 taurocholate 500gm 254 potassium oxalate 500gm 255 barrium chloride 500gm 256 urea powder 500gm 257 glucose powder 500gm 258 glass dropper with marking ( glass 10ml ) 259 sodium hydroxide 500gm 260 potassium peroxide 500 ml 261 phenolphthalein 100 ml 262 sodium chloride 500 gm 263 potassium chloride 500 gm 264 potassium iodide 500 gm 265 potassium bromide 500 gm 266 zinc oxide 500 gm 267 silver nitrate 500 gm 268 acetic anhydride 500ml 269 starch solution500ml 270 sodium acetate 500 gm 271 potassium dichromate 500 gm 272 silica 25 ml 273 sodium nitrate 500 gm 274 sodium iodide 500 gm 275 zinc sulphate 500 gm 276 borax 500 gm 277 calcium oxide 500 gm 278 lab burners 279 rubber tubing 280 acetatebuffer 281 saturated glucose solution 282 pyridine solution 283 10% naoh ( sodium hydroxide solution ) 284 cobalt ( ii ) thiocynate 285 cobalt ( ii ) acetate dihydrate 286 isopropylamine 287 acetaldehyde 288 vanillin 289 chloroform 290 ammonium vanadate 291 concentrated sulfuric acid 292 40% formaldehyde 293 para dimethylaminobenzaldehyde ( p dmab ) 294 anhydrous ferric chloride 295 ferric chloride hexahydrate 296 sodium molybate 297 molybdic acid 298 selenious acid 299 copper ( ii ) sulfate penthahydrate 300 sodium nitroprusside 301 sodium carbonate 302 hiv rapid card 303 malaria raid card 304 syphalis card ( igg, ibm ) 305 vdrl ( rrr ) strip 306 hbsag rapid card 307 pregnency test card 308 tissue paper roll 309 aluminium foil 310 boric acid ( 500g ) 311 calcium carbonate ( 500g ) 312 iodine solution500ml 313 uric acid powder100g 314 urea kit ( berthlot method ) 315 er anitibody rtu ( ready to use ) 316 pr anitibodyrtu ( ready to use ) 317 ki 67 anitibodyrtu ( ready to use ) 318 ihc ditection system ( hrp kit = secondary antibodies ) 319 pep pen 320 ihc slides ( poly l lysine coated slides ) 321 ihc washing buffer 20x ( pbs ph 7.4 to 7.6 ) 322 antigen retrival solution 323 blooting papers 324 sodium dihydrogen phosphate 325 disodium dihydrogenortho phosphate 326 tri sodium citrite 327 cirtric acide 328 triss buffer 329 afb stain 330 sda agar base powder media 331 disposable autoclavable bagsbig size 332 paper tape 333 bile esculin agar powder media 334 nitrile gloves ( size 6.5, 7, 7.5 ) 335 dropping bottle 336 droppers 337 alcohol absolute 338 sprit 339 uric acid kit 340 creatinine kit 341 cholesterol kit 342 total protein kit 343 albumin kit 344 bromine water ampule ( 10ml ) 345 micropipette stand 346 micropipette ( 10 100ul ) 347 micropipette ( 100 200ul ) 348 micropipette ( 1000ul ) 349 glass pipette 2, 5, 10ml 350 volumetric flask 100, 500ml 351 amber glass bottle 250, 500, 1000ml 352 burette 25ml 353 idometric flask with stopper250ml 354 white porcelin dish 355 zipper bag 6*8 356 cons. h2so4 500ml 357 double distill water500ml / 10 liter 358 rapid h&e stain kit 359 ethanol 95% 500ml 360 aspen 68 ds diluent ** 361 aspen 68 ld lysa ** 362 aspen 68 fd dye ** 363 aspen 68 lb lyse ** 364 aspen 68 lh lyse ** 365 sta neo ptnimal ( 01163 ) ** 366 sta desorb u ( 00975 ) ** 367 sta coag. control n+p ( 00679 ) ** 368 sta cleaner solution ( 00973 ) ** 369 sta owren koller ( 00360 ) ** 370 alfa lyser ** 371 alfa diluent ** 372 eosin 2% ready to use 373 hemotoxylinready to use 374 ceftaroline 30 mcg disc 375 aztreonam30 mcg disc 376 doripenam30 mcg disc 377 fosfomysin10 mcg disc 378 ticarcillin clavulanate75 / 10 mcg 379 cefpodoxime disc 380 etrapenem 381 meropenem disc 382 novobiocin 383 optochin 384 biological indicater tape 385 broom stick 386 plate wash scrub 387 nichrom loop handle 388 para film sealing film100mm width, 58 met 389 cedar wood oil125ml 390 gram iodine100ml 391 methyl blue for z n125ml 392 paper adhesive plaster microporous surgical tape 1 inche*9 met 393 honeycomb towel bleach54 inch*27 inch 394 sanitizing agen 50ml 395 carbolic acid phenol500ml 396 disposable sharp collection containers5 lit 397 absorbent bench underpads absorbancy340ml 398 cary blair medium base100gm...

Department of Health Research - Madhya Pradesh

38329946 bids are invited for laboratory chemicals glacial acetic acid 2.5l atc , methanol 25l normal grade , hcl 1l normal , h2so4 500ml normal , sodium phosphate dibasic 1kg , sodium phosphate monobasic anhydrous 1kg , tris base 2kg , pbs tablets 200 x 100ml , kcl 500gm , nacl 5kg , sds 5kg , activated charcoal powder 2kg , edta 2kg , ammonium persulfate mb grade 100gm , temed mb grade 100ml , sarcosyl mb grade 25gm , paraformaldehyde pfa , silver nitrate mb grade 25gm , triton x 100 mb grade 500 ml , sodium hydroxide pellets mb grade 500 gm , sodium carbonate mb grade 500gm , sodium bicarbonate mb grade 500gm , glycerol 5 l , tween 20 mb grade 100ml , luria broth 500gm , agar agar 500gm , agarose low melting mb grade 100gm , skimmed milk powder mb grade 500gm , magnesium chloride anhydrous mb grade 100gm , 2 propanol ar grade 25l , propidium iodide mb grade 25mg , glycine mb grade 5kg , sucrose mb grade 500gm , coomassie brilliant blue r 250 100gm , coomassie brilliant blue g 250 25gm , imidazole mb grade 100gm , 2 mercapto ethanol mb grade 100ml , ponceau s stain mb grade 250ml , butanol mb grade 500ml , calcium chloride dihydrate 500gm 1665 , xylene cyanol mb grade 5gm , urea mb grade 500gm , ortho phosphoric acid 500 gm , oxalic acid dihydrate hi ar 500gm total quantity : 44...

Bhopal Gas Tragedy Relief and Rehabilitation - Madhya Pradesh

38274231 tender of pathology items tender document for pathology items , biochemisry &serology kits , a.s.o.tire , alkaline phosphatase , amylase kit , anti sera a , anti sera b , anti sera d , bloodglucose , blood urea berthlot method , blood urea kinetic method , blood urea urease method , brain thromboplastin (5ml bottle) , chickengunia igm , cholesterol kit , cpkmb kit , coombs sera , control serum 1.20x 5 ml , control serum 2.20x 5 ml , crp kit , csf protein kit , dengu (combi pack) , g6pd kit , glycocylated haemoglobin (hba 1c) kit , hbs ag test card , hbs ag test kit , hcv test antigen card , hdl cholestrol (direct) , hiv test antigen card , l.d.h.kit , malaria antigen card , malaria antigen strip kit , occult blood kit , phosphorus , prothrombin time kit , r. a. factor test kit , serum albumin kit , serum bilirubin kit , serum calcium kit , serum creatinine kit , serum lipase kit , serum triglyceride kit , serum uric acid kit , sgotkit , sgpt kit , t 3 kit , t 4 kit , total protein kit , troponin 1 card , tsh kit , vdrl. card (rapid plasma reagin test) , widal test kit slide method , widal test kit test tube method , reagents& miscellaneous , barium chloride 10%solution , carbol fuschin , crystal violet solution , cynamethaemoglobin solution , deionised water , dpx mountanent , e.d.t.a. solution , field staina , field stain b , flow clean solution , fouchet’s reagent , glassware cleaning solution , glacial acetic acid , isopropyl alcohol , leishaman’s stain , methylene blue , methanol , multi strip urine , n / 10 hcl , oil imerssion , pregnancy test strip , r.b.c. diluting fluid , urine strip protein & sugar , urine strip sugar & acetone , w.b.c. diluting solution , xylene , glassware , beaker (100 ml) , capillary tubes , centrifuge machine tubes (plastic) , cover slip withsize:18x18mm (+/ 1.00mm), thikness 0.13 to 0.17mm (pkt of 50 pieces) , esr stand wintrobe , esr tube wintrobe , falcon tube (conical bottom) (50ml each plastic containers with air tight screw cap printed graduation) , filter paper , glass marking pencil , glass slide 75mm x 25mm x 1.1mm , glass test tube 12 x 100 (medium size) heavy quality 100/pkt(no.) , k3 e.d.t.a. tube , micro pipette 10 ml , micro pipette 5 50 micron , micro pipette 50 100 micron , micro pipette 100 1000 micron , micro pipette tips 50 100 ?l , micro pipette tips 200 1000 ?l , micro pipette tips 5 300ul , plain vial with screw cap (12x75) , polypaper labels (sticker) , sputum container (100 per box) , sterile polyvial , swab stick with tube sterile (70 80 mm length 10 15 mm diameter), unit 1 (100/pkt) , test tube basket , test tube medium , test tube small 12 x 75 mm , test tube stand 24 hole aluminiummedium , test tube washing brush big , test tube washing brush medium , test tube washing brush small , thermal paper for r. a. 50 analyzer (size 78 ml) , tissuerole paper , torniquet (arm belt) , urine culture container sterile plasticsize 50mm , urine container size of the container shall be 30ml disposable (50 per pkt) , vaccutainer , wash bottle , pathology reagentsfor fully automaticbiochemistryanalyzer , alk phosphate (4x12ml / 4x12ml) , alt (4x50ml / 4x25ml) , amylase (4x40ml / 4x10ml) , ast(4x25ml / 4x25ml) , calcium (4x27ml / 4x27ml) , cholesterol(4x22.5ml) , ckmb (uv) (2x25ml / 2x4ml) , ckmb calibrator (6x1ml) , creatinine (4x51ml / 4x51ml) , direct billirubin (4x6ml / 4x6ml) , glucose (4x25ml / 4x12.5ml) , hdl cholesterol (4x27ml / 4x9ml) , hdl cholestrol calibrator (2x3ml) , haemoglobin denaturant , hba 1c kit , lipase (4x10ml / 4x3.3ml) , total billirubin (4x15ml / 4x15ml) , triglyceride(4x20ml / 4x5ml) , urea (4x25ml / 4x25ml) , uric acid(4x12ml / 4x5ml) , wash solution(6x2 ltr) , pathology other itemsfor fully automaticbiochemistryanalyzer , hba 1c calibrator , mandoline line for probe cleaning , mixing rods ( 3pcs./set) l shape , r. probe , rack id level (1 20) , s. probe , sample cup glass 100pcs. , sensa core st 200 aqua reagent pack (cal a :450 ml, cal b : 200 ml) , system calibrator...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

38007429 supply of laboratory chemicals and similary hygiene items at bundelkhand sahakari dugdh sangh maryadit, sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

37999746 tender for supply of laboratory chemicals, glassware, sanitary & hygiene items ethanol (absolute alcohol) iso amyl alcohol for milk testing l.r. acetone l.r. acetic acid glacial l.r. ammonium ferrous sulphate l.r. ammonia solution about 25% l.r. ammonium molybdate (extra pure) calcium chloride (fused) l.r. chloroform l.r. citric acid l.r. cupric sulphate cupric acetate (monohydrate) diphenylamine p dimethylaminobenzaldehyde l.r. erichrome black t metal (pm) indicator ethylenediamine tetra acetic acid l.r. ferroin indicator solution formaldehyde solution (39% 41%) l.r. glycerol l.r. hydrochloric acid (about 40%) l.r. iodine crystal lactic acid min. 88% manganese sulphate (monohydrate) butylated hydroxy anisole (b.h.a.) mercuric sulphate mercuric chloride methylene blue tablet for milk testing nesslers reagent oxalic acid l.r. petroleum ether 400c 600c l.r. phenolphthalein indicator powder phenolphthalein solution indicator potassium carbonate potassium dihydrogen orthophosphate potassium dichromate l.r. potassium permanganate (kmno4) potassium oxalate monohydrate l.r. potassium iodide l.r. potassium hydrogen phthalate resorcinol crystal l.r. sodium azide l.r. sodium carbonate l.r. sodium hydrogen carbonate l.r. sodium hydroxide pellets l.r. sodium hydroxide n/10 ampule silver nitrate l.r. silver sulphate l.r. starch soluble sodium sulphate anhydrous sodium thiosulphate pentahydrate tartaric acid l.r. tri sodium citrate l.r. tri sodium citrate zinc acetate (dihydrate) citric acid (food grade commercial) p nitrophenyl disodium orthophosphate rosalic acid xylene fur furaldehyde whats man filter paper (4) no. whats man filter paper (42) no. membrane nylon pore size 0.45 micron dia 47 mm. potassium sorbate sulphuric acid about 98% l.r. violet red bile agar potato dextrose agar plate count agar ringer salt solution powder m7hr fc agar buffer tablets ph 4.0 buffer tablets ph 7.0 buffer tablets ph 10.0 buffer strips ph 2.0 – 10.5 wide range distilled water potassium hydroxide barium hydroxide solution (0.1n) furfural solution 2% total hardness kit (range 5 10 & 25 500ppm) ammonium chloride edta disodium salt (dihydrate) test tube with rim 15 x 150 mm. tube culture 16 x 125 mm. tube culture 16 x 160 mm. beaker low form graduated with spout 50 ml beaker low form graduated with spout 100 ml beaker low form graduated with spout 150 ml beaker low form graduated with spout 250 ml beaker low form graduated with spout 500 ml beaker low form graduated with spout 1000 ml bottle, plain with screw cap and liner 125 ml conical flask 100 ml flask erlenmeyer narrow mouth 150 ml flask erlenmeyer narrow mouth 250 ml flask erlenmeyer narrow mouth 500 ml flask erlenmeyer narrow mouth 1000 ml petri dish 100 x 15 mm pipette 1.1 ml pipette 2.2 ml pipette 5 ml graduated 1/20 pipette 10 ml graduated 1/10 milk pipette 10.75 ml measuring cylinder 10 ml measuring cylinder 50 ml measuring cylinder 100 ml measuring cylinder 250 ml measuring cylinder 500 ml measuring cylinder 1000 ml measuring cylinder 100 ml with interchangeable stopper graduated volumetric flask 50 ml volumetric flask 100 ml volumetric flask 250 ml volumetric flask 500 ml separating funnel 500 ml r.m. valve apparatus 300 ml complete set for fat testing flask volumetric sugar estimation 100/110 ml funnel glass 12 cm funnel glass 6 cm test tube stand plastic for 12 test tube test tube stand plastic for 24 test tube thermometer alcohol ( 100c to 1100c) in 10c graduation thermometer alcohol ( 100c to 500c) in 0.50c graduation sprit lamp (aluminum) cotton bundle culture tube (with rim 10 ml) still head (rm) condenser (rm) glass rod burette stand polansky flask 310ml (rm)...

Medical College - Madhya Pradesh

37879902 tender for supply of hospital required items 1 supply 2 tourniquet 3 disposable syringe5 ml 4 disposable syringe 2 ml 5 disposable syringe 50 ml 6 edta tube 7 plain tube 8 slide box 9 sahli’s hemoglobinometer 10 hb pipette 11 hb tube 12 methanol spray 13 stain a field 14 stain b field 15 tissue paper 16 couplingjar 17 dropping bottles 18 needle box 23 gauge 19 n / 10 hcl 20 distilled water ( 5lit ) 21 glucose strip on call ( 50 strip box ) 22 on call glucometre 23 urine strip ( 2 panl ) 24 cover slip 25 test tube ( glass ) 26 urine pregnancy card 27 esr tube 28 blood group & rh kit 29 ra factor kit 30 widal test 31 cr protein 32 sodium flouride tube 33 torsons micro tips 50 ul 34 torsons micro tips 500 ul 35 stop watch ( min & sec calculate ) 36 oil immersion 37 hbs ag 38 vprl 39 hiv 40 urine container 41 lancet ( 100 pcs ) 42 cap surgical 43 mask disposal ( 100 pcs ) 44 micropipette 5 50 micro lit. 45 micropipette 500 micro lit.fixed 46 micro tips small 47 micro tips large 48 glucose kit 500 ml ( ready to use ) 49 benedects reageant 50 fouchestreageant 500ml 51 4% sodium hypochlorite ( 5 lit ) 52 bleeching powder 53 formalin 1 lit. 54 chloroform 500ml 55 alcohol500ml 56 sulphuricacid500ml 57 hydrochloric acid500ml 58 sodium potassium hydroxide 500ml 59 benedict solution 500ml 60 sodium nitrate 500 gm 61 potassium nitrate 500 gm 62 nitric acid 500 gm 500 gm 63 potassium iodide 500 ml 64 iodine 100 ml 65 xylene 500 ml 66 normal saline ( ns ) 100 ml 67 glass jar 68 x ray film 12x15 69 x ray film 10x12 70 x ray film 8x12 71 dovlaper 22.5 lt 72 fixer 22.5 lt 73 casid 12x15 74 casid 6x8 75 water heater 76 r marker 77 l marker 78 ecg paper roll 79 ucg paper roll a4 size 80 ecg gel 500 ml 81 usg gel 500 ml 82 ultrasound gel 5 lit 83 disposable surgical gloves 7 no 84 disposable surgical gloves 6 1 / 2 no 85 examination gloves latex ( rubber ) 7 no 86 examination gloves ( polyethen ) 87 mackintosh sheet 88 plastic sheet ( flex ) 6x4 ft 89 cotton 500 gm 90 bandage 2inch 91 bandage 3 inch 92 bandage 4 inch 93 gauge than 94 micropore ( paper ) 1 inch 95 micropore ( paper ) 2 inch 96 micropore ( paper ) 3 inch 97 leucoplast 3 inch ( cloth ) 98 savlon 1 lit 99 betadine 1 lit 100 glycerine 400 ml 101 foley’s catheter 102 hydrogen peroxide400 ml 103 surgical sprit500 ml 104 hijama cup size 2 105 hijama cup size 3 106 hijama cup size 4 107 hijama cup size 5 108 hijama cup size 6 109 hijama pump 110 surgical blade 7 no 111 surgical blade 11 no 112 surgical blade 10 no 113 crap bandage 3 114 crap bandage 4 115 leechfor leech therapy 116 scalp vein 23 no 117 scalp vein 22 no 118 scalp vein 20 no 119 rechargeable cell clock 120 rechargeable cell pencil 121 cell charger for pencil cell 122 cell charger for clock cell 123 examination torch 124 bio medical pedal waste dustbin 12 ltr ( yellow + blue + black + red +white ) 125 bio medical waste bag ( different color ) 126 disposable plastic appron 127 disposablecap / hair cover 128 disposablemask ( 100 piece ) 129 kharal sange marmar ( small ) 130 kharal sange marmar ( lagre ) 131 kharal sange sumaq 132 brass seives 133 porcelain jars 134 brass container ( 5 kg capacity ) 135 copper container ( 5 kg capacity ) 136 plastic container ( 50 kg capacity ) 137 plastic bottle with cap 100 ml 138 brown envelop 100 gsm ( 8x5.5 inch ) 139 brown envelop 100 gsm ( 5x3 inch ) 140 brown envelop 100 gsm ( 4x3.5 inch ) ...

Defence Research And Development Organisation - Madhya Pradesh

37532560 bids are invited for ammonium persulfate , lysozyme , triton x 100 , urea , ammonium bicarbonate , bca protein assay kit , formic acid , tween 20 , 2 b mercaptoethanol , edta , acrylamide suitable for electrophoresis , bis acrylamide , trizma base , glycine , dithiothretol , iodoacetamide , glycerol , nacl , isopropanol , agarose for molecular biology , sodium dodecyl sulphate , 1x pbs powder , potassium chloride , sodium phosphate , sodium phosphate monobasic reagent plus , potassium phosphate, monobasic , bsa 10 gm , sodium bicarbonate , tween 80 , temed , etbr , bromophenol blue , coomassie blue dye r 250 , ponceau suitable for electrophoresis , imidazole , cyrstal violet , iptg , guanidine hydrochloride , nickel sulphate , peg 8000 1g , mgso4 , mncl2 , ca no3 2 , xylene cyanol , cacl2 molecular grade , pmsf , tmb total quantity : 324...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

37451413 supply of laboratory chemical and glasswares annual rate contract basis april 2023 supply of laboratory chemical and glasswares annual rate contract basis april 2023 ref. no.25 , requirment of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) , iso amyl alcohol for milk testing l.r. , acetonel.r. , acetic acid glaciall.r. , ammonium ferrous sulphatel.r. , ammonia solution about 25% l.r. , ammonium molybdate ( extra pure ) , calcium chloride ( fused ) l.r. , chloroforml.r. , citric acidl.r. , cupric sulphate , cupric acetate ( monohydrate ) , diphenylamine , p dimethylaminobenzaldehyde l.r. , erichrome black t metal ( pm ) indicator , ethylenediaminetetra acetic acid l.r. , ferroin indicator solution , formaldehyde solution ( 39% 41% ) l.r. , glycerol l.r. , hydrochloric acid ( about 40% ) l.r. , iodine crystal , lactic acid min. 88% , manganese sulphate ( monohydrate ) , butylated hydroxy anisole ( b.h.a. ) , mercuric sulphate , mercuric chloride , methylene blue tablet for milk testing , nesslers reagent , oxalic acid l.r. , petroleum ether 400c 600cl.r. , phenolphthalein indicator powder , phenolphthaleinsolution indicator , potassium carbonate , potassium dihydrogen orthophasphate , potassium dichromate l.r. , potassium permagnete ( kmno4 ) , potassium oxalate monohydratel.r. , potassium iodidel.r. , potassium hydrogen phthalate , resorcinol crystal l.r. , sodium azide l.r. , sodium carbonate l.r. , sodium hydrogen carbonate l.r. , sodium hydroxide pellets l.r. , sodium hydroxide n / 10 ampule , silver nitrate l.r. , silver sulphate l.r. , starch soluble , sodium sulphate anhydrous , sodium thiosulphate pentahydrate , tartaric acid l.r. , tri sodium citrate l.r. , tri sodium citrate , zinc acetate ( dihydrate ) , citric acid ( food grade commercial ) , p nitrophenyl disodium orthophosphate , p nitrophenyl disodium orthophosphate , rosalic acid , xylene , furfuraldehyde , whats man filter paper ( 4 ) no. , whats man filter paper ( 42 ) no. , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sorbate , sulphuric acid about 98% l.r. , voilet red bileagar , potato dextrose agar , plate count agar , ringer salt solution powder , m7hr fc agar , buffer tablets ph 4.0 , buffer tablets ph 7.0 , buffer tablets ph 10.0 , buffer stripsph 2.0 – 10.5 wide range , requirment of laboratory glasswares ( for plant & mccs ) , test tube with rim 15 x 150 mm. , tube culture 16 x 125 mm. , tube culture 16 x 160 mm. , beaker low form graduated with spout 50 ml , beaker low form graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low form graduated with spout 500 ml , beaker low form graduated with spout 1000 ml , bottle, plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petridish 100 x 15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchamgeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , seperating funnel 500 ml , r.m. valve appratus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 100c to 1100c ) in 10c graduation , thermometer alcohol ( 100c to 500c ) in 0.50c graduation , sprit lamp ( alluminium ) , cotton bundle , culture tube ( with rim 10 ml ) ...

Government Medical College - Madhya Pradesh

37436544 supply for central lab consumable and other items supply for central lab consumable and other items in gmc ratlam , three part automated cell counter model : swelab alfa plus basic close system , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , automatic coagulation analyzer model : sta compact max 3 close system , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , sodium metabisulphate , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , alpha napthol , copper acetate , glucose (dextrose) 1 , fructose , iodine cristal , resorcinol , sprit lamp (steel) , sprit 100% (flammable) , sodium hydroxide , starch soluble , sodium nitrite , lead acetate , sodium carbonate , trichloroacetic acid , ammonium malybdate , sulphar powder , ammonia solution , egg albumin powder , fouchets reagent , organic solvent (sprit) , funnel poly lab , mercuric sulphate , copper sulphate , ninhydrin ar , bile salt , kits , reticulocyte count kit , field stain kit , giemsa stain kit , pt/inr kit , hbsag elisa kit , hbsag rapid cards , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , casset , glass dish staining jar , hand wash , bubbler (plastic screw) , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , pasture pipette , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , measuring cylinder 100 ml , measuring cylinder 5 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey broth single strength (for water testing) , maltose , mannitol , pyr agar , robertson cooked meat medium base , sodium deoxycholate , sucrose , tcbs agar , antibiotic disc , cefepime 50ug , cefoperazone / sulbactum , cefotaxime+clavulanate , cefpodoxime , ceftazidime+clavulanate , ceftriaxone sulbactum 30/15ug , colistin (0.016 256 mcg/ml) , cotrimoxazole(25 ?g) , doripenem(10 ?g) , ertapenem(10 ?g) , imipenem 10 mcg , meropenam 10ug , novobiocin(5 ?g) , quinopristin dalfopristin(15 ?g) , teicoplanin , ticarcillin clavulanate(75/10 ?g) , vancomycin (0.016 256 mcg/ml) , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crystal violet powder , formaldehyde solution , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , methyl blue for (z n) , methyl alcohol , nitrate reagent a , nitrate reagent b , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , xylene , zinc dust , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable reusable transparent bags , bcg(1 ml each) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , filter paper sheet((whatmann no 01) , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 50 borocilicate glass autoclavable , metal loop holder , soap , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba gamma gt kit (5x44ml/5x11 ml ) , compertable with transasia semi auto analyzer erbachem 5x , ldh kit , ck mb kit , hdl kit , micropippte((0.5 50 ul)) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , ada , compertable with gelmatrix system model : tulip , ahg (coombs) test card , complete grouping card , diluent 2 liss , ngl xcf 3000 blood component separator machine , platelet apheresis bag...

Department of Health Research - Madhya Pradesh

37194794 bids are invited for molecular gel electrophoresis reagents bromophenol blue , xylene cyanol ff , glycerol , sodium chloride , coomassie protein assay reagent bradford reagent total quantity : 5...

National Fertilizers Limited - Madhya Pradesh

37167285 supply of stationary => limited tee pin approx. 100 gms, packing make;zebra / vapi / kores / lion / gem, etc eraser pencil, make: kores / camlin / natraj, etc 15 ml while fluid correction pen, make: kores / camlin, etc gum bottle 150 ml, make: kores / camlin, etc pencil ordinary hb make:camlin / kohinoor / natraj, etc pencil sharpner make;natraj / camlin / kores, etc stapler pin for max 10 stapler, make: kores / kangaroo / max, etc. each box containing 1000 pins ( x 50 ) stapler pin 24 / 6, make: kores / kangaroo / max, etc plastic scale of 12 / 30 mm having both reading transparent, make: camlin / kores / omega deluxe, etc unbranded paper weight, material: acrylic / polymer, shape: square / triangle, weight: approx. 125 / 150 gms magnetic alpin box make: omega 1797 or equivalent make permanent marker pen xylene and tolune free, make:camlin / kohinoor / natraj, etc, colour: black 300, blue and red 150 each, green 100 stapler 10, make: kores / kangaroo / max, etc stapler 26 / 4, make: kores / kangaroo / max, etc highlighter, colour: pink 50 nos, yellow 150 nos, green 50 nos white board markers, colors : black 150 nos , red 50 nos, blue 50 nos, bullet tip write & whipe, make: camlin / natraj / kohinoor, etc. stamp pad violet colour 7cmx11.5cm make; kores / camlin rubber band assorted sizes in 100 gram packing ink for stamp pad colour purple 25 ml.pack make: kores / camlin or equivalent carbon paper pencil 210 x 330 mm. pkt. of 100 sheets make; kores / saphire / camlin impress or equivalent single punching machine double punch machine small make;kangaroo 280 / kores or equivalent punch double heavy duty for filing of official papers make: veeto / taj / kangaro dp 800 or equivalent...

Indian Army - Madhya Pradesh

36989789 bids are invited for procurement of consumables items for lab 1 32 haemocult test occult blood test kit of 50 tests , abst octa disc ready made gnb and gpc , acetone commercial , alcohol amyl , alcohol dehydrated ethanol , bactec alert aerobic biomerieux , bactec alert aerobic paediatric , water culture agar double strength , blood agar base , cled agar , d p x mounting med , diamond glass writing 240 oblique 240 , formalin 05 ltr can , hydrogen peroxide solution 500 ml , kit for pas ready to use , knife bard parker blade size 2 fitting commercial no 22 packet of 6 , pap stain rapid , paraffin liquid 500ml , paraffin wax tissue embedding , parrafin tissue block moulds metal steel , perls iron stain kit , cover slip microscopic rectangular 22 x 50 mm , slide microscope thickness 1 point 15 to 1 point 35mm size 75mm x 25mm , sterile containers 50ml wide mouth sealed , tissue cassettes plastic , zn stain kit readymade , xylene xylol pure , pt prothrombin time reagent vial of 25 tests , reticulocyte stain kit readymade j k diagnostics , anti h lactin , rapid card screening for hcv , erba norm and erba path internal qc combipack , glucose powder 500gm , kit for estimation of ck mb 28 ml 2 x 2 ml , kit for estimation of ldh 4x8 ml 1x8 ml , kit for estimation of lipase 1x20 ml , kits for estimation of alkaline phosphatase 6 x 6 ml or 4x24 4x6ml , protein csf kit 1x50 ml micro protein , tube test 75 mm x 12 mm rimless , d dimmer estimation test kit pack size 1x7 ml 1x4 ml , ehrlich haematoxylin stain merck , vaccutainer sterile with gel 5ml gold bd , vaccutainer heparin tubes 4ml green bd , chloroform , milk testing kit , 1 percent periodic acid , kits for estimation of electrolytes total quantity : 8526...

Government Medical College - Madhya Pradesh

36706248 tender for chemical reagent at nscgmc chemical and reagent ( microbiology and histopathology service lab ) , gram stain kit 125 ml ( crystal violet, iodine, acetone & safranin ) , carbon fuschin 500ml , zn staining kit , lugols iodine 500 ml , borosil glass petri plates ( 95 100 mm ) autoclavable , borosiltest tubes ( 120*13 mm size ) , borosiltest tubes ( 140*16 mm size ) , test tubes rack ( 120*13 mm & 140*16 mm size ) , durham tube , borosil glass bottle with rubber caps for blood culture ( 30ml , 50 ml ) , nichrome wire loop big & small with handle , albert stain a & b , antibiotic disc ampicillin 10 ⴎg / disc ( 1 vial ) , antibiotic disc amoxicillin 20 ⴎg / disc ( 1 vial ) , antibiotic disc ampicillin / sulbactam 10 / 10 ⴎg / disc ( 1 vial ) , antibiotic disc ampicillin / clavulanic acid20 ⴎg / 10 ⴎg / disc ( 1 vial ) , antibiotic disc piperacillin 20 ⴎg / disc ( 1 vial ) , antibiotic disc piperacillin / tazobactam 100 / 10 ⴎg / disc ( 1 vial ) , antibiotic disc co trimoxazole 25ⴎg / disc ( 1 vial ) , antibiotic disc vancomycin 30 mcg / disc ( 1 vial ) , antibiotic disc linezolid 30 mcg / disc ( 1 vial ) , antibiotic disc cefoxitin 30 mcg / disc ( 1 vial ) , antibiotic disc erythromycin 15mcg / disc ( 1 vial ) , antibiotic disc azithromycin 15mcg / disc ( 1 vial ) , antibiotic disc doxycycline hydrocloride 10 mcg / disc ( 1 vial ) , antibiotic disc minocycline 30 mcg / disc ( 1 vial ) , antibiotic disc clindamycine 10 mcg / disc ( 1 vial ) , antibiotic disc chloramphenicol 30 mcg / disc ( 1 vial ) , antibiotic disc ciprofloxacin 05 mcg / disc ( 1 vial ) , antibiotic disc ofloxacin 05 mcg / disc ( 1 vial ) , antibiotic disc levofloxacin 05 mcg / disc ( 1 vial ) , antibiotic disc cefixime 05 mcg / disc ( 1 vial ) , antibiotic disc cefixime / calvulanic acid 5 / 10 mcg / disc ( 1 vial ) , antibiotic disc ceftriaxone 30mcg / disc ( 1 vial ) , antibiotic disc ceftriaxone / sulbactam 30 / 15 mcg / disc ( 1 vial ) , antibiotic disc cefotaxim 30mcg / disc ( 1 vial ) , antibiotic disc cefotaxim / calvulanic acid 30 / 10 mcg / disc ( 1 vial ) , antibiotic disc ceftodoxime 10 mcg / disc ( 1 vial ) , antibiotic disc ceftazidime 30 mcg / disc ( 1 vial ) , antibiotic disc cefepime 30 mcg / disc ( 1 vial ) , antibiotic disc imipenam / cilastin10 / 10 mcg / disc ( 1 vial ) , antibiotic disc imipenam 10 mcg / disc ( 1 vial ) , antibiotic disc imipenam + edta10 mcg / disc + 750 mcg / disc ( 1 vial ) , antibiotic disc meropenam ( 1 vial ) , antibiotic disc etrapenam 10 mcg / disc ( 1 vial ) , antibiotic disc nitrofurantoin 200 mcg / disc ( 1 vial ) , antibiotic disc netillin 30 mcg / disc ( 1 vial ) , antibiotic disc amikacin 30 mcg / disc ( 1 vial ) , antibiotic disc gentamicin 10 mcg / disc ( 1 vial ) , antibiotic disc gentamicin 120mcg / disc ( 1 vial ) , antibiotic disc streptomycinhls 300mcg ( 1 vial ) , disc bacitracin b ( 1 vial ) , disc otochin ( 1 vial ) , disc novoblocin 5 mcg / disc ( 1 vial ) , vancomycin ( 1 vial ) , levofloxacin ( 1 vial ) , amoxyclav ( 1 vial ) , sterile cotton swab , slide store box ( plastic ) , culture glass bottel with cap , measuring cylinder ( 100ml ) , xylene 100 ml ( renkem / himedla ) , dpx ( 500gm ) , tuberculin syringe , ppd 5tu, 10 tu , glass slide ( 75*25 mm size ) isi mark 1.35 thickness frosted micro slideblue star , coverslip ( 22x22 mm size ) blue star , coverslip ( 22x50 mm size thickness no. 1, 0.13 0.16 blue star ) , discarding bag , distill water ( 1 litre ) , anaerobic gas pack for anaerobic culture , borosil conical flask ( 100, 250, 500, 1000 ml ) , forceps big & small , paraffin oil ( 1 litre ) , dispensing dropper 3 ml sterlle ( 1 pack opf 1000 ) , normal saline , cotton bundle , testtube brush , peptone water ( 500 gm ) , mac conkey agar ( 500 gm ) , cled agar ( 500 gm ) , nutrient agar ( 500 gm ) , blood agar base ( 500 gm ) , mueller hinton agar ( 500 gm ) , t.c.b.s. agar ( 100 gm ) , oxidase discs , mr vp medium ( glucose phosphate broth ) 500 gm , triple sugar iron agar medium500 gm , simmons citrate agar500 gm , urea agar base ( christensen ) 500 gm , kovacs indole reagent 100 ml , methyl red indicator100 ml , barritt reagent a ( for vp test ) 100 ml , barritt reagent b ( for vp test ) 100 ml , autoclave tape , bacillus thermophillus spore ( steam sterilization monitor strip ) , anaerobic jar , plastic tray ( 37*28*7 cm ) , disposable jar , hand wash 1 ltr , room freshner , sterile swab stick wooden stick, individually packed of size 150* 2.50 mm ( 1packet of having 500 pcs ) , sterile sample collection container 30ml , spatula , koh 40 % ( 5 litre ) , sabouraud dextrose agar base, emmons modified ( 500 gms ) , sabouraud dextrose agar base with chloramphenicol ( 500 gms ) , potato dextrose agar ( 500 gms ) , corn meal agar ( 500 gms ) , potasium tellurite agar , selenite f broth , tween 80 , deoxycholate cxitrate agar ( dca ) , salmonella shigella agar , lactophenol cotton blue stain , india ink stain 100ml , stool container , slide box ( 1 packet ) , filter paper , robertson cooked minced meat media , 1% glucose reagent , 1% lactosereagent , 1% menltolreagent , 1% sucrosereagent , urease reagent , clay , oxidase reagent , wilson & blair medium , loffiers serum slope , test tube ( 10ml, 20 ml, 30 ml ) , glass marker pen , beaker ( 100ml, 250 ml & 500ml, 1000ml ) , 5% o napthon , pottassium hydro.pell. ( 500gm ) , syringe ( 1 10 ml ) , falcon tube rack big , falcon tube , methynol ( 1 litre ) , phenol ( 1 litre ) , paraffin roll , spirit ( 5 litre ) , petridish plate 90 ml ( glass ) autoclavable , inoculating, loop holder , inoculating wire , text tube holder , autoclave drum , spray bottle , nutrient broth , brain heart infusion ( bhi ) broth , bromocresol purple lactose agar , sillons citrate agar ( 500 gms ) , sxt ( trinethiprin plus slufanethxazole ) text , mopility agar test , nitrate broth , hydrogen peroxide 500 ml , salt tolerance text ( 1 pieces ) , congo red capsule stain ( 1 pieces ) , wirtzs endospore stain , tryptona soya broth , varivol ii micropipette ( 10 ul, ) , varivol ii micropipette ( 200ul ) , varivol ii micropipette ( 1000ul ) , nitric acid 10% ( merck / renkem / qualignes ) 500 ml , glacial actic acid ( merck / renkem / qualignes ) 500 ml , hemotoxylin ( merck / renkem / qualignes ) 5 gms , mercuric oxide ( merck / renkem / qualignes ) 100 gms , paraffin wax ( melting point 58 62 c ) per 2 kg ( himedia / renkem / qualignes ) , surgical blade ( long cutting ) ( 100pcs ) , blade holder scalpel ( 6*4 inch ) , blade holder scalpel ( 3*2 inch ) , base mold for embedding ring ( 22*22* 6 mm ) , base mold for embedding ring ( 32*25* 6 mm ) , base mold for embedding ring ( 38*25* 6 mm ) , steel tissue cassettes ( big ) , steel tissue cassettes ( small ) , glass jar with lid ( stainless steel ) ( 25 sildes ) , staining basket ( staining steel ) ( 25 slides ) , carriers rack ( slide ) 50 slides , carriers rack ( slide ) 20 slides , l mold with plate ( brass ) small 16*16*12 mm , l mold with plate ( brass ) medium 22*22*12 mm , l mold with plate ( brass ) big 32*25*12 mm , eosin powder ( merck / renkem / qualignes ) , aluminum ammonia sulphate ( merck / renkem / qualignes ) , hcl ( merck / renkem / qualignes ) , diamond pencil ( 1 packet ) , isopropyl alcohol ( merck / renkem / qualignes ) , formlin solution ( merck / renkem / qualignes ) , stalnless steel instrument tray 12*11 , rapid pad stain kit , rapid giemsastain kit , disposableneedle 23g, 24 g , disposable 10 ml & 5 ml syring with needle , aluminum slide carring tray horizontal for 20 slide , fnac plunger , reticulocyte stain 100 ml , glycerin ( 1 lit ) , pop ( plaster of paris 01 kg pkt ) ( 01 kg ) , phenol crystal ( 500 gm ) , thymolcrystal ( 500 gm ) , plane slide ( 2.5*7.5 cm ) ( pkt ) , wide mouth bottle ( dimensions 10.5*5.5*5.5 ) size 10.5*5.5 cm ) ( 1 pcs ) , slide holder ( 1 pcs ) , cover slip ( 2*2 cm ) ( 1 pkt ) , cuplin jar ( 1 pcs ) , anti d antisera10 ml , anti a antisera10 ml , anti b antisera 10 ml , sulphosalicylic acid ( 500 ml ) , capillary tube 90 mm , n / 10 hci ( 500 ml ) , rbc diluting fluid ( 500 ml ) , wbc diluting fluid ( 500 ml ) , leishman stain ( 500 ml ) , field a stain ( 500 ml ) , field b stain ( 500 ml ) , benedicts reagent ( 1n lit ) , sodium nitroprusside ( 100 gm ) , fouchets reagents ( 150 ml ) , sulphur powder ( 500gm ) , immersion oil ( 25 ml ) , liqour ammonia ( 25 % ) ( 500 ml ) , acetone99 % ( 500 ml ) , disposable needle , pas stain , buffer solution ( 500ml ) ( 01 bottels ) , pricking lancet ( disposable ) , glass capillary tubes ( 1 packs ) , wintrobe&westergrentubes ( pieces ) , egc roll ( 01 packs ) , ecg jelly ( 01 bottles ) , savlon solution ( 500ml ) ( 01 bottles ) , edta solution ( 01 bottles ) , double oxalate solution ( 01 bottles ) , 1.3% sodium citrate solution ( 01 packs ) , graph paper sheets ( 01 packs ) , rectified spirit ( alcohol ) 500ml ( 01 packs ) , platelet diluting fluid ( rees ecker ) , sodium glycocholate 500gm , ammonia solution 500ml , acetic acid 500ml , jack been meal 500gm , silver nitrate 500ml , picric acid 500ml , magnesium sulphate 500gm , calcium chloride 500gm , ammonium sulphate 500gm , creatinine powder 25gm , bovine albumin powder 25gm , pure phosphate powder 500gm , borosil glass reagent bottle ( 1000ml ) , taurocholate 500gm , potassium oxalate 500gm , barrium chloride 500gm , urea powder 500gm , glucose powder 500gm , glass dropper with marking ( glass 10ml ) , sodium hydroxide 500gr. , potassium peroxide 500 ml , phenolphthalein 100 ml , sodium chloride 500 gr. , potassium chloride 500 gr. , potassium iodide 500 gr. , potassium bromide 500gr. , zinic oxide 500 gr. , silver nitrate 50 gr. , acetic anhydride 500ml , starch solution 500 ml , sodium acetate 500 gr. , potassium dichromate 500 gr. , silica 25 ml , sodium nitrate 500 gr. , sodium iodide 500 gr. , zinic sulphate 500 gr. , borax 500 gr. , calcium oxide 500 gr. , lab burners ( 02 set ) , rubber tubing ( 01 set ) , acetatebuffer , saturated glucose solution , pyridine solution , 10% naoh ( sodium hydroxide solution ) , cobalt ( ii ) thiocynate , cobalt ( ii ) acetate dihydrate , isopropylamine , acetaldehyde , vanillin , chloroform , ammonium vanadate , concentrated sulfuric acid , 40% formaldehyde , para dimethylaminobenzaldehyde ( p dmab ) , anhydrous ferric chloride , ferric chloride hexahydrate , sodium molybate , molybdic acid , selenious acid , copper ( ii ) sulfate penthahydrate , sodium nitroprusside , sodium carbonate , hiv rapid card , malaria raid card , syphalis card ( igg, ibm ) , vdrl ( rrr ) strip , hbsag rapid card , pregnency test card , tissue paper roll , aluminium foil , boric acid ( 500g ) , calcium carbonate ( 500g ) , iodine solution 500ml , uric acid powder 100g , urea kit ( berthlot method ) , er anitibody rtu ( ready to use ) , pr anitibodyrtu ( ready to use ) , ki 67 anitibodyrtu ( ready to use ) , ihc ditection system ( hrp kit = secondary antibodies ) , pep pen , ihc slides ( poly l lysine coated slides ) , ihc washing buffer 20x ( pbs ph 7.4 to 7.6 ) , antigen retrival solution , blooting papers , sodium dihydrogen phosphate , disodium dihydrogenortho phosphate , tri sodium citrite , cirtric acide , triss buffer , pas stain , afb stain , hematoxylin ( ready to use ) ( 02 bottles ) , 2 % eosin ( ready to use ) ( 01 bottle ) , buffered formalin 10 % ( ready to use ) ( 25 litres ) ...

Department of Higher Education - Madhya Pradesh

36648646 bids are invited for lab instrument cyclohexane , ethylacetate , acetophone , acetone , silica crusible , thisel tube , isopoopyl alcohol , cupper sulphate , dimethyl glyoxime , distallation unit , kipps appratus , filter paper no 1 , diphenylamine , acetinalide , pthalic anhydride , aniline , 2.4 dinitoophenyl hydazine , acetaldehyde , litmash paper , 500 ml r b flask , 250 ml r b flask , weight box , chloroform , ferous sulphate , ammonium phasphate , acetic acid , strontium chloride , potassium dichromate , phthalic acid , poasium iodide , sodium hypochloride , microscope binocular , microscope compound , sprit lamp , xylene , dissecting box , watch glasss , slide stand , cotton blue , ethanol , glycerine , canada balsam , chrometography paper , pertidish , forcep , needle , brushes , dropper , safranin , fast green , acetocarmin , sulphuric acid , glass funel , t.s of testis mammal permanent slide , t.s. of liver mammal , v.s. of kidney mammal permanent slide , water bottle 250 ml , needles , dropper , glucose , sucrose , starch , benedicts solution , sulphuric acid , molish reagent , fehling solution a , fehling solution b , hcl acid , slides , slide box , beaker 100 ml , spirit lamp , cover slips , test tubes , test tube holder , test tube stand , traveeling microscope , stop watch digital , physical balance , zener diode , lens all type , ohms law appratus , pnp npn transistor , pn junctio didiode , weight box total quantity : 322...

Directorate Of Medical Education - Madhya Pradesh

36434740 kits chemical and comsumable, reagents tender regarding kits chemical and comsumable, reagents , name of department : pathology , diluent ( m 53 ) , lyse ( lh ) ( m 53 ) , leo ( ii ) ( m 53 ) , leo ( i ) ( m 53 ) , cleanser ( m 53 ) , probe cleanser ( m 53 ) , quality control ( m 53 ) , calibrator ( m 53 ) , bendedicts qualitative reagent , reticulocyte kit , leishmann stain sol. with buffer tablet ph , methanol ( acetone free ) , occult blood test kit ( haem test kit ) , drabkins solution , vaccutainer edta ( k3 vial with needles ) , immersion oil ( merck / span ) , test tube glass ( 12 x75 ) borosil / pyrex , tips ( micropipette ) ( 5 200?l ) , glass capillary tube , lancet , ( 10 ml syring ( piston with rubber bang ) , disodium hydrogen phosphate ( anhydrous ) , sodium di hydrogen phosphate , protein for csf ( calorimeter ) , albumin for csf ( albumin ) , rubber gloves 6.5, 7.0, 75 size , strips for urine albumin and sugar , hypochlorite so. ( conc. ) , ehrilichs aldehyde reagent , semen diluting fluid , wbc diluting fluid , sulphur powder , test tube holder , manual cellcounter , neubaerscounting chamber new improved , urinometer for specific gravity , h2o2 ( conc. ) , leishman staining powder , esr wintrobe tube ( glass ) , ammonia sol. , tissue paper roll , fouchets reagent , esbachsreagent , ehrlichs reagent , litmus paper , total protein reagent , filter paper , forceps 6 & 4 , tissue roll , vaccutainer needles holder , tourniquet , sodium citrate vail , cell pack , stromatolyzer 4 dl , stromatolyzer 4 ds , sulfolyzer , cell clean , g6pd kits , coombs , leishmann stain sol. with buffer tablet ph leishmans , waxparaffin ( 60 62 digree ) high grade, , formaline , microtome blade ( thermo ) m x 35 ultra 34 / 80 mm , nitric acid , filter paper sheet size 460mm x 570mm , popy lysine coated slide , poly lysine solusion , citric acid , tri sodium , sodium di hydrogen phosphate , disodium hydrogen phosphate , sodium chloride , tris ( hydroxy methyl ) amino methane , pas staining kit , microtome blades ( spencer’s rottary ) high profile , ptah staining kit , microtome blades ( thermo ) hp35 ultra 34 / 75 mm , cryomatrix gel ( thrmo ) , crytome ( fe ) cryocassette ( block hider ) , reticuline stain , messon tricrome , l mold ( brass metal ) size 6x03x02cm , cassette ( for tissue processing ) metal , dimond pencil , formic acid , runing water tray ( for histology ) , grossing nife ( ss ) , forcep 6’’ , scissors 6’’ , slide tray aluminium , coplinjar , tissue paper , cover slipe ( 22x50mm ) histology+ cytology , glycerol , con. hcl , muccuric oxide , iron alum amunium potesium sulphate , fericammonium sulphate , mucicarmine stain , alcian blue stain , congo red stain , staining rack , gold chloride , sliver nitrate , liquer ammonia , ph paper , slide filing cabinets , alcohol ( isopropyle alcohol ) histology + cytology , glass slide histology, cytology, cpl , xylene sulpher free histology + cytology , cover slips22x22 mm histology + cytology+cpl , d.p.x. 250 ml histology + cytology , haematoxyline powder 5 gm histology + cytology , glacial acetic acid histology + cytology+cpl , cover slips22x50 mm histology + cytology , cover slips22x40 mm histology + cytology , ea 50 , og 06 , eosin , carbal fuchsin , acid fast , methylene blue , cytospin filter card , cytospin filter cup with clips , plain plastic tube , glass test tube , filter paper sheet , diamond pencil , sta neoptimal cl 10 ( 00667 ) , sta ptt automate 5 ( 00595 ) , sta c.k. prest 5 ( 00597 ) , sta thrombin 2 ( 0611 ) , sta lia testd di plus ( 00662 ) , sta coag control ( n+p ) ( 00679 ) , sta lia test control n+p ( 00526 ) , sta lia test vwf:ag ( 00518 ) , sta immnodef def f viii ( 00728 ) , sta immnodef def f ix ( 00734 ) , sta pool norm ( 00539 ) , sta desorb u ( 00975 ) , sta cacl2 0.025 m ( 00367 ) , sta cleanersolution ( 00973 ) , sta cuvettes ( 38669 ) , sta cuvettes satellite ( 39430 ) , sta liquid cooling glycol ( 38640 ) , sta ptt la ( 00599 ) , sta liquid fib ( 00673 ) , sta pm kits ( 89567 ) , sta system control ( 00678 ) , sta uni calibrator ( 00675 ) , water bath measures ( with thermostate ) , aggregometer , digital stop watchs , incubator ( variable tempresure medium size ) , micro ppt ( finn pipette ) variable , ( a ) 20 200 ? l , ( b ) 05 100 ? l , ( b ) 1000 5000 ? l , ( d ) 50 500 ? l , centrifuge digital without carbon bush ( remi r 8c bc ) , thermametre ( mercury ) centrigrate , diamond pencil , semi automatic coagulometer ( 04 tube ) , cell pack , stromato lyser 4 dl , stromato lyser 4 ds , sulfo lyser , cell clean , e check trilevel , scs 1000 calibrator , g6pd kits ( qualitative ) , coombs sera , tri sodium citrate , amonium sulphate ( erba pure ( nh4 ) so4 , lieshman stain with buffer , mpo stain , iron stain ( perls ) , liquar amonia solution , sodium hypo cloride , distilled water , normal saline ( ns ) , immersion oil , methanol ( acetone free ) , chloroform ( chcl3 ) , potassium ferocyanide , sodium meta bisulfite ( ar ) , h2o2 ( hydrogen peroxide ) , dpx mountant , sodium dihydrogen phosphate , di sodium hydrogen phosphate , bovine albumin ( 22 % ) , acetone solution , syringe plastice 02 ml , piston with rubber bag 5 ml ( syringe ) , piston with rubber bag 10 ml ( syringe ) , hand gloves ( ruber ) , gauze , cotton roll , tissue paper , filter paper roundshape , hand wash shop / solution , citrate test tube ( 3.2% ) 2 ml mark , edta vial 2ml mark ( vacutainer ) , plain plastice 5 ml test tube with stopper , microtips ( unirersal type ) , micro centrifuge tubes ( 1.5ml size ) , glass slides ( blue star ) , cover slips ( blue star ) , glass test tubes ( borsil ) , glass test tubes ( borsil ) , glass ppt. ( mark up to tip ) , glass ppt. ( mark up to brosil ) , rubber bulb for ppt , glass fimmd ( borosil ) , bio rad d 10 tm dual program , lyphochek a2 control ( 553 ) l1+l2 , plastic aliquos polypropylane vials with pierceable caps ( sample vials 1.5 ml ) , micropipettes ( 100 1000 micro lt. ) , micropipettes ( 05 50 micro lt. ) , microtips+macrolips ( large ) , microtips+macrolips ( small ) , thermal printer paper ( 4 ) , rb a hu3c comlenent / fitc , rb a hu igg / fitc , rb a hu igm / fitc , rb a hu iga / fitc , miscellaneous item , igg , iga , igm , c3 , cig , c4d ( tansplant ) , fibrinogen , kappa ( kidnev only ) , lambds ( kidnev only ) , fitc ( florescent isothiayank , rhodaminc , feulgen stain , michelsmidium ( transport midium ) , er immuneo , pr immune , her 2 / neu , hpv 16 & hsv immuno stains , proliferative marker p 53 , proliferative marker kit 67 , pancytokeratin , ck 7 , ck 20 , ema , cea , hmwck , apf , vimentin , s 100 , desmin , nse , chromogranin , synaptophysin , msa , c kit / cd 117 , cd 34 , cd 31 , lca , bcl 2 , bck 6 , cd 3 , cd 5 , cd 10 , cd 20 , cd 15 , cd 1a , cd 30 , cd 68 , cd 99 , alk 1 , ca 125 , hmb 45 , gfap , myoglobin , cd 19 , plap , cd 33 , mpo , leucognost alpa , leucognost est , leucognost pas , leucognost pox , leucognost basic set , hematognost fe , basic set / reduction set , ttf 1 , p16 , mannual kits for liquid based cytology , cd 34 , cd 31 , lca , andriogenreceptro , myogenin , pten , cyclin d1 , lbc manual kits for cervical cancer screening , ihc basic kit , pap pen , humod chamber , name of department :pediatric medicine , crp ( turbidometry quantitative ) , crp slide ( latex / slide ) , urea ( modified berthelot ) , creatinine ( alkaline picrate kinetic ) , bilirubin t+d ( dmso ) , protein ( total ) { biuret } , printer paper ( thermal ) , sodium hypochlorite , tips – small ( 5 100 ul ) , tips – 1 ml ( big ) , micropipette – 1 ml , micropippete 50 ul , micropippete 10 ul , micropippete 5 50ul , dengue card , caliberator 1 and 2 , na electrode , k electrode , ca electrode , reference electrode , complete tubing set , paper roll , electrolyte filling solution , reference electrode filling solution , albumin ( bcg method ) , name of department :medicine , sterilant hot disinfectent for dialysis containing 21% ( approx ) ( citrostrile disinfectent ) for dialysis machine , sodium hypochlorite solution 5% for dialysis machine , dialyzer / a.v line reprocessing sterilant cold disinfectent for dialysiscontaining pracetic acid hydrogen peroxide acetic acid , equipment disinfecten gluteraldehyde solution 2% , bi_ carb h.d. fluid , bi_ carb potassium free h.d fluid , 1. wash cartridge 2. measurement cartridge for siemens abg machine , serum glucose kit method – god pod , blood urea kits modified birthlot method , serum creatinine method – jaffe’s kinetic method , eeg paste , eeg electrode , ncv electrode , emg needle , diluents ( abx minidil lmg ) method horiba abx micros es 60 , abx miniclean cleanser method horiba abx micros es 60 , abx mini lysevio method horiba abx micros es 60 , abx mono clair method horiba abx micros es 60 , urine strip method deka phan laura 10p make transasia , methanol , field stain a , field stain b , drabkin’s reagent method – cyanmethemoglobin , name of department : biochemistry department , murcuric sulphate , barium chloride , cupric acetate , creatinine powder , casine powder , formaldehyde , fructose powder , glucose powder , gelatin powder , lactose powder , mercuric chloride , maltose powder , phenyl hydrazine hydro chloride , resorcinol , sodium nitro prosside , sodium hydroxide , sodium tarcholate , sodium meta bisulphate , sucrose powder , starch , sodium chloride , sodium nitrite , sulphuric acid , hydro chloric acid , glacial acitic acid , nitric acid , ? napthol , phloroglucinol powder , ninhydrine powder , hydrogen peroxide , liquor ammonia , chloroform , albumin powder , ethanol ( abs.alcohol ) , amyl alcohal , ammonium molebdate , bromine ampule , burning spirit , sodium tungstate , lead oxid ( yellow ) , silver nitrate , urea powder , megnsium sulphate , uric acid , trichlora acitic acid , frerric chloride , cupper sulphate , ammonium oxalate , sulpher powder , bromocresal green ( liquid ) , picric acid , phenopthline indicator , lead acetate , orthophosphoric acid , sodium carbonate , lactic acid , barium nitrate , barium hydroxide , potassium chloride , sodium phosphatase ( hydrated ) , sodium pyrophosphate , n butanol , ether , phenol ( carbolic acid ) , phaspho molybdic acid , phasphotungstate , potassium hydroxide , sodium acetate , sodium carbonate , sodium hypo chloride , sodium tungstate , acetone , calcium chloride , ferrous sulphate , bilirubin powder , sodium benzoate , sodium dihydrogen phosphate monohydrate , thioberbituric acid , sodium citrate , sodium meta bisulphate , methanol , tannic acid , acitic anhydride , sodium diethyle dithio carbamate , sodium sulphate , ferric ammonium sulphate , perchloric acid , adrenaline bi tartrate , l tyrophan , l alanine , l arginine , l aspartic acid , l cysteine , l glycine , l tyrisine , l serine , l histidine , l methionine , l phenyl alanine , pera nitrophynele phosphate , sodium citrate dihydrate , filter paper 1, 2, 3 , filter paper circular 1, 2 ( circular ) , filter paper plane , cellulose strip ( for electrophoresis ) , beaker , beaker , beaker , beaker , beaker , beaker , volumetric flask , volumetric flask , volumetric flask , funnel ( plastic ) , flat bottom flask , flat bottom flask , merking acid bottles ( hcl ) , merking acid bottles ( h2so4 ) , merking acid bottles ( hno3 ) , dropping bottles brown , dropping bottles plane , reagent bottle , test tube , test tube , spirit lamp , test tubes holder , fallin uw tube , slide glass , cover slip , doramess urea meter , measuring clyinder , measuring clyinder , measuring clyinder , measuring clyinder , test tube stand ( bigsize hole 12 test tubes ) , drapper ( big size ) , glucose god pod , urea birth lot , uric acidpap method , cholesterolchod pap method , total protein biurate , albuminbcg colorimetric test , csf protein ( end point ) , sgotifcc / uv kinetic method , sgptifcc / uv kinetic method , alkaline phosphatase pnpp amp kinetic assay , triglyceride , hdl cholestrol , serum bilirubinjendrassik & grof method , serum creatinine jeff s reaction ( alkaline picric method ) , serum calcium , serum phophorus , calibrator solution 1& 2 ( carelyte electrolyte analyzer ) ( electrode method ) , enzyme cleaning solution , sodium conditioner , reagent pack ( careline electrolyte analyzer ) ( electrode method ) , control level 1 , control level 2 , d proteinization solution , sodium conditioner , cleaning solution , glucose god pod ( ba 400 ) , urea urease / glumate dehydrogenase , serum creatinine jaffe compensated , sgotifcc , sgpt ifcc , alkaline phosphate amp2 amino 2 methly 1 propanal , total bilirubindicholophenyl dizo buffer ( ifcc ) , serum direct bilirubindicholophenyl dizonium , serum protein biuret , serum albumin bromocresol green , cholesterol cholesterol peroxidase method , triglyceride glycerol phaphate oxidase / peroxidase , hdl cholesteroldirect , hdl / ldl standard , ldl cholesterol direct , serum uric acid uricase peroxidase , serum calcium arsenazo iii , serum phosphorus , serum amylase direct substract , serum lipase colour method , cpk ( ck ) ifcc , ck mb ifcc , serum ferritinlatex , serum ferritin standard , hba1c direct , hba1c standard , crp , crp standard , ldh kit , magnesium kit , biochemistry calibrator , biochemistry control , wash solution concentrate , reaction rotor , pd cups , extran ma 02 , protein electrophoresis in blood ( serum kit ) code no.7004058 , normal control serumcode no.58305 , wash solution code no. 58595 , destaining solution code no.58694 , hb electrophoresis , d 10 hemoglobin a1c program recorder pack ( code no 220 0101 ) , d 10printer paper ( code no 220 0375 ) , liquichek diabetes control level 1 ( code no 171 ) , liquichek diabetes control level 2 ( code no 172 ) , tips ( 10 200 ul ) , tips ( 10 1000 ul ) , allicates , clot vaccutainer , distill water ( ltr ) , tissue paper roll , t3 elisa , t4 elisa , tsh elisa...

Indian Army - Madhya Pradesh

36317550 procurement of drugs and disposable , powder free gloves surgical ( sterile ) , ( pair of ) size 8.0 ( conforming to bis standards is 13422;1992 ) , powder free gloves surgical ( sterile ) , ( pair of ) size 6.0 ( conforming to bis standards is 13422;1992 ) , denudation pipette ( plastic ) 300 microns ( human ivf grade ) individually sterile packed vial of 10 / 20 pipette , disinfectant spray ( non embryo toxic ) of 1 litre ( human ivf grade ) , semen collection jar sterile individually packed ( 110 ml ) ( human ivf grade ) pack of 100 , icsi dish for ivf ( human ivf grade ) ( pack of 500 ) , 14ml tube poly round bottom tubes individually packed sterile packed for ivf ( human ivf grade ) pack of 500 , opu needle 17g needle lengh 35cm tubing length 90 100cm , powder free gloves latex, gamma irrigated, size 7 , picsi dish pack of 20 , humidification flask for trigas incubator , sheppard intrauterine insemination set 5.4 fr / 20 cm , kim wipes disposables wipes ( l x w 4.5 inch x 8.5 inch ) , pvp media , virtrification freeze pack for cleavage stage embryos ( containing 2x2 ml equilibration solution and 2x2 ml virtification solution ) , vitrification thaw pack for cleavage stage embryos ( 2x2 ml 1m sucrose ws + 2x2 ml 0.5 m sucrose ws + 2x2 mops solution ) , inj leuprorelin 4mg / ml , tab melatonin 3 mg , human normal immunoglobulin 16.5 % 2 ml , inj triptorelin 3.75 mg , inj highly purified hmg 1200 iu s / c use , inj hmg 150 iu , disposable tips ( 1 to 10 ul ) individually sterile packed ( human ivf grade ) , ivf multidish 4 / 5 well plate ( human ivf grade ) pack of 120 , disposable lithotomy drape ( conforming to bis certificate ) , marker pens for labling ivf plates ( non xylene ) ( human ivf grade ) dual point set of 8 pens ( each pens separate colour ) red, blue, black, green, purple, yellow, orange, brown ( 8 pen set ) ...

Directorate Of Medical Education - Madhya Pradesh

36184405 tender for supply of chemical and reagents for mdru dep , item name , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , floor cleaner phenyl 1 l * 5 , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Indian Army - Madhya Pradesh

35954331 purchase of medical stores as per tender documents , medicines : , pregnancy test card , ana kit (kit of 1x25 tests) , troponin i (pack of 1x25 tests) , aso titre (1x25 tests) , widal kit (4x5ml) , crp kit (1x25tets) , dengue (ns1ag, igg & igm) rapid test , malaria antigen test , fecal occult blood test kit (1x10 tests) , g6 pd test kit , pttk reagent (pack of 12x5 ml) , prothrombin time (pack of 12x5ml) , cuvette for stago start 4 (pack of 150x4) , biorad level 1 chemistry control (pack of 12x5ml) , biorad level 2 chemistry control (pack of 12x5ml) , diabetes control biorad level 1 & 2 , leishman stain ready to use (pack of 500ml with buffer) , reticulocyte stain (bott of 100ml) , drabkins solution (1 ltr) , zn stain ready to use , indian ink stain (50ml) , lacto phenol cotton blue stain , haemotoxyllin ehrlich (ready to use) bott of 500ml , haematoxillin stain harris (ready to use) bott of 500ml , pap stain , ethanol (bott of 500ml) , methanol (bott of 500ml) , formalin , xylene (bott of 500ml) , chloroform (bott of 500ml) , glycerine (bott of 500ml) , paraffin wax (pack of 500gm) , microtome blade s 35 high profile type (pack of 50 blades) feather microtome , plastic tissue embedding ring , plastic tissue cassette , cled agar (500gm) , urochrome agar (500gm) , muller hinton agar (500gm) , blood agar bass (500gm) , sabauraud dextose agar (500gm) , salmonella, shigella agar (bott of 500gm) , vacutainer edta , vacutainer sodium fluoride , vacutainer sterile with gel 5ml , vacutainer sterile plain without gel 3ml , vacutainer sodium citrate 3ml , microscope bulbs , glass marking pen (diamond marker) , milk adulterants test kit , tourniquet , pedridish disposable , urine container plastic 50ml , typhoid igg/igm rapid test (pack of 1x25 tests) , ra factor (1x25 tests) , calcium chloride 0.025m (vial of 5ml) , steel balls for start 4 stago semi auto coagulation analyzer (pack of 1850) , gram stain ready to use , acetone (bottle of 500ml) , filter paper 60x60cm (pack of 50) , l shape embeding mould (brass) => limited...

Government Medical College - Madhya Pradesh

35627530 supply for central lab and cssd consumables and other item supply for central lab and cssd consumables and other items in gmc raltam , three part automated cell counter model : swelab alfa plus basic , swelab alfa plus diluents , swelab alfa plus lyser , boule control normal , boule control low , boule control high , five part fully automated cell counter model : bc 6800 , m 68lh lyse , m 68 lb lyse , m 68 dr diluent , m68 ld lyse , m 68 ln lyse , m 68 ds diluent , 68 fd dys , 68 fr dys , 68 fn dys , probe cleanser , controls and calibrators , aspen bc – 6d control set (6x4.5ml (2l, 2n, 2h)) , aspen bc – ret control set (6x4.5ml (2l, 2n, 2h)) , aspen sc – cal plus calibrator , automatic coagulation analyzer model : sta compact max 3 , stac cacl20, 0025m (00367) , sta cephascreen 10(00310) , sta cleanser solution 6x2500ml(00973) , sta coag control n+p(00679) , sta desorb u24x15ml (00975) , sta liatest control n+p (00526) , sta liatest d di (00662) , sta @ neoptimal 5. (01163) , sta owren koller 24x15ml(00360) , chemicals , ethanol (99.9%) , xylene (sulphar free) , paraffin wax (58 60 temperature) , acetone , hematoxyline , eosin (2%) , distyrene plasticizer xylene (dpx mountant) , glacial acetic acid , formic acid (100%) , nitric acid (100%) , propanol (45%) , oil immersion , n/10 hcl , sodium metabisulphate , urine strip 10 para , sodium nitroprusside , liquor ammonia , ammonium sulphate , sulphosalicilic acid solution , sulphur powder , leishmen stain , wbc diluting fluid , rbc diluting fluid , og 6 , ea 50 , semen analysis diluting fluid , formaline , spirit alcohol , sulphuric acid , reticulocyte count fluid , distilled water , barium chloride , sodium hypochloride , methanol , glucose pouch , perls stain (long expiray) , pas stain (long expiray) , mpo sstain (long expiray) , benzidine solution (long expiray) , kits , reticulocyte count kit , pt kit , aptt kit , field stain kit , rapid pap stain kit , giemsa stain kit , g6pd kit , antisera a , antisera b , antisera d , sickle cell test kit , pt/inr kit , reagent , benedict reagent (long expiray) , ehrlich’s reagent (long expiray) , esbech’s reagent (long expiray) , fouchet reagent (long expiray) , other consumable items , microscopic glass slide (75x25) , jam microscopic cover glass (22x50) , casset , microtome blade , slide box , tissue paper roll , plastic dropper (small) , plastic dropper (big) , test tube 5ml , coupling jar , test tube 10ml , slide carrying tray , aluminium slide tray , slide staining stand , glass dish staining jar , test tube stand , measuring cylinder (10 ml borosilicate) , glass tube brush , hand wash , beaker glass (100 ml borosilicate) , beaker glass (500 ml borosilicate) , conical flask (100 ml borosilicate) , conical flask (500 ml borosilicate) , bubbler (plastic screw) , graduate pipette (borosilicate ) 10ml , volumetric flask 100ml , filter paper 12.5dm , diamond pencil , capillary tube for bt ct (glass) , k3 edta vial , urine container , knife (grossing) , speciman jar with lid (glass) (200x200x70 mm) , speciman jar with lid (glass) (150x150x60mm) , museum jar with lid (glass) (220x150x100mm) , museum jar with lid (glass) (220x195x80mm) , museum jar with lid (glass) (250x165x140mm) , museum jar with lid (glass) (360x150x100mm) , museum jar with lid (glass) (150x150x80mm) , museum jar with lid (glass) (250x250x120mm) , museum jar (10x10x15 inches) , museum jar (18x12x12 inches) , museum jar (25x15x10 inches) , pippette 1 ml (borosilicate) , pippette 5 ml (borosilicate) , glass rod (solid ) , slide holder (steel) , slide staining rack , urinestripe 4 parameter (1.ph 2.specific gravity3. sugar 4.albumin(protein)) , sodium citrate vial , esr tube (wintrobe) , esr western green tube , cover slip10 gm , application plastic stick , sprit lamp glass , tube holder , rbc pipette , wbc pipette , wester green stand , wintrobe stand , pasture pipette , disposable pap smear kit , torniqute , tissue embedding mold , embedding o ring , test tube 15 ml , test tube 20 ml , centrifuge tube 15ml , centrifugr graduated tube 15 ml , reagent bottle 100 ml , reagent bottle 250ml , reagent bottle 500 ml , measuring cylinder 100 ml , measuring cylinder 5 ml , dropping bottle 250 ml , detergent powder , culture media , agar powder , alkaline peptone water , anhydrous barium chloride , arabinose , arginine dihydrolase powder , automated blood culture bottle (adult) compatible withbact/alert 3d 480, bio merieux , automated blood culture bottle (paediatrics) compatible withbact/alert 3d 480, bio merieux , bile esculin agar , blood agar powder , brain heart infusion broth , candida crome agar , cary blair medium base , christensens urea agar base , cled agar , corn meal agar , decarboxylase broth moeller , dermatophyte test medium , glucose , glucose phosphate broth , hugh leifson medium , lowenstein jansens medium(ready prepared) , lactose , lysine decarboxylase , macconkey agar without crystal violet , macconckeys agar with crystal violet , macconkey broth double strength (for water testing) , macconkey broth single strength (for water testing) , maltose , manitolmotility test medium , mannitol , mannitol salt agar , manual blood culture bottle with sds (adult) 70ml , manual blood culture bottle with sds (paediatrics) 20ml , muller hinton agar , nutrient agar , nutrient broth , peptone powder , phenyl alanine agar , pyr agar , robertson cooked meat medium base , sabouraud dextrose agar with chloramphenicol with cycloheximide , sabourauds dextrose agar powder , sabroud dextrose agar with chlorophenicol , selenite f broth , simmons citrate agar , sodium deoxycholate , sucrose , tcbs agar , triple sugar iron agar , xld agar , antibiotic disc , amikacin 30 mcg , amoxicillin , amoxycillin clav 20/10ug , ampicillin 10 mcg , ampicillin sulbactam(10/10 ?g) , azithromycin 15 mcg , aztreonam(30 ?g) , cefazoline 30 mcg , cefepime 50ug , cefoperazone / sulbactum , cefoperazone 75 mcg , cefotaxime(30 ?g) , cefotaxime+clavulanate , cefoxitin 30ug , cefpodoxime , ceftazidime 30 mcg , ceftazidime+clavulanate , ceftriaxone 30 mcg , ceftriaxone sulbactum 30/15ug , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mcg , clarithromycin(15 ?g) , clindamycin 2 mcg , co trimoxazole(sulpha/trimethoprim) 25 mcg (23.75/1.25) , colistin (0.016 256 mcg/ml) , colistin 10 mcg , cotrimoxazole(25 ?g) , doripenem(10 ?g) , doxycycline hydrochloride 30 mcg , ertapenem(10 ?g) , erythromycin 15 mcg , gatifloxacin(5?g) , gemifloxacin(5 ?g) , gentamicin 10 mcg , imipenem 10 mcg , linezolid(30 ?g) , lomefloxacin(10 ?g) , meropenam 10ug , minocycline(30 ?g) , moxifloxacin(5 ?g) , nitrofurantion 300 mcg , norfloxacin 10 mcg , novobiocin(5 ?g) , ofloxacin(5 ?g) , oxacillin(1 ?g) , penicillin 10 units , piperacillin 100 mcg , piperacillin/tazobactam 100/10 mcg , polymyxin b , quinopristin dalfopristin(15 ?g) , teicoplanin , teicoplanin 30 mcg , tetracycline 30 mcg , ticarcillin clavulanate(75/10 ?g) , tobramycin 10 mcg , trimenthoprim(5 ?g) , vancomycin (0.016 256 mcg/ml) , vancomycin 30 mcg , bacitracin(0.4 u) , sterile disc , v factor , x factor , x+v factor , optochin(5 ?g) , kits & chemical , acetone solution , acid fast staining kit , albert’s metachromatic stain kit , andrade’s indicator , anti hav igm (elisa kit) , anti hav igm (rapid test) , anti hcv antibody kits (elisa kit) , aso kit(25 test/packet),consumable , basic carbol fuchsin for afb staining(powder) , conc hcl , crp test kit , crystal violet powder , dengue ns 1 elisa , formaldehyde solution , field stain a , field stain b , filarial antigen card test , ferric chloride (500 gm) , formaldehyde 40% (conc. formaline) , giemsa stain (merck / span) , glycerol , gram iodine , gram staining kit , h2so4 (sulphuric acid) 25% , hbv elisa test kit , hepatitis e virus anti hev igm antibody (elisa) , hiv (rapid)(whole blood finger prick test kit) , hiv elisa test kit , hydrogen peroxide 6% solution , india ink , kovac’s reagent (indole) , lacto phenol cottons blue stain , lead acetate strip , leishman stain , liquid paraffin , malaria bivalent antigen detecting rapid diagonstic tests(rdts) , methyl blue for (z n) , methyl alcohol , methyl red indicator , methylene blue powder , nitrate reagent a , nitrate reagent b , occult blood test kit (haem test kit) , oxidase disc , oxidase reagent (tetra methyl para phenylene di amine di hydro chloride) , phenol crystals , pyr reagent , ra factor rapid kit , rpr test kit , safranine (gram stain) , urea 40% supplement (for urea agar base) , voges proskauer reagent a , voges proskauer reagent b , widal slide test(4x5ml with control) , xylene , zinc dust , chemical indicator for autoclave (indicator tape) , biological indicator for autoclave (indicator vial) , glassware, plasticware& other item , autoclavable aluminium foil , autoclavable glass bottle with screw cap for culture media (1000ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (500ml (borosilicate glass autoclavable)) , autoclavable glass bottle with screw cap for culture media (50ml (borosilicate glass autoclavable)) , autoclavable petri plate (100mm) plastic , autoclavable petri plate (150mm) plastic , autoclavable petri plate (90mm) plastic , autoclavable reusable transparent bags , bcg(1 ml each) , beaker 1000ml (borosilicate glass autoclavable) , bloting paper (paper) , burning sprit , cedar wood oil , concavity slide , conical flask (glass) 1000ml , conical flask (glass) 100ml , conical flask (glass) 2000ml , conical flask (glass) 500ml , conical flask (glass) 50ml , cover slip , cryogenic vial , disposable plastic loop 2mm , disposable plastic loop 4mm , disposable sharp collection containers(5 ltr) , dropping bottle plastic 100 120 ml capacity , durham’s tube , falcon tube sterile, (conical bottom)(50ml each plastic containers with air tight screw cap printed graduation) , filter paper sheet((whatmann no 01) , filter paper(12.5 cm, 0.1 micron) , forceps small , gaspak (3.5 liter) , glass marking pen (diamond ) , glass reagent bottle (5 litre) , glass test tube 12 x 100 (medium size) heavy quality 100/pkt(no.) , glass test tube 12 x 50 borocilicate glass autoclavable , glass test tube 15 x 125 borocilicate glass autoclavable , measuring cylinder plastic (100 ml) , measuring cylinder plastic (1000 ml) , measuring cylinder plastic (50 ml) , measuring cylinder plastic (500 ml) , metal loop holder , micropipette tips (10 ul )(for serology) , micropipette tips (100 ul )(for serology) , micropipette tips (1000 ul )(for serology) , micropipette tips (20 ul ) , micropipette tips (200 ul ) , microscope lens cleaner kit , para film sealing film , ph paper strip range (1 10) , soap , sterile cotton swab wooden stick(individually packed) , sterile disposable/hypodermic syringe for single use(5ml ) , sterile disposable/hypodermic syringe with needle for single use(2ml ) , sterile disposable/hypodermic syringe with needle for single use(10ml ) , sterile urine collection container 50ml disposable , individually packed , swab stick with tube sterile , test tube holder , test tube stand (aluminum) 10x10 holes for 12mm diameter test tube , test tube stand 10x10 holesfor 18mm diameter test tube , test tube stand 10x10 holes for 12mm diameter test tube , test tube stand, polypropylene, 3 tier(for keeping 10 ml vtm vials/ tier) , urine container size of the container shall be 30ml disposable , utility gloves(medium) , atcc strain & antisera , acinetobacter baumannii nctc 13304 , enterococcus faecalis atcc 29212 , klebsiella pneumoniae atcc 700603 , pseudomonas aeruginosa atcc 27853 , staphylococcus aureus 25923 , escheriachia coli 25922 , staphylococcus aureus atcc43300 (mrsa) , shigella boydii polyvalent c antisera , shigella dysentriae polyvalent a antisera , shigella flexneri polyvalent b antisera , shigella sonnei polyvalent d antisera , vibrio cholera o1(ogawa)antisera , vibrio cholera o1( inaba)antisera , vibrio cholera (o139 )antisera , salmonella typhi poly o antisera , salmonella typhi o 2 antisera , salmonella typhi o 7 antisera , salmonella typhi o 9 antisera , rt pcr kits, chemical & consumable , 0.2 ml pcr tube (sterile, flat cap shaped) dnase/rnase free , 15 ml polypropylene centrifuge tubes, sterile, {certified nonpyrogenic and dnase /rnase free, disposable conical bottom with seal caps(the tubes should have printed graduations and a large white marking spots)} , alcohol 70% (laboratory grade) , bio medical waste bins red (15 ltr) , bio medical waste bins red (25 ltr) , bio medical waste bins red (40 ltr) , bio medical waste bins yellow (15 ltr) , bio medical waste bins yellow (25 ltr) , bio medical waste bins yellow (40 ltr) , bmw polybags red colour (18 kg capacity) , bmw polybags red colour (28 kg capacity) , bmw polybags red colour(45 kg capacity) , bmw polybags red colour (05 kg capacity) , bmw polybags yellow colour (18 kg capacity) , bmw polybags yellow colour (28 kg capacity) , bmw polybags yellow colour (45 kg capacity) , cryotags / freezer labels, for 1.5 2.0 ml cryovials {ability to withstand cryogenic temperatures upto minus 80 degree c for a wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates} , diluent for dna extraction/ ethanol, molecular(biology grade) , filter barrier tips 20 ul (in box packing, sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 10 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 1000 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , filter barriertips 200 ul (sterile dnase rnase pyrogenfree compatible with nichipet ex2 pipette (make nichiriyo)) , micro centrifuge tube 0.5 ml (polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 1.5 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro centrifuge tube 2 ml(polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes,(autoclavable, dnase, rnase/endotoxin free)) , micro pipette tips 5 300ul , microcentrifuge tube rack (20 tube/24 tube capacity)(for 1.5/2ml tube) , microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other( side with 0.2 ml pcr tubes) , non latex purple nitrile gloves (large) (sterile dnase rnase pyrogenfree ) , non latex purple nitrile gloves (medium) (sterile dnase rnase pyrogenfree ) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , optical adhesive covers for pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , parafilm roll (size approx 2 inch width and 250 inch length) , pcr 96 well rxn plates 0.2ml (compatible with biorad cfx 97 dx opm) , pcr 96 well rxn plates 0.2ml (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.1 ml (strip of 4) (compatible with qiagen 5plex rotorgene rt pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with thermo fisher a28574 quant studiort pcr machine) , pcr strips 0.2 ml with attached cap (strip of 8) (compatible with biorad cfx 97 dx opm) , rnase/ dnase away solution (for complete removal of rnase/ dnase contamination from work surfaces, pipettes and equipments(should be stable at room temperature)) , sterile pasteurppipettes 3ml , viral transport media with swabs (3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab (1.viral transport medium (vtm) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts)) , aluminium foil (9 meters length) thickness 11 microns, width 30 cm , compertable with transasia xl 1000fully automated biochemistry analyser , erba ada kit (1x20 ml/1x10 ml) , erbaalbumin kit (10x44 ml) , erba alakaline phosphatase kit (2x44 ml /2x11 ml) , erba amylase kit (3x22 ml) , erba autowash kit (10x100 ml) , erba bilirubin total (btdca) kit (6x44 ml /3x22 ml) , erba bilirubin direct (btdca) kit (6x44 ml /3x22 ml) , erba calcium (arsenazo) kit (10x12 ml) , erba cholestrol kit (10x44 ml) , erba ck nac kit (2x44 ml /2x11 ml) , erba ck mb kit (2x44 ml /2x11 ml) , erba direct hdl cholestrol with calibrator kit (4x30ml/4x10ml) , erba direct ldl cholestrol with calibrator kit (2x30//2x10 ml) , erbacreatinine (enzymetic) kit (5x30 ml/5x10 ml) , erba gamma gt kit (5x44ml/5x11 ml ) , erba glucose kit (10x44 ml) , erba fe 125 kit (r1 4x25 ml/r2 2x12.5 ml/calibrator/2x2ml) , erba hba1c kit (r1.2x15 ml/r2 2x5 ml/5x0.5 ml) , erba ldh p kit (2x44 ml /2x11 ml) , erba lipase xl kit (1x44 ml/1x11 ml) , erba magnesium kit (2x44 ml) , erba mal kit (1x10/5x25 ml) , erba microprotein kit (10x12 ml) , erba phosphorus kit (10x12 ml) , erba total protein kit (10x44 ml) , erba sgot el kit (6x44/3x22 ml) , erba sgpt el kit (6x44/3x22 ml) , erba triglycerides kit (5x44 ml/5x11ml) , erba urea kit (5x44 ml/5x11ml) , erba uibc125 kit (r1 4x25ml, r2 2x12.5ml, calibrator 2x12.5ml ) , erba uric acid kit (5x44 ml/5x11ml) , xl turbi crp kit (2x22 ml/1x11 ml) , xl turbi rf kit (1x22/1x5.5 ml) , erba ada cail kit (1x1ml) , erba ada control kit (1x1ml) , erba hba1c con h kit (1x.0.5ml) , erbahba1c con l kit (1x.0.5ml) , erba xl multical kit (4x3 ml) , erba norm kit (1x5ml) , erbapath kit (1x5ml) , apo a1 kit , apo b kit , hs crp kit , lp(a) kit , xl auto wash ac/al kit (5x44 ml /5x44 ml) , sample cups kit , sample cup vol: 1.0 ml unique type kit , thermal paper roll (108 mm x 3 m)kit , ise module reagent pack na+/k+/cl./li+(4 channel pack) kit , ise cleaning solution kit , compertable with transasia semi auto analyzer erba chem 5x , glucose kit , urea kit , creatinine kit , total bilirubin kit , total protein kit , albumin kit , total cholesterol kit , sgpt/alt kit , sgot/ast kit , ldh kit , ck mb kit , trop i kit (qualitative) , alp kit , triglycerides tg kit , hdl kit , disposable plastic test tube , clot activater tube (plan tube) , fluoride tube , micropipette tip1000ul , micropipette tip100ul , micropippte((0.5 50 ul)) , micropippte (100 1000ml) , external quality control vial for routine biochemistry (erba chem 5x) , protein csf kit , lamp. (erba chem 5x) , calcium (50x1 ml) , uric acid , ada , ark diagnosis electrolyte analyzer , electrolyte analyzer reagent , electrolyte daily cleaner , electrolyte quality control 1,2,3 (1 box ( serum: l1 3, l2 4, l3 3,urin: l1 1, l2 1)) , pm kit , reference housing , electrode (na,k,cl) , compertable with elisa reader (tecan infinite f50 & hydroflex) , t3 , t4 , tsh , sterilizer item compertable with cisa 8 stu model no. 6412 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , sterilizer item compertable withcisa 4 stu model no. 4212 , printer paper , door gasket , heating element , microbiological filter , print ink ribbon for washer , table topitem compertable with table top sterilizer 23 ltr , door gasket , microbiological filter , heating element , printer paper , washer kf 155item compertable with cisa washer 12 din , liquid alkaline detergent , liquid neutralising agent , lubrication spray , enzamatic detergent , cleaning indicator (level 1) , cleaning indicator (level 2) , cleaning indicator (level 3) , cleaning indicator (level 4) , print ink ribbon for washer , air filter (hepa) , heater element , gasket , ultrasonic washeritem compertable with cisa ultrasonic washer 30 ltr , cleaning agent for ultrasonic cleaner , heat sealeritem compertable with cisa heat sealer , print ink ribbon for heat sealer ( pack of 10 ) , consumables for operation for cssd equipmentitem compatible with cisa cssd machines , 3 line label steam , bowie dick strip , batch monitoring strip , chemical indicator class 4 , chemical indicator class 5 , biological indication steam , wrapping paper 40x40 cm , wrapping paper 50x50 cm , wrapping paper 60x60 cm , wrapping paper 75x75 cm , wrapping paper 90x90 cm , wrapping paper 100x100 cm , wrapping paper 120x120 cm , sterilization reel 50x200m , sterilization reel 75x200m , sterilization reel 100x200m , sterilization reel 120x200m , sterilization reel 150x200m , sterilization reel 200x200m , sterilization reel 250x200m , sterilization reel 300x300m , sterilization reel 350x200m , sterilization reel 400x200m , sterilization reel 500x200m , autoclave tape ( 18x50 meter ) , autoclave tape ( 24x50 meter ) , packing tape (18x50 meter) , packing tape (24x50 meter) , packing tape (36x50 meter) , packing tape (48x50 meter) , process indicator ( external labeling ) for every pack , sms paper non woven material(90 x90 mm) , sms paper non woven material (100 x100 mm) , sms paper non woven material (100 x120 mm) , sms paper non woven material (120 x 120 mm) , labelling ink role , ro plant consumables for cssd , anti scaling chemical , cip chemical , chemical for flushing , jumbo catridge filter , r.o. membrane 8040 , water softener consumables for cssd , resin , air compressor consumables for cssd , check valve kit , intake filter element , crankase filter element with felet , grease kit , piston ring set , filter , operational consumables for cssd compertable , apron heavy duty water proof , brushes for instrument cleaner , devices for cssd , pcd device for bms test , pcd device for bds test , gun for labeling , aqua zero vacuum pump (devices for cssd 8 stu) , aqua zero vacuum pump (devices for cssd 6 stu) , aqua zero vacuum pump (devices for cssd 4 stu)...

Home Department - Madhya Pradesh

35330880 bids are invited for multiple chemicals 1 / 25 2 mercaptoethanol , molecular biology grade, dnase, rnase and protease free , 2 propanol, molecular biology grade, dnase, rnase and protease free , sodium hypochlorite acs grade , agarose for nucleic acid electrophoresis , boric acid, molecular biology grade , acetone, molecular biology grade , buffer capsule, ph , dimethyl sulphoxide dmso molecular biology grade, dnase, rnase and protease free , dl dtt, molecular biology grade , dna zap pcr dna degradation solution , diluent for dna extraction ethanol molecular biology grade, dnase, rnase and protease free , ethidium bromide, molecular biology grade , fta purification reagent , acetic acid, molecular biology grade, dnase, rnase and protease free , glycerol, molecular biology grade, dnase, rnase and protease free , hematein, molecular biology grade , humic acid, molecular biology grade , hydrochloric acid , molecular biology grade, dnase, rnase and protease free , magnesium chloride anhydrous, molecular biology grade , phosphate buffer saline ph7.4, molecular biology grade , potassium chloride, molecular biology grade, dnase, rnase and protease free , sodium acetate anhydrous, molecular biology grade, dnase, rnase and protease free , sodium chloride, molecular biology grade, dnase, rnase and protease free , sodium hydroxide, molecular biology grade, dnase, rnase and protease free , sucrose , molecular biology grade , tannic acid powder, acs grade , tris base, molecular biology grade dnase, rnase and protease free , tween 20, molecular biology grade , xylene, molecular biology grade , sarcosyl, molecular biology grade, dnase, rnase and protease free , hand disinfectant rub with ethyl alcohol, skin softner and moisturizer , surface sanitizer with benzalkonium chloride and isopropyl alcohol , labolene phosphate free , bovine serum albumin, molecular biology grade , indigo carmine , isoamyl alcohol, molecular biology grade , dna ladder, 100bp to 3000bp, ready to use premixed with loading buffer. , 6x gel loading buffer for dna gels with two tracking dyes total quantity : 143...

Home Department - Madhya Pradesh

35255419 bids are invited for multiple chemicals 1 / 25 2 mercaptoethanol , molecular biology grade, dnase, rnase and protease free , 2 propanol, molecular biology grade, dnase, rnase and protease free , sodium hypochlorite acs grade , agarose for nucleic acid electrophoresis , boric acid, molecular biology grade , acetone, molecular biology grade , buffer capsule, ph , dimethyl sulphoxide dmso molecular biology grade, dnase, rnase and protease free , dl dtt, molecular biology grade , dna zap pcr dna degradation solution , diluent for dna extraction ethanol molecular biology grade, dnase, rnase and protease free , ethidium bromide, molecular biology grade , fta purification reagent , acetic acid, molecular biology grade, dnase, rnase and protease free , glycerol, molecular biology grade, dnase, rnase and protease free , hematein, molecular biology grade , humic acid, molecular biology grade , hydrochloric acid , molecular biology grade, dnase, rnase and protease free , magnesium chloride anhydrous, molecular biology grade , phosphate buffer saline ph7.4, molecular biology grade , potassium chloride, molecular biology grade, dnase, rnase and protease free , sodium acetate anhydrous, molecular biology grade, dnase, rnase and protease free , sodium chloride, molecular biology grade, dnase, rnase and protease free , sodium hydroxide, molecular biology grade, dnase, rnase and protease free , sucrose , molecular biology grade , tannic acid powder, acs grade , tris base, molecular biology grade dnase, rnase and protease free , tween 20, molecular biology grade , xylene, molecular biology grade , sarcosyl, molecular biology grade, dnase, rnase and protease free , hand disinfectant rub with ethyl alcohol, skin softner and moisturizer , surface sanitizer with benzalkonium chloride and isopropyl alcohol , labolene phosphate free , bovine serum albumin, molecular biology grade , indigo carmine , isoamyl alcohol, molecular biology grade , dna ladder, 100bp to 3000bp, ready to use premixed with loading buffer. , 6x gel loading buffer for dna gels with two tracking dyes total quantity : 143...

Directorate Of Health Services - Madhya Pradesh

35141987 supply of medicines and consumables the year 2022 23 1.01 5 fluorouracil ( 5 fu ) ( 250mg ) , injection 1.02 acenocoumarol / nicoumalone ( 2 mg ) , tablet [ 120003 ] 1.03 adrenochrome monosemicarbazone ( 0.75mg / ml ( ml amp ) ) , injection 1.04 aggs ( anti gas gangrene serum ) 10, 000 iu / ml 40000 iu / ml / 30000 ou / ml inj. 1.05 alpha beta arteether ( 150mg / 2ml ) , injection 1.06 alprazolam ( 0.5mg ) , tablet 1.07 amikacin ( 250mg / 2ml ) , injection 1.08 amino acid glass bottle contain amino acid 6 gm, nitrogen 0.929, essential amino acid 51%, non essential amino acid 49%, bcca 22.6%, carbohydrate 5% inj ( 6 gm ) , injection solution for 1.09 aminoacid 10% ( essential ) ivf ( 10 % ) , injection solution 1.1 aminoacid 5% ivf ( 100ml bottle ) , infusion 1.11 amiodarone tab ( 200mg ) , tablet 1.12 amlodipin ( 10mg ) , tablet ] 1.13 amoxicillin 250mg + clavulanic acid 50mg inj vial 1.14 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet 1.15 amoxycilline and clavulanic acid inj 1.16 ampicillin ( 1 gm vial ) , injection 1.17 ampicillin inj ( 250 mg / vial ) , vial 1.18 antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp 1.19 anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for 1.2 artemether inj 80mg / ml ( 1 ml amp ) , injection 1.21 artesunate + sulphadoxine + pyrimethamine ip ( 100 mg ( 3tab ) + 750mg + 37.5mg ( 1tab ) ( age group between 5 to 8 years ) ) , combi blister pack 1.22 artesunate tablets 150mg ( 3tab ) + sulphadoxine ( 500mg+500mg ) pyrimethamine 25mg +25mg tab ip ( 2tab ) ( age group 9 to 14 years ) , combi blister pack 1.23 artesunate tablets 25mg ( 3tab ) + sulphadoxine 125mg pyrimethamine 6.25mg tablets ip ( 1tab ) ( age group of less than 1year ) , combi blister pack 1.24 artesunate + sulphadoxine + pyrimethamine ( 50 mg + 500 mg + 25 mg tablet ) , combi blister pack 1.25 aspirin low dose tab 150mg 1.26 atorvastatin ip ( 20 mg ) , tablet 1.27 azathioprine 50mg tab 1.28 azithromycin inj 100mg / 5ml 1.29 basal insulin glargine injection 300iu disposable pen 300iu with 4 needles per pen 31g needle ( ) , pen 1.3 basal insulin glargine penfill 300iu with free permanent pens one pen for each five cartridge and 10 needles per pen 1.31 beclomethasone inhalation i.p 200 mcg per dose ( 200 metered dose container ) , inhaler 1.32 benedicts solution ( qualitative ) , bottle 1.33 benzyl benzoate emulsion ( ) , emulsion 1.34 benzyl penicillin 10lac / vial ( penicillin g ) , injection 1.35 betahistine ( 16 mg ) , tablet 1.36 betamethasone valerate cream 0.05% ( 15gm tube ) , ointment 1.37 betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment 1.38 betamethasone valerate oint / cream ip ( 0.12% ) , tube 1.39 bevacizumab100 mg ( 4 ml vial ) , injection 1.4 black disinfectant fluid ( phenyl ) as per schedule o grade iii 1.41 black disinfectant fluid ( phenyl ) strength : specification as per schedule o grade i 1.42 bortezomib ( 2mg ) , injection 1.43 bortezomib ( 3.5mg vial ) , injection 1.44 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup 1.45 budesonide nebulising suspension containing budesonide 0.25mg / ml ( 2ml amp ) , suspension 1.46 budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler 1.47 bupivacaine hydrochloride inj. 0.25mg ( 20 ml vial ) , injection solution for 1.48 bupivacaine hydrochloride inj. 0.5% 20ml vial ( not for spinal use ) ( ) , vial 1.49 bupivacaine hydrochloride ( not for spinal use ) ( 0.5% ) ( 4ml amp / vial ) , vial 1.5 calcium carbonate derived from oyester shell equivalent to elemental calcium 500mg and vitamin d3 250 iu ( ) , tablet 1.51 calcium chloride 0.1 ( 10 ml ) , injection 1.52 calcium citrate 1000mg ( elemental ca equivalent to 250 mg and vitamin d3 400 iu ) ( ) , tablet 1.53 calcium with vitamin d tablets calcium carbonate 650mg eq. to elemental calcium 250mg and cholecalciferol 125 iu 1.54 carbamazepine tab ( 400mg ) , tablet 1.55 carboplatin ( 150mg 15 ml vial ) , injection 1.56 carboprost trome thamine inj usp 0.25mg / ml vial ( ) , injection solution for 1.57 carboprost tromethamine injection i.p ( 15 methyl pgf2a ) inj 250mcg / 1ml ) , ampule 1.58 carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop 1.59 carvedilol ( 3.125 mg ) , tablet 1.6 carvedilol ( 6.25 mg ) , tablet 1.61 cefazolin ( 1gm ) , injection 1.62 cefazolin inj ( 500mg vial ) , injection 1.63 cefepime 1gm and tazobactam 125 mg inj ( vial ) , injection solution for 1.64 cefepime ( 500mg injection ) , injection 1.65 cefixime 50 mg dt tab ( ) , tablet 1.66 cefixime tab ip ( 100mg ) , tablet 1.67 cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection 1.68 cefoperazone 500mg + sulbactam 500mg ( vial ) , injection 1.69 ceftazidime ( 250mg / vial ) , injection 1.7 ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection 1.71 ceftriaxone+tazobactum 250mg+31.25mg ( vial ) , injection 1.72 ceftriaxone+tazobactum ( 500mg+62.5mg vial ) , injection 1.73 cephalexine ( 500mg ) , capsule 1.74 cetrimide + chlorhexidine ( conc. ) ( 15%+7.5% ) ( 1 liter bottle ) ( 15%+7.5% ) , liquid [ 1.75 cetrimide + choline salicylate gel for oral ulcer 15ml tube 1.76 cetrimide cream bp ( 0.1% w / w ) , tube 1.77 chloramphenicol ear drop 5% ( 5 ml vial ) , eye drop 1.78 chloramphenicol eye applicaps 1% ( 100 applicaps per bottle ) , eye drops / ointment 1.79 chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop 1.8 chlorhexidine 0.2% mouth gargle ( 100 ml ) , solution 1.81 chlorhexidine gluconate solution [ 1.82 chlorhexidine gluconate solution 4% i.p. ( antiseptic ) ( 500 ml bottle ) , liquid 1.83 chlorine based compound ( sodium dicholoroiso cyanurate ) nadcc tablets 75 mg with available chloroine 45 mg bis ( 45 mg ) , tablet 1.84 chloroquine phosphate inj. 64.5mg / ml 30ml vial ( ) , injection solution for 1.85 chloroquine ( phosphate ) , syrup 1.86 chlorpheniramine maleate ( 4mg ) , tablet 1.87 chlorpromazine hydrochloride sugar coated tab ( 100 mg ) , tablet 1.88 chlorpromazine hydrochloride ( 25 mg ) , tablet 1.89 chlorpromazine hydrochloride ( 50 mg tab ) , tablet 1.9 chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for 1.91 cholecalciferol concentrate ( powder form ) ph.eur. 60000iu / gm ( 60000iu / gm ) , powder 1.92 ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop 1.93 ciprofloxacin + tinidazole ( 500mg+600mg ) , tablet 1.94 ciprofloxacin 0.3% ( 5ml vial ) , eye drop 1.95 ciprofloxacin inj 2 mg / ml inj 100ml glass bottle ( ) , injection solution for 1.96 ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) , injection solution for 1.97 cisplatin ( 10 mg vial ) , injection 1.98 cisplatin 50 mg inj ( 50 ml vial ) , injection solution for 1.99 clindamycin ( 150mg / ml ( 2 ml vial / amp ) ) , injection 2 clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream 2.01 clomiphene citrate ( 25 mg tab ) , tablet 2.02 clonazepam ( 2mg ) , tablet 2.03 clopidogrel + aspirin ( 150mg ) , capsule 2.04 clopidogrel 75mg + aspirin 75mg tab ( 10x10 ) , tablet 2.05 clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial 2.06 clotrimazole cream 1% ( 15 gm tube ) , cream 2.07 clotrimazole vaginal pessary tab 100mg 14 x 10 tab 2.08 clotrimazole vaginal tablet i.p. 100mg ( without applicator ) , tablet 2.09 cloxacillin sodium inj. ( 500mg ) , vial 2.1 compound benzoic acid ointment 2.11 compound tincture benzoin ip ( solution ) , bottle 2.12 cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) ( 5 ml ) , syrup 2.13 cyclophosphamide ( 1000mg vial ) , injectio 2.14 cyclophosphamide inj 500mg / vial ( each ) , injection solution for 2.15 cyclophosphamide inj ( 200 mg / vial ) , injection 2.16 dacarbazine ( 200 mg per vial ) , injection 2.17 deferasirox dispersible ( 100mg ) , tablet 2.18 deferasirox dispersible tab. 400mg 2.19 desferioxamine inj ( 0.5g / vial ) , injection solution 2.2 dextromethorphan syrup ( each 5ml contains 30 mg dextromethorphan ) ( ) , syrup 2.21 dextromethorphan syrup ( ) , syrup 2.22 dextrose 10% 500ml bfs bottle ( ) , injection solution 2.23 dextrose 10% ( ffs / bfs 500ml bottle ) , infusion 2.24 dextrose 25% inj ( 100ml ffs / bfs bottle ) , injection solution 2.25 dextrose 25% inj 500ml bfs bottle ( ) , injection solution for 2.26 dextrose 25% inj 500ml ffs / bfs bottle ( ) , injection solution 2.27 dextrose 5% 500ml bfs bottle ( ) , injection 2.28 dextrose 50% inj 100ml ffs / bfs bottle ( dextrose 50% inj 100ml ffs / bfs bottle ) , injection solution 2.29 dextrose 50% inj. bottle ( 500ml ffs / bfs ) , injection solution 2.3 dextrose with saline 5% + 0.9% inj 500ml bfs bottle 2.31 dextrose with saline 5% + 0.9% inj 500ml ffs / bfs bottle 2.32 diclofenac sodium 50mg + paracetamol ( 325mg ) , tablet 2.33 dicyclomine 10mg / ml ( 10ml with dropper ) , drop 2.34 digoxin 250mcg / ml ( 2ml amp ) , injection 2.35 dilitiazem tab 60mg 2.36 dispersible zinc tab ( 10mg ) , tablet 2.37 dobutamine ( 50 mg / 5 ml ) , injection 2.38 docetaxel 20mg inj 2.39 docetaxel 80mg inj 2.4 domperidone suspension ( 5mg / 5ml ) , suspension 2.41 doxorubicin inj 10mg ( 10mg ) , injection solution 2.42 doxycycline tab. 100mg ( ) , tablet 2.43 doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet 2.44 electrolyte e inj 500ml ffs / bfs bottle ( electrolyte e inj 500ml ffs / bfs bottle ) , injection solution 2.45 electrolyte g inj 500ml bfs bottle ( ) , injection solution 2.46 electrolyte m inj 500ml bfs bottle ( ) , injection solution for 2.47 electrolyte m inj ( 500ml ffs bottle ) , injection solution for 2.48 electrolyte m inj 500ml ffs / bfs bottle ( ) , injection solution 2.49 electrolyte p inj 500ml bfs bottle ( 500ml bfs bottle ) , injection solution 2.5 electrolyte p inj ( 500ml ffs bottle ) , injection solution 2.51 electrolyte p inj 500ml ffs / bfs bottle ( ) , injection solution 2.52 enalapril maleate tab ( 2.5mg ) , tablet 2.53 enalapril maleate tab ( 5mg ) , tablet 2.54 enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection 2.55 enoxaparin ( 20mg / 0.2ml ) ( 0.2 ml prefilled syringe ) , injection 2.56 epinephrine hydrochloride inj. 1 mg / ml ( ) , injection solution for 2.57 epirubicin ( 10mg vial ) , injection 2.58 epirubicin ( 50mg vial ) , injection 2.59 equine anti rabies immunoglobulin, ( not less than 300iu / ml ) , injection 2.6 erythromycin stearate tab 250 mg 2.61 erythromycin stearate ( 500 mg ) , tablet 2.62 erythropoietin ( 4000 iu inj vial ) , injection 2.63 ethinyl estriadiol+norethisterone tab ( 35 mcg +1mg ) , tablet 2.64 etiophylline and theophylline ( paediatric ) , syrup 2.65 etiophylline theophylline sr tab. 300mg ( ) , tablet 2.66 etoposide ( 100mg vial ) , injection 2.67 filgrastim 300mcg inj 2.68 formaldehyde ( formalin ) ( 37% acq ) , bottle 2.69 formoterol + budesonide ( 6 mcg + 100 mcg / puff ( 120 mdi ) ) , inhaler 2.7 furazolidone ( 25mg / 5ml ( 60 ml bottle ) ) , suspension 2.71 gatifloxacin ( 0.3% ) , eye drop 2.72 gemcitabine ( 1000mg vial ) , injection 2.73 gemcitabine ( 200mg / vial ) , injection 2.74 gentian violet crys sol 1% 2.75 glibenclamide tab 2.5 mg 2.76 gluteraldehyde solution b.p. ( b.p. ) , solution 2.77 glycerine ip solution ( who gmp certification exempted for this item ) ( 100 ml ) , bottle 2.78 glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for 2.79 griseofulvin tab. ip 125 mg 2.8 haloperidol inj ( 50mg / ml ) , injection [ 2.81 haloperidol ( 10mg ) , tablet 2.82 heparin inj ( 5000iu / ml 5ml vial ) , injection 2.83 hepatitis b immunoglobulin im inj 200 iu / vial 2.84 human albumin 20% ( 50 ml vial ) 2.85 human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution 2.86 human anti d. immunoglobulin ( polyclonal ) bp / ep / usp / ip ( 300mcg / vial ( vial / pfs ) ) , injection 2.87 human chorionic gonadotropin inj ( 5000 iu 1ml ) , ampule 2.88 hydroethylstarch 6% solution with sodium chloride 0.9% iv infusion ( hydroxy ethylstarch solution ffs / bfs ) ( 0.9% iv ) , bottle 2.89 hydroxyprogesterone caproate inj i.p. 250mg / ml 2.9 hyoscine butylbromide ( 10mg ) , tablet 2.91 ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet 2.92 ifosphamide 1gm lyophilised each vial + 3amp of mesna 100mg / 2ml inj ( 100mg / 2ml inj ) , injection solution for 2.93 insulin aspart in disposable pen 300iu with minimum 4 needles per pen 31g needle 2.94 insulin aspart penfill 300 iu with free permanent pen ( one pen per five cartridges and ten needles per pen ) 2.95 insulin human mixtard inj. 30:70 ( ) , injection solution for 2.96 insulin lispro in disposable pen 300iu with minimum 4 needles per pen 31g needle 300iu ( prefilled syringe ) , pens 2.97 ipratropium bromide + levosalbutamol ( 20mcg+50mcg, 200 mdi ) , inhaler 2.98 ipratropium bromide powder for inhalation 250mcg / ml [ 4330004 ] 2.99 irinotecan ( 40mg / vial ) , injection 3 iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ( iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ) , tablet 3.01 iron and folic acid entric coated tab dessicated ip 67mg equivalent to 20mg of elmental iron 3.02 iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet 3.03 isoflurane solution ( liquid for inhalation ) 100ml ( amber color bottle ) , bottle 3.04 isosorbide mononitrate ( 20mg ) , tablet 3.05 isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for 3.06 ivermectin usp ( 6mg ) , tablet 3.07 ketoconazole ointment 2% 15gm tube ( 15 gm ) , ointment 3.08 ketoconazole tab 3.09 lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet [ 3.1 lactulose solution ( 3.35gm / 5 ml ) , solution 3.11 l asparaginase 5000 iu lyophilized ( vial ) , injection 3.12 levocetirizine tab 5mg ( ) , tablet 3.13 levodopa +carbidopa tab 250mg + 25m 3.14 levofloxacin 500mg inj 100ml ffs / bfs bottle ( ) , injection solution 3.15 levonorgestrel emergency contraceptive ( 0.75mg ) , tablet 3.16 lidocaine 2% inj. 30 ml vial ( 30 ml ) , injection solution 3.17 lignocaine hydrochloride ( 4% ( 5 ml vial ) ) , eye drops / ointment 3.18 lignocaine hydrochloride topical solution usp ( 2% ) , vial 3.19 linezolid 200mg / 100ml ( 100ml ffs bottle ) , injection 3.2 liquid paraffin ( 500 ml, bottle ) , solution 3.21 lmwh low molecular weight heparin inj 4000iu / ml. ( ) , injection solution for 3.22 lmwh low molecular weight heparin inj. 6000_x000d_iu / ml ( ) , injection solution for 3.23 lorazepam ( 2 mg ) , tablet 3.24 losartan ( 50 mg ) , tablet 3.25 lysol ( 5ltr jar ) , solution 3.26 magnesium hydroxide and aluminium hydroxide simethecon ( 500mg + 250 mg ) , tablet 3.27 magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection 3.28 magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule 3.29 mannitol inj, 10% 100 ml bottle ( ) , injection solution 3.3 mannitol inj, 20% 350ml bfs / ffs bottle ( ) , injection solution 3.31 mannitol inj. 10% 350ml bottle ( ) , injection solution for 3.32 mannitol injection i.p. 20% 100ml bottle ( ) , injection solution 3.33 mebendazole ( 100 mg tab ) , tablet 3.34 mefloquine tab ( 250mg ) , tablet 3.35 menadione usp ( vitamin k3 ) ( 10 mg / ml ( 1 ml amp ) ) , injection 3.36 mephentermine inj 15mg / ml 10ml vial 3.37 methotrexate ( 10 mg ) , tablet 3.38 methotrexate 2.5 mg tab 3.39 methotrexate inj 15mg / ml ( vial ) 3.4 methotrexate inj 500mg vial 3.41 methotrexate inj ( 2ml ) ( 50mg ) , injection solution for 3.42 methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vail 3.43 methyl prednisolone sodium succinate inj.usp ( 40mg / ml vial ) , injection 3.44 methyl prednisolone sodium succinate inj. usp 500mg 3.45 methyl prednisolone sodium succinate tablet 8 mg 3.46 metoprolol inj 1 mg / ml ( 5ml vial ) , injection 3.47 metronidazole benzoate oral suspension ( 100mg of base / 5 ml ( 60ml bottle ) ) , suspension 3.48 metronidazole 500mg ( 100 ml ffs bfs bottle ) , injection 3.49 metronidazole tab ( 200 mg ) , tablet 3.5 micronised progestron inj. 200mg / m 3.51 milk of magnesia 11.25 ml, liquid paraffin 3.75ml phenolphthalein 50mg / 15ml ( cremaffin pink formula ) 170ml syr 3.52 milk of magnesia 11.25ml+liquid paraffin 1.25ml / 5ml 170ml bottle 3.53 morphine sulphate inj. ip 15mg / ml ( 15mg / ml ) , injection solution 3.54 moxifloxacine eye drop 0.5%w / v 3.55 multivitamin drops ( approx 22 drops ) ( ) , drop 3.56 multivitamin sugar coated tab. ( nfi formula ) , tablet 3.57 n acetyl cysteine inj ( 200mg / ml in 1ml amp ) , injection 3.58 nitrofruantoin tablet ip 100m 3.59 noraderanaline inj. ( 2 mg base / 2 ml amp ) , injection solution 3.6 norethisterone ( 5mg ) , tablet 3.61 ofloxacin + ornidazole ( 200mg and 500mg ) , tablet 3.62 ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop [ 110332 ] 3.63 ofloxacin suspension [ 4670003 ] 3.64 ofloxacin suspension 50mg / 5 ml ( 30 ml bottle ) , suspension [ 120224 ] 3.65 olanzapine 20mg tab [ 4710506 ] 3.66 olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , eye drop [ 110337 ] 3.67 omeprazole 40mg ( vial ) , injection [ 120231 ] 3.68 omeprazole ( 20mg ) , capsule [ 120230 ] 3.69 ondansetron 8mg inj [ 4340019 ] 3.7 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder [ 4550004 ] 3.71 oxaliplatin ( 50mg inj 25 ml vial ) , injection [ 120239 ] 3.72 oxytocin ( 5 iu / ml ( 2ml amp ) ) , injection [ 4350048 ] 3.73 paclitaxel 260mg inj 43.4ml vial [ 4340016 ] 3.74 paclitaxel 300mg inj [ 4350372 ] 3.75 paclitaxel 30mg inj ( 30mg ) , injection solution for [ 4350305 ] 3.76 paclitaxel inj ( 100mg ) , injection 3.77 pantoprazole tab ( 40 mg ) , tablet 3.78 paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg ) , syrup 3.79 pentaprazole inj. 40mg 10ml vial ( ) , injection solution for [ 4350418 ] 3.8 pantaprazole ( 40mg tab ) , tablet 3.81 phenytoin sodium inj. ( 100 mg ) , vial 3.82 phenytoin sodium oral suspension 25 mg / ml ( 100 ml bottle suspension ( loan licencing will be accepted for this item. ) ) , suspension 3.83 pilocarpine eye drops ( 4% ) , eye drop 3.84 pilocarpine hydrochloride eye drops bp 2% 3.85 pioglitazone ( 30 mg ) , tablet 3.86 piroxicam ( 20mg ) , tablet or capsule 3.87 pneumococcal ( polysaccharide ) vaccine 23 valent / 0.5ml inj 3.88 potassium chloride inj. ( 150 mg / 10ml ) , injection solution for 3.89 potassium chloride inj. 150mg / ml 3.9 povidone iodine ointment 5% 250gm jar ( ) , each 3.91 povidone iodine surgical scrub solution. 7.5% ( 500 ml bottle ) , solution 3.92 pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection 3.93 prazosin tab ( 5 mg ) , tablet 3.94 prednisolone ( 10 mg ( dt also acceptable ) ) , tablet 3.95 prednisolone ( 10 mg / ml ) , eye drop 3.96 premixed insulin biphasic analogue 25 / 75 in penfill 300iu permanent pen one pen per five cartidges and ten needles per pen 3.97 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens one pen per five cartridges and ten needles per pen 3.98 promethazine inj 25 mg / ml ( 10 ml vail ) ( 10 ml vail ) , injection solution 3.99 promethazine tab ( 25 mg ) , tablet 4 propofol sodium 1%w / v ( 10mg / ml ( 20ml vial ) ) , injection 4.01 propranolol tab ( 40 mg ) , tablet [ 4.02 protamine sulphate inj 10mg / ml 4.03 quinine sulphate 150mg / 5ml syrup 60 ml 4.04 quinine sulphate inj. ( 300mg / ml ) , injection solution for 4.05 rabies vaccine inj ( vero cell culture ) inj. intra dermal ( ) , vial 4.06 rabies vaccine ip human ( ( cell culture ) ) , injection solution 4.07 rabies vaccine ip human cell culture 2.5 iu / dose ( intra muscular use ) , vial 4.08 rabies vaccine ip human ( purified chick embryo cell culture ) ( ) , vaccine 4.09 rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution 4.1 ramipril ( 5 mg ) , tablet 4.11 rectified spirit ( 90% ) solution 4.12 ringer lactate inj iv 500ml bfs bottle ( ) , injection solution 4.13 ringer lactate inj iv 500ml ffs / bfs bottle ( ) , injection solution f 4.14 rituximab ( 100mg ) , injection [ 120268 ] 4.15 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 4.16 snake venom anti serum ip liquid form ( ) , injection 4.17 snake venom anti serum inj. ( ) , injection solution for 4.18 sodium chloride 0.9% injection ip 100ml bottle ( ) , injection powder for 4.19 sodium chloride 1 / 2 normal, hyper tonic and dextrose 5% inj 4.2 sodium chloride inj iv 0.9% 500ml ( glass bottle ) ( ) , injection solution 4.21 sodium chloride inj iv 500ml bfs bottle ( ) , injection solution 4.22 sodium chloride inj iv 500ml bottle ( ) , injection solution 4.23 sodium chloride n / 2 injection ip 500ml bfs bottle ( ) , bottle 4.24 sodium chloride n / 2 injection ip 500ml ffs / bfs bottle ( ) , injection solution 4.25 sodium hypochlorite 5% solution ( 5 ltr ) , solution 4.26 sodium valproate enteric coated tab. bp ( 200 mg ) , table 4.27 sodium valproate ( 200mg ) , tablet 4.28 soluble insulin 30% isophane insulin 70% 100 iu inj 4.29 spironolactone tab 100mg ( 10x10 ) , tablet 4.3 streptokinase inj ( ) , injection solution 4.31 streptomycin inj ( 0.75g ) , injection solution for 4.32 succinyl choline inj. 50mg / ml 1ml amp 4.33 sulfacetamide eye drops ( 20% ) , eye drops / ointment 4.34 sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet 4.35 sulfamethoxazole 200mg and trimethoprim 40mg per 5ml suspension ( 50ml bottle ) , suspensio 4.36 sulphadoxine 500mg and pyrimethamine 25mg tab. 4.37 surfactant suspension ( for intratrcaheal ) natural surfactant inj ( 25 mg / ml ) , injection solution for 4.38 surfactant suspension ( intratrcaheal ) bovine 4ml amp natural inj ( ) , ampoule 4.39 surgical spirit bp 500 ml ( ) , bottle 4.4 syrup 100ml bottle. ( 5ml 100mg elemental fe iron & folic acid syrup ( as per the standards provided ) ( ) , syrup 4.41 tamoxifen ( 20mg ) , tablet 4.42 telmisatran ( 20 mg ) , tablet 4.43 temozolomide ( 100mg ) , capsule 4.44 temozolomide 20mg cap 4.45 temozolomide 250mg cap 4.46 terbutaline suplhate inj 4.47 terbutaline suplhate tab ( 2.5mg ) , tablet 4.48 tetanous vaccine adsorbed ip 5ml ( tetanus toxide inj ) 4.49 tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial 4.5 tetanus toxide inj 5ml ( ) , injection solution for 4.51 tetanus toxiod ( inj. ) , injection 4.52 tetracycline eye oint 1% 4.53 thyroxine sodium tab 100 mcg ( 100 tab bottle ) ( 100 tab ) , tablet 4.54 thyroxine sodium tab ( 50mcg ( 100 tab bottle ) ) , tablet 4.55 tinidazole ( 500mg ) , tablet 4.56 tobramycin ( 0.3% 5ml ) , eye drop 4.57 torsemide ( 10mg ) , tablet [ 4.58 torasemide tab ( 20mg ) , tablet 4.59 tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ( brand: oliclinomel n7 2000 ml ) 4.6 tramadol ( 100mg / ml ( 2 ml amp ) ) , injection 4.61 tramadol cap ip ( 50mg ) , capsule 4.62 tramadol ( 100mg ) , tablet 4.63 tranexamic acid inj. 125mg / ml amp 4.64 trastuzumab ( 440mg vial ) , injection 4.65 triamcinolone acetate 40mg / ml ( 1ml amp ) , injection 4.66 urograffin 76% solution for injection 20ml vial ( 20ml ) , injection solution for 4.67 urograffin 76% solution for injection 50ml vial bottle 4.68 urokinase ( 5 lac iu / vial inj ) , injection powder for 4.69 valethamate bromide 8mg / ml ( 1ml ) , injection 4.7 vancomycin hydrochloride ( 250mg vial ) , injection 4.71 verapamil sugar coated tab ip ( 40mg ) , tablet 4.72 vildagliptin tab ( 50 mg ) , tablet 4.73 vinblastine 10mg inj. 4.74 vincristine inj 1mg / ml 4.75 vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule ] 4.76 vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule 4.77 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet 4.78 vitamin k inj ( phytonadione inj ) 1mg / 0.5ml ( ) , injection solution for 4.79 vitamin k inj. 10 mg / ml ( 10 mg / ml ) , injection solution for 4.8 vitamin. b complex ( nfi ( prophylactic ) ) , tablet 4.81 vitamin b12 inj 500 mcg / ml ( 30 ml amp / vial ) , injection 4.82 voglibose dispersible 0.3mg tab 4.83 water for injection inj 10 ml amp 4.84 zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup ] 4.85 bcg diluent ( normal saline ) 1ml 4.86 bcg with vvm 10 doses 4.87 measles diluent ( sterile water ) 4.88 ad syringe ( 0.1 ml ) , vaccine 4.89 ad syringe ( 0.5 ml ) , vaccine 4.9 disposable syringe ( 5 ml ) , syrings 4.91 tt with vvm 10 doses [ 3790004 ] 4.92 absorbable gelatine sponge ( ip 80mm x 50mm x 10mm ) , consumable 4.93 absorbent cotton wool ip 500 grms ( each ) roll ( iso:13485:2016 ) , consumable 4.94 adhesive plasters usp 7.5 cm x 10 mts / roll 4.95 adhesive plasters usp ( 7.5 cm x 5 mts / roll ) , consumable 4.96 ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet 4.97 b.b silk with 1 / 2 cir rb needle ( size:3 / 0 20 mm length 75 cm ) , consumable 4.98 b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable 4.99 b.b. silk 6 reels x 25 mts ( size:3 / 0 length 25 mts ) , consumable 5 benzyl benzoate application i.p 25%w / w ( 100ml bottle ) , radiology 5.01 blood administrations set 5.02 ceftazidime injection i.p. ( 0.5gm / vial ) , injection 5.03 cholesterol kit end point enzymatic kit 50 test / kit 5.04 coated polyster braided with cd white d ( needle 25 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 ) , consumable 5.05 coated polyster with cd green needle 17 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 length 90cm 5.06 cpk mb kit ( kinetic ) ( 25 test / kit ) , consumable 5.07 disposable dust mask jl246c equivalent to n 95 mask 5.08 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 5.09 disposable needles ( is 10654:2002 22g ) , surgical material 5.1 disposable needles ( is 10654:2002 24g ) , surgical material 5.11 disposable needles ( is 10654:2002 26g x 1 / 2 ) , surgical material 5.12 disposable syringes is 10258:2002 ( with needle is 10654:2002 cgs 10cc ( in ribbon pack ) ) , surgical material 5.13 disposable syringes is 10258:2002 with needle is 10654:2002 ( cgs 2cc ( in ribbon pack ) ) , surgical material 5.14 disposable syringes is 10258 2002 with needle is 10654 2002 ( cgs 5cc in ribbon pack ) , surgical material 5.15 field stain a ( 500ml ) , digonstic 5.16 field stain b ( 500ml ) , consumable 5.17 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 5.18 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 5.19 foleys urinary catheter ( 3 way size 12 ) , surgical material 5.2 g6pd deficiency ( test kit 10 test ) , consumable 5.21 glass slide 75mm x 25mm 1.1 mm 5.22 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 5.23 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit [ 6120003 ] 5.24 infant feeding tube ( ( catheter ) size: 5g ) , consumable [ 6760003 ] 5.25 infant mucus extractor sterile pvc ( each ) , surgical material [ 6550018 ] 5.26 intravenous set with airway and needle ( ( adult ) ) , surgical material [ 6450089 ] 5.27 intravenous set with airway and needle ( children ) , surgical material [ 645090 ] 5.28 iv cannula ( two way ) ( size 20 ) , surgical material 5.29 iv cannula ( two way ) ( size 22 ) , surgical material 5.3 iv cannula size 24g with inj.valve ( port ) , surgical material 5.31 k wire length 375mm ( size:1.6mm roll ) , surgical material [ mis70 ] 5.32 k wire size:1mm 5.33 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab [ 6120089 ] 5.34 micro volume ( drip set ) , digonstic 5.35 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 30mm length 70 cm non absorbable ( surgical sutures usp size 1 ) , digonstic [ 6450117 ] 5.36 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 30 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.37 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 2 / 0 ( 12 foils / pkt ) , surgical material 5.38 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 13.5 ltr 5.39 pregnancy detection kit ce marked / isi marked 5.4 pregnancy detection kit ce marked / isi marked 30 test / kit ] 5.41 pyrethrum extract 2% ( 25 litre drum ) ( as per specification attached in tender ) , chemical 5.42 reuse prevention syringe sterile single use reuse prevention syringewith detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( 2ml ) , surgical material 5.43 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( preferred material thermoplastic elastomer ) ( 5ml ) , surgical material 5.44 disposable spinal ( l.p. ) needle ( 25g ) , surgical material 5.45 stainless steel wire 28g 5.46 stainless steel wire 30g 5.47 surgical blade, size 11 5.48 synthetic absorbable suture 1 with 1 / 2 circle taper cut needle ( h ) size :1 40mm length 90cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( 12 foils per pkt ) , surgical material 5.49 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 40mm length 90cm polyglycolic acid ( pga ) [ 6450024 ] synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0 20mm length 70cm polyglycolic acid ( pga ) [ 6450017 ] 5.51 synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0, 40mm length 90cm polyglycolic acid ( pga ) 5.52 synthetic absorbable suture 4 / 0 with 3 / 8 cir cutting needle size:4 / 0 16mm length 45 cm polyglycolic acid ( pga ) 5.53 three layer surgical mask 5.54 urinary drainage bag 2 litre cap with non return valve ( eo sterile ) 5.55 wbc diluting fluid ( 500 ml bottle ) , consumable [ mis144 ] 5.56 x ray film 10 x 12 50 sheets / pack 5.57 x ray film 12 x 12 50 sheets / pack 5.58 x ray film 14 x 14 50 sheets / pack 5.59 x ray film 14 x 17 50 sheets / pack x ray film 6.5 x 8.5 50 sheets / pack 5.61 x ray film 8 x 10 50 sheets / pack 5.62 ceftazidime inj ( 500mg / vial ) , injection 5.63 disposable sterile gloves isi marked surgical rubber hypoallergenic latex 100% powder free 7 1 / 2 inc 5.64 disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7inch / pair ( pair ) , consumable 5.65 ventilator adult model new port e 360 [ 360 ] 5.66 k wire length 375mm ( size:1.8mm roll ) , surgical material [ mis71 ] 5.67 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 25 mm length 70 cm non absorbable surgical sutures usp size 3 / 0 5.68 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 40 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.69 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 9.0 ltr [ 6521029 ] 5.7 tetanus toxoid ( adsorbed ) ip ( 5ml vial ) , injection 5.71 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 7 inches 5.72 x ray film 12 x 15 50 sheets / pack 5.73 foldable iol sterile lens + 18d ( usfda approved, as per specification ) ( each ) , consumable 5.74 foleys urinary catheter 3 way size 18 5.75 foleys urinary catheter 3 way size 20 5.76 foldable iol sterile lens + 18.5 d ( usfda approved, as per specification ) ( each ) , consumable 5.77 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 5.78 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 5.79 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) 5.8 reuse prevention syringe sterile with detachable needles complaint to iso ( 7886:4 typei and typeb 3ml ) , consumable 5.81 foldable iol sterile lens + 19d ( usfda approved, as per specification ) ( each ) , consumable 5.82 foldable iol sterile lens + 19.5d ( usfda approved, as per specification ) ( each ) , consumable 5.83 foldable iol sterile lens + 20d ( usfda approved, as per specification ) ( each ) , consumable 5.84 foldable iol sterile lens + 20.5d ( usfda approved, as per specification ) ( each ) , consumable 5.85 foldable iol sterile lens + 21d ( usfda approved, as per specification ) ( each ) , consumable 5.86 foldable iol sterile lens + 21.5d ( usfda approved, as per specification ) ( each ) , consumable 5.87 foldable iol sterile lens + 22d ( usfda approved, as per specification ) ( each ) , consumable 5.88 foldable iol sterile lens + 22.5d ( usfda approved, as per specification ) ( each ) , consumable 5.89 micro pipet 1000 fix and variable each 5.9 baby oxygen mask set of all sizes 5.91 catgut chromic size:2 / 0 length 150 cm 5.92 disposable syringes is 10258:2002 with ( needle is 10654:2002 20ml ) , consumable 5.93 endotracheal tube internal dia 5.5mm to 9.5mm 5.94 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 5.95 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine 5.96 sgot kit ( kinetic ) 5x20ml 200 test / kit 5.97 aciclovir 3% ( 5gm tube ) , ointment 5.98 acyclovir suspension 400mg / 5ml ( 100 ml bottle ) , suspension 5.99 aciclovir tab 400 mg ( 400 mg dt tablet also acceptable ) , tablet 6 amino infusions ( 200ml bottle ) , infusion 6.01 amitriptyline tab. ip ( 25 mg ) , tablet 6.02 ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection 6.03 anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection 6.04 ascorbic acid ( vitamin c ) tab. 500 mg. 6.05 atracurium besylate ( 10mg / ml inj amp ) , injection 6.06 botropase injection ( ( haemocoagulase 1cu ) 1ml ) , injection 6.07 oseltamivir h1 n1 antiviral cap 75 mg 6.08 clonidine injection, 10ml vial ( 1mg ) ( 10ml vial ) , injection 6.09 cyclophosphamide 50 mg tab 6.1 diphenhydramine syrup 12.5mg / ml 6.11 disposable cap 6.12 disposable ( needles 23g ) , consumable 6.13 disposable pricking lancet ( pkt of 200 units ) ( packet ) , consumable 6.14 enalapril maleate inj. ( 1.25 mg per ml ) , injection 6.15 ethamsylate inj ( 250mg ( 2ml amp ) ) , injection 6.16 ethamsylate tab ( 500mg ) , tablet 6.17 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , infusion 6.18 foleys urinary catheter size 16 2 way 6.19 foleys catheter size 18 2 way 6.2 glucose kit ( god / pod ) ( 350ml, digonstic ) , consumable [ mis60 ] 6.21 hcv kit card test ( 25 test / kit ) , digonstic 6.22 hydrocortisone sodium succinate inj. 200mg vial ( ) , injection 6.23 iv cannula size with inj.valve ( port ) ( 18g ) , consumable 6.24 ketamine hydrochloride inj. 50mg / ml ( 2 ml amp ) 6.25 meropenem inj 125mg / vial ( each ) , injection [ 6.26 inj.iv dns ( ) , injection 6.27 multivitamine 200ml syrup ( 200ml ) , syrup 6.28 n acetyl cysteine inj 200mg / ml in 10ml amp 6.29 nimesulide ( 100 mg ( dispersiable tablet also accepted ) ) , tablet 6.3 norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet 6.31 oxygen inhelation mddial oxygen steel aluminium cylinder 10 ltr ( ) , consumable 6.32 oxygen nasal cannula ( neonatal ) , consumable 6.33 paracetamol drop ( 100 mg / ml ) , drop 6.34 paracetamol drop 10mg / ml 6.35 phenobarbitone syp 200mg / 5ml ( ) , syrup 6.36 povidone iodine cream 250 gm 6.37 salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup 6.38 salicylic acid ointment ( 6% ) , ointment 6.39 salt testing kit ( as per attached specification , kit ) , consumable 6.4 mesalamine ( 5 aminosalicylic acid 400 mg ) tab 6.41 thiopentone injection 1gm 6.42 tobramycin + dexamethasone ( 0.3%w / v + 0.1%w / v ( 5ml vial ) ) , eye drop 6.43 torasemide inj 100mg ( 2ml vial / amp ) , injection 6.44 umblical cotton tape length 75cm. 6.45 verapamil 80mg ( tablet ) , tablet 6.46 foldable iol sterile lens +18d ( each ) , lens 6.47 microsurgery speciality gloves ( size 6.5 ) , lens 6.48 alchohol repellent and anti static sms fabric csection drape with 16in x 14in adhesive full incise, 270 degrees pe film fluid collection pouch with malleable band and suction port and sms arm board covers and tube holders 120in x 100in 50gsm 6.49 alchohol repellent and anti static sms fabric drape with absorbent material. fluid collection pouch with malleable band and suction port, having filter screen for sample collection and graduated markings on pouch 40 in x 44 in 50gsm 6.5 silver impregnated peripherally inserted central catheter 4 fr with integrated hub 6.51 non foldable iol sterile lens pc + 18.5 ( each ) , lens 6.52 non foldable iol sterile lens pc + 19 ( each ) , lens 6.53 non foldable iol sterile lens ( pc + 20.5 ) , lens 6.54 non foldable iol sterile lens pc + 20 6.55 non foldable iol sterile lens pc + 21.5 6.56 non foldable iol sterile lens pc + 21 ( each ) , lens 6.57 non foldable iol sterile lens pc + 22 ( each ) , lens 6.58 non foldable iol sterile lens pc + 23 6.59 non foldable iol sterile lens pc + 24 6.6 non foldable iol sterile lens ac + 20 6.61 non foldable iol sterile lens ac + 18 6.62 gefitinib tab 250mg 6.63 pancreatin 170 mg+oxbile extract 50 mg+ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) , tablet 6.64 paclitaxel 260mg inj ( 260mg ) , injection 6.65 filgrastim 300 mcg ( prefilled syrings ) , vial 6.66 dacarbazine inj. ( dtic ) ( 500 mg vial ) , injection 6.67 5 fluorouracil ( 5 fu ) ( 500mg inj ) , injection 6.68 paclitaxel protein bound particles inj 6.69 tamsulosin 4mg tab 6.7 nilotinib ( 200mg ) , tablet or capsule 6.71 nilotinib ( 150mg ) , tablet or capsule 6.72 oxytocin 10 iu / ml ( 1ml ampoule ) , injection 6.73 foleys urinary catheter 3 way size 16 6.74 chymotrypsin and trypsin 100000 iu tab 6.75 l ornithine +l aspartate 5mg inj ( 5mg ) , injection 6.76 quinine sulphate ( ip 600mg ) , tablet 6.77 personal protection kit ( kit ) , consumable 6.78 oseltamivir ( 45mg ) , capsule 6.79 oseltamivir h1 n1 antiviral cap 30 mg 6.8 chromic with st rb needle ( 12 foils / pkt ) ( 60 mm length 76 cm size:2 / 0 ) , consumable 6.81 dextrose 5% inj 500ml ffs / bfs bottle ( 500ml ) , bottle 6.82 acyclovir intervenous infusion i.p ( 500mg / vial ) , injection 6.83 propofol sodium ( 1% w / v 10mg / ml, 10ml vial ) , injection 6.84 digital x ray film 8x10 ( 150 films / pkt ) 6.85 digital x ray film 10x12 ( 150 films / pkt ) 6.86 digital x ray film 11x14 ( 150 films / pkt ) ( 11x14 ( 150 films / pkt ) ) , film 6.87 ecg paper ( chemical coated ) 50mm x 30 mtr. roll 6.88 plaster of paris bandage 15cm x 2.7mtr / roll ( roll ) , bandage ] 6.89 plaster of paris bandage bp 10 cm x 2.7 mtr / roll 6.9 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings 6.91 ecg jelly 250 gms ( bottle ) , jelly 6.92 ecg paper ( wax coated ) 50mm x 30 mtr, roll 6.93 nebulization mask kit ( adult ) , mask 6.94 oxygen mask adult ( standard size ) , mask 6.95 oxygen mask paediatric ( standard size ) , mask 6.96 ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll 6.97 mackintosh double colour water proof rubber marked isi hospital rubber sheeting is:4135 1974 packing and making : as per clause no 4.1 and 4.3 / mtr 6.98 instrument sterilant 10 minute sporicidal sterilant aldehyde free containing sodium perborate ( ( 810 grm packet ) ) , powder 6.99 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( ( 5kg packet ) ) , powder 7 b.b silk with 1 / 2 cir rb needle 20 mm length at least 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle 7.01 black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt 7.02 black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt 7.03 black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) 7.04 disposable needles ( 26g x 1 / 2 ) , consumable 7.05 halothane ( 200ml ) , bottle 7.06 erythromycin ( as estolate ) powder for susp ( 125 mg / 5ml 40ml bottle ) , consumable 7.07 potassium chloride oral solution 500mg / 10ml 7.08 cefixime syrup 50mg / 5ml ( 30 ml bottle ) , syrup 7.09 ferric ammonium citrate 200mg, folic acid 0.5mg ( bottle ) , syrup 7.1 multivitamin 10ml ( amp inj ) , injection 7.11 vecuronium bromide inj 4mg / ml amp ( 4mg / ml amp ) , solution [ 987609 ] 7.12 iron sucrose ( 20 mg ) , injection 7.13 clofazimine ( 50 mg ) , capsule 7.14 b complex minerals with zinc ( capsule ) , capsule 7.15 antioxident ( cap ) , capsule 7.16 vaseline white / yellow ( 1 / 2 kg ) , consumable 7.17 silver sulphadiazine cream 500gm 7.18 hydroxypropyl methylcellulose ophthalmic solution 2% ( 5ml vial ) , consumable 7.19 atracurium besylate usp inj injection 7.2 diphenhydramine inj 50mg / ml ( 50mg / ml ) , injection 7.21 dextran 70 injectable sol inj 500ml ( solution ) 7.22 hydrocortisone sodium succinate inj. 200 mg / vial ( 200 mg / via ) , injection 7.23 ofloxacin inj 2mg / 1ml ( 100ml ) , injection 7.24 meropenam 500mg inj 7.25 inj. meropenam 125mg ( 125mg ) , injection 7.26 meropenem ( 1gm ) , injection 7.27 phenobarbitone inj. 100 mg / ml 7.28 inj. heamocoagulase 1cu 1ml 7.29 diclofenac sodium injection, 3ml ( ) , injection 7.3 inj. b complex 30ml 7.31 inj. l ornithine l aspartate ( 10ml ) , injection 7.32 inj. diclofenac 30ml 7.33 drop iron ( 15ml ) , consumable 7.34 neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube 7.35 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream 7.36 diclofenac + menthol ( 30gm ) , tube 7.37 oint. gentamycin sulphate ( 15gm ) , ointment 7.38 nimesulide oint gel 20gm 7.39 heparin and benzyl nicotinate 20mg oint. 7.4 oxygen inhelation ( oxygen ip medical oxygen in steel or aluminium, cylinder ( 10 litres water cap ) ( 10 liters ) , consumable 7.41 powder protien +vitamins +corbohydrates & minerals 200gm ( 200gm ) , consumable 7.42 calcium syp 100ml syrup ( 240mg / 5 ml ) 7.43 multivitamin 200ml syrup 7.44 cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup 7.45 magnesium hdroxide+aluminium hydroxide ( 625mg+312mg / 5ml ) [ 987646 ] 7.46 dicyclomine syrup [ 987647 ] 7.47 vitamin b complex nfi formula ( 100ml bottle ) , syrup 7.48 syp. ferric ammonium citrate 200mg +folic acid 0.5mg+vitamin b 125mcg+zinc 5ml syrup 7.49 antacid mint flavour ( 170ml ) , syrup 7.5 drop paracetamol 100mg / 15ml 7.51 norfloxacin + tinidazole ( ( 100 mg + 100 mg ) / 5 ml 30ml syrup ) , syrup 7.52 norfloxacin +metronidazole 30ml syrup 7.53 ibuprofen 10mg+paracetamol 125mg syrup 7.54 ampicilline 125mg / 30ml syrup 7.55 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup 7.56 syp. cefodroxil 125mg / 30ml syrup 7.57 vitamin b complex nfi formula ( 200ml bottle ) , syrup 7.58 cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup 7.59 syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup 7.6 calcium gluconate syrup ( 200ml ) , syrup 7.61 amoxicillin dispersible ( 125 mg ) , tablet 7.62 dicyclomine 20mg tab 7.63 clonidine tablet ( 100 mcg ) , tablet 7.64 diphenhydramine ( 25mg ) , capsule 7.65 dexamethasone ( 4 mg ) , tablet 7.66 vitamin c tab 500 mg tablet 7.67 mesalamine ( 5 aminosalicylic acid ) ( usp 400mg ) , tablet 7.68 isoxsuprine tablets i.p. 20 mg tablet 7.69 anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet 7.7 pentoprazole 40mg, domperidone 10mg tab tablet 7.71 pentoprozole 40mg +domperidone 10mg tab 7.72 calcium citrate 500mg with vitamin d3 200mcg tablet 7.73 norfloxacine 400mg and tinidazole 600mg tab 7.74 losartan 50mg +hydroclorothiazide 12.5mg tablet 7.75 ethamsylate tablet ( 250mg ) , tablet 7.76 diclofenac 50mg +paracetamol 325mg+chlorzoxazone 500mg ( tab ) , tablet 7.77 ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet 7.78 azythromycin 1 gm + fluconazole 150 mg, + secnidazole 2 g, tablet c tablet 7.79 amlodipine 5mg+atenolol ( 50mg ) , tablet 7.8 iron & folic acid entric coated 100mg, of elemental iron ( adult ) +fa 1.5mg tab. 7.81 aceclofenac 100mg+paracetamol 500mg tab 7.82 dicyclomine 20mg+paracetamol 325mg tab 7.83 norfloxacin + tinidazole 400mg tab 7.84 norfloxacin +tinidazole 400mg tab 7.85 roxithromycin 150mg tablet 7.86 domperidone +ranitidine 150mg tab 7.87 povidone iodine cream 250gm 7.88 amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection 7.89 dexamethasone + gentamycin eye drop 0.1%+0.3% 7.9 prostaglandin e2 gel 0.5mg ( 3gm tube ) , tube 7.91 who hemoglobin color scale ( starter kit ) components ( 1 ) colour scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 10x100 ( nabl / cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered ) , consumable [ mis145 ] 7.92 strip for albumin urine and suger 7.93 glass slide 75mm x 25mm 1.35 mm 7.94 cover slip 18 x 18 mm 10gm 7.95 variable auto pippets 10 to 100 micro litres ( 10, 25, 50, 100 ) each 7.96 tips for auto pippetes 10 to 100 micro litres 7.97 glucometer strip ( 1x50 ) , consumable 7.98 urea kit berthelot ( 100 test / kit ) , consumable 7.99 acetone detection kit ( 100 gm ) , powder 8 crp test kit ( latex / card ) ( 25 test / kit ) 8.01 cyanemeth solution for hb ( 5 litre ) , consumable 8.02 leishman stain ( 500 ml bottle ) , consumable 8.03 hcl n / 10 ( 500 ml bottle ) 8.04 semen dilution fluid ( 100 ml bottle ) , consumable 8.05 gram iodine ( gram stain ) 125 ml 8.06 sodium citrate 3.8% ( 500 ml bottle ) , consumable 8.07 edta solutions k3 ( 500 ml ) 8.08 disposable cup for urine sputum 30ml 80 to 90 mm diameter 100 / pkt 8.09 disposable pricking lancet 100 units consumable 8.1 paper adhesive plaster 1 x 9.0mts 8.11 barium chloride 10% ( 500 ml bottle ) , consumable 8.12 sulfur powder 8.13 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup ( 10 ml ) , syrup 8.14 alkaline citrate with k oral solution ( 100ml ) , syrup 8.15 total protein lysozyme 1x50 ml 8.16 b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical sutures usp , 2 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical 8.17 b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material 8.18 bandage than ( 1mtrx20mtr ) , consumable 8.19 rolled bandage 15cm � 5 m 8.2 rolled bandage 10cm � 5m 8.21 rolled bandage 7.5cm � 5m 8.22 bandage clothes 01m � 20m consumable 8.23 cotton crape bandage 15cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.24 cotton crape bandage 10cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.25 rolled bandage 5cm � 5m 8.26 iv cannula ( two way ) ( size 24 ) , consumable 8.27 keratome 3.2 keratome round stock 3.2mm full handle knives e.t.o. sterile angled bevel up 45 deg ( ) , consumable 8.28 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 8.29 hiv 1&2 test cards 8.3 urine albumin & suger 8.31 dengue card test 100 test kit 8.32 typhoid test card ( an immunochromatography assay for the rapid visual detection of typhoid antibody igg / igm in human serum / plasma ) ( 50 test per pack ) , consumable 8.33 hiv kit 100 test / kit 8.34 sodium hypo chloride 5 lit jar 8.35 disposable paper gloves size 7 inches consumable 8.36 disposable paper gloves size 7, 1 / 2 inches consumable 8.37 usg thermal paper 8.38 orthopaedic speciality gloves ( size 7 ) , consumable 8.39 disposable appron consumable 8.4 cannula fixer ( set ) , consumable [ 987748 ] 8.41 cotton delivery belt 8.42 gauze swab / pad 6 layer 20 � 20 8.43 disposable sterile gloves size 6 inches consumable 8.44 disposable sterile gloves size 61 / 2 inches consumable 8.45 disposable sterile gloves size 7, 1 / 2 inches consumable 8.46 c.p.d.blood bag 350 ml consumable 8.47 fixer powder ( bromex acid fixer with hardner ) ( 22.5 ltr / pkt ) 8.48 bilirubin kit ( colorimeter semi auto ) ( 4x60 ml 480 test / kit ) , consumable 8.49 cholesterol kit end point enzymatic kit ( 5x20ml 200 test / kit ) , consumable 8.5 hdl kit ppt ( 2x50ml 200 test / kit ) , consumable 8.51 triglyceride kit enzymetic ( 5x20ml 200test / kit ) , consumable 8.52 creatinine calorimeter for semi auto kinetic 4x60ml 480test / kit 8.53 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 8.54 ra factor 50 test kit qualicative 8.55 chromic with cd.rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 ) , surgical material 8.56 chromic with 1 / 2 cir rb needle 30 mm length 76cm, 2 0 usp, absorbable surgical suture surgical material ( 12 foils / box ) , surgical material 8.57 chromic with 1 / 2 cir rb needle 20 mm length 76 cm, 3 0 usp, absorbable surgical suture surgical material 12foils / box 8.58 chromic with 1 / 2 cir rb needle size:1 / 0, 30 mm length 76cm absorbable surgical suture surgical material 8.59 chromic with 1 / 2 cir rb needle 40 mm length 76 cm ( with needle ) ) absorbable surgical sutures usp, ( size 1, 12 foils / pkt ) , surgical material 8.6 chromic with cd rb needle 30 mm length 76 cm size:2 / 0 ( absorbable surgical suture surgical usp, 12 foils / boxmaterial ) , surgical material 8.61 chromic with cd cutting needle 12 mm length 70cm size:3 / 0 8.62 chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length at least 150 cm ) , consumable 8.63 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 8.64 b.b silk with 1 / 2 cir rb needle size:2 / 0 30 mm length 75 cm surgical material 8.65 poly propylene with 1 / 2 cir rb needle 16 mm length 70 cm size:4 / 0 ( 12 foils / pkt ) , consumable 8.66 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm non absorbable surgical sutures usp size 2 / 0 ( size:2 / 0 ( 12 foils / pkt ) ) , consumable 8.67 disposable needles ( 22g consumable ) , consumable 8.68 polyamide with cd r cut extra penetrating needle ( 12 foils / pkt ) ( size 4 / 0 ) , consumable 8.69 needle hypodermic0insulin ( metallic non0sterile ) 8.7 suture needles curved 1 / 2 circle round bodyassorted size 1 5 8.71 suture needles curved 1 / 2 circle round bodyassorted size 11 15 8.72 suture needles curved 1 / 2 circle round bodyassorted size 16 20 8.73 spinal ( l.p. ) needle disposable ( 24g ) , consumable 8.74 spinal ( l.p. ) needle disposable 26g consumable 8.75 chromic catgut , round body needle no. 1.0 8.76 needle hypodermic size is ( 10654:2002 24g ) , consumable 8.77 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable 8.78 bleaching power gr ii ( 25kg ) bags consumable 8.79 bleaching powder gr ii is 1065 / 1989 with upto date amendment packed in 25 kg hdpe bags isi marked stable consumable 8.8 disposable suction catheter assorted covering ( all sizes 10, 12, 14, 16, 18 ) , consumable 8.81 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 8.82 ecg paper computerizesd triple channel 20m 8.83 infant feeding tube size: 6g 8.84 b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material [ 987794 ] 8.85 gauze swab / pad 6 layer 10 � 10 8.86 endotracheal tube internal dia 2.5 mm to 5 mm 8.87 complete delivery kit 1plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) .disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) .face mask 2 free size, ( 4 ) .plastic disposable cap ( non woven plastic laminated, leak proof ) ( 1pair, ( 5 ) .long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) , ( 6 ) disposable shoe covers, till calf ( plastic ) 2pair ( free size ) as per attached specification ) , consumable 8.88 malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species 8.89 seman diluting fluid 100 ml. 8.9 n / 10 hcl 500ml 8.91 widal 2x2 sera slide kit 8.92 syphalis card igg+igm s / s above 99.5 % syrup 8.93 edta k3 vial each 8.94 crp latex slide per test 8.95 urine culture pot 30 ml. 8.96 rapid ra 25 test 8.97 cell pack, reagent pack for cell counter ( ( erma and mindrug ) complete set ) , consumable 8.98 capillary tube ( 100 pieces ) , consumable 8.99 crp kit 1x100 biolab qualitative ) 9 vdrl ( rpr ) 1x100 strip 9.01 widal 4x5 ml 9.02 anti abd grouping serum 3x10ml consumable 9.03 sgpt kit lyphozyme 5x20 ml 9.04 urea uv gloh 5x20ml 9.05 urea ( brethelot ) 3x100ml lyphozyme 2x10ml 9.06 creatinin kit 9.07 uric acid biosystem 9.08 sugar albumin strip 9.09 test tube 15x125 9.1 disposable syringes ( with needle cgs 2cc ) , consumable 9.11 disposable syringes ( with needle cgs 5cc ) , consumable 9.12 disposable syringes with needle ( cgs 10cc ) , consumable 9.13 insulin syringe ( 40 units / ml iso 8537:2007 ) , consumable 9.14 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 3ml ) , consumable 9.15 disposable syringe with needle cgs 1cc with mark 0 1ml consumable ( ) , consumable 9.16 malaria pf / pv rapid test 9.17 malaria pf / pv antigen card 9.18 ryles tube ( pvc ) size ( children: 10 ) , consumable 9.19 ryles tube ( pvc ) size : adult: 16 ( each ) , consumable 9.2 infant feeding tube ( catheter ) size: 8g ( each ) , consumable 9.21 edta vail 9.22 edta vial with safty cap ( 2ml. ) capsule 9.23 plain vial with screw cap ( 12 x 75 ) , consumable 9.24 bed sheet white 60 x 90 consumable 9.25 basta cloth 44 x 44 ( 44x44 ) , consumable 9.26 draw sheet bleach 45 x 45 9.27 instrument wash 500ml with spray pump 9.28 liquid hand wash solution with dispenser consumable ( 500 ml ) , consumable 9.29 surgical blade isi marked, size 15 ( 100 per packet ) , surgical material 9.3 surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material 9.31 suture mersilk 8 0 ( 12 foil ) [ 987841 ] 9.32 paper adhesive plaster 1 / 2 x 9.0mts 9.33 inj. primacort hydrocotisone ( 200 mg ) , injection 9.34 iv dextrose 40% 9.35 absorbent cotton roll 100 gm each consumable 9.36 acetic acid solution ( 3% 100 ml bottle ) , consumable 9.37 acetone solution ( 100 ml ) , bottle 9.38 antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup 9.39 azithromycin + fluconazole +secnidazole ( 1 gm+150 mg+ 1 gm, tablet combipack ) , tablet 9.4 bandage cloth bleach consumable 9.41 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment 9.42 buppivacaine 5 mg, dextrose80 mg / ml ( 4 ml inj injection ) , injection 9.43 calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , syrup 9.44 cefixime 50 mg / 5ml, 30 ml, drop ( 30 ml ) , drop ] 9.45 chair cushion box type 18x18 9.46 neonatal hyperthermia prevention double layer pe bag with hood and velcro protection 9.47 chloramphenicol 0.5% ( 5ml ) , eye drop 9.48 chlorhexidine 0.5 % propanol 70 %, 100 ml hand rub ( 100 ml ) , consumable 9.49 chlorhexidine acetate 0.5 %, medicated gauze 9.5 chlorquine phosphate 64.5 mg / ml, 5 ml inj ( 5 ml ) , injection 9.51 cold cough drop , 15 ml ( phenyl ephrine 5 mg, chlorphenaramine 0.5 mg, paracetamol 125 mg / 5 ml ) , consumable 9.52 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 9.53 dengue duo serum plasma 10 test / kit ( sd ) 9.54 dexamethasone sodium ( 0.5 mg ) , tablet 9.55 dextrose 25 %, 25 ml inj 9.56 dextrose 50 %, ( 25 ml ) inj ( 50 % ) , injection 9.57 digestive drop ( digestive enzyme and multivitamin with l lysine ) ( 15 ml ) , drop 9.58 digital x ray film size 14 x 17 ( ( 100 sheet per packet ) ) , film 9.59 kellys pad disposable 9.6 dusting powder, 10 gm ( neomycin sulphate 5 mg, baccitracin 250 unit, sulphacetamide sodium 60 mg ) 9.61 enema 100 ml ( sodium acid phosphate 10 gm, sodium phosphate 8 gm / 100 ml ) 9.62 foleys urinary catheter 3 way size 22 9.63 frusemide 20mg + spironolactone 50mg ( tablet ) , tablet 9.64 g 6pd kinetic per ml 9.65 gauze clothes 90cmx20m 9.66 gauze swab / pad ( 4 layer 20x40 ) , consumable 9.67 gentian violet ( gram stain ) 100ml bottle 9.68 glass test tube 5 without edge 9.69 haemoccel ( electrolight na, k, ca, cl ) ( 500 ml inj ) , injection ] 9.7 haemocoagulase 1 nih unit / ml, 1 ml inj 9.71 hdl kit 50 test 9.72 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 9.73 hematology cell counter reagents dilutent ( 20 ltr ) 9.74 hematology cell counter reagents rinse solution ( 20 ltr ) 9.75 heparin sodium benzyl nicotinate oint 9.76 hiv 1+2 ( rapid ) per card j mitra 9.77 inj. sigmacrome ( obrochrome ) 10ml 9.78 iron syrup 200 ml ( elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg / 5 ml ) , consumable 9.79 iv cannula size 26g ( ) , consumabl 9.8 labetalol 5 mg / ml, 2 ml inj ( 2 ml ) , injection 9.81 losartan potassium, hydrochlorthiazide ( 50 mg + 12.5 mg ) , tablet 9.82 medigard hand scrub 9.83 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule 9.84 metresses 3x6 with raxine cover 4 density 9.85 miconazole nitrate 2 % w / w 15 gm, oint 9.86 micropiptte 100 1000 9.87 ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop 9.88 pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet 9.89 paracetamol 100 mg / ml, 150 ml drop ( 150 ml ) , consumable 9.9 paracetamol 75 mg / ml ( 10 ml inj ) , injection 9.91 phenobarbitine ( 20 mg / ml, 60 ml syrup ) , syrup 9.92 poly propylene mesh ( 7.5cmx15cm ) , consumable 9.93 sgpt test kit reagent 9.94 strip for malaria antigen, p vivex, p falciparum ( 50 tests ) 9.95 synethetic absorbable suture 1 / 0 with 1 / 2 cir rb needle size: 1 / 0 length 90cm 9.96 telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet 9.97 tuberculin diluted ppd 5 tu / 0.1 ml ( 5 ml ) , solution 9.98 uri stix 100 test 9.99 vitamin b complex syp 200 ml 10 white petrollium jelly 500 gm 10.01 widal 2x2 tube test kit 10.02 b.b silk with 1 / 2 cir rb / cutting needle 30 mm length 75 cm non absorbable ( size 2 0, 12 foils / pkt ) , consumable 10.03 collagen sheets 10 x 10 cm sheet 10.04 foleys catheter size 14 3 way 10.05 foleys catheter size 14 2 way 10.06 ryles tube ( pvc ) size : adult ( 18, each ) , tube 10.07 ryles tube ( pvc ) size ( children : 12 ) , tube 10.08 disposable suction catheter ( size 14 ) , consumable 10.09 disposable suction catheter ( size 12 ) , consumable 10.1 disposable scalp vein set ( size 20 no ) , consumable 10.11 disposable scalp vein set size 22 no ( each ) , consumable 10.12 paediatric drip set ( set ) , digonstic 10.13 measure volume ( drip set ) , each 10.14 cvp line complete set 10.15 triple lumen jugular catheter 12 x 16 10.16 oseltamivir h1 n1 antiviral syp 75 mg 10.17 swine flu vaccine ( vaccine ) , vaccine 10.18 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll ( 1 inch * 9 m / roll ( iso 13485:2016 ) ) , consumable 10.19 paper adhesive plaster microporous surgical tape ( 4 inch x 9 m / roll ( iso 13485:2016 ) ) , consumable 10.2 paper adhesive plaster microporous surgical tape ( 2 inch x 5m / roll ) , consumable 10.21 paper adhesive plaster microporous surgical tape ( 6 inch x 5m / roll ) , consumable 10.22 plaster of paris bandage 10 cm x 2.7 mtr / roll ( roll ) , bandage 10.23 vdrl kit ( strip ) ( 50 test / kit ) , consumable 10.24 disposable spinal needle ( 23 no ) , each 10.25 disposable spinal needle 18 no 10.26 disposable spinal needle ( 22 no ) , each 10.27 dj stent for ureter ( 8 fr ) , each 10.28 dj stent for ureter ( 6 fr ) , each 10.29 double lumen hoemodialysis catheter with pur ext ( tube ) , each 10.3 trucut biopsy needle ( 18 g length 15 cm ) , each 10.31 disposable ( 20 g no isi marked ) , needle 10.32 disposable syringe ( 50 ml ) , syrings 10.33 reuse prevention syringe ( 10 ml ) , syrings 10.34 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt ( no. ) , tube 10.35 test tube 12 x 100 ( medicm size ) 100 / pkt 10.36 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 10.37 tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each 10.38 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 10.39 abdominal drain ( set 32 no ) , each 10.4 abdominal drain set ( 28 no ) , each 10.41 icd bag 1000 ml 10.42 foleys urinary catheter 2 way size 8 10.43 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque blue line 10.44 wound suction catheter ( no 18 ) , each 10.45 foleys urinary catheter pediatrics ( size 10 ) , each 10.46 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 10.47 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 10.48 chikungunya card test 1 gg + 1 gm ( 25 test / kit ) 10.49 alpha beta arteether inj 75 mg / 2 ml 10.5 cefadroxil ( 500 mg ) , tablet 10.51 clotrimazole suspension i.p 50mg / 5ml ( 50mg / 5ml ) , suspension 10.52 olopatadine hydrochloride ophthalmic solution usp 01% w / v 5ml ( ) , eye drop [ 10.53 atorvastatin ( 20mg ) , tablet 10.54 soframycin ointment 30 mg tube ( ) , ointment 10.55 atorvastatin ( 10 mg ) , tablet 10.56 glass test tube 12 x 75 ( small size ) ( heavy quality 100 / pkt ) , tube 10.57 b.b. silk 6 reels x 25 mts length 25 mts. black braided silk without needle in reels non absorbable surgical sutures usp 3 0 ( 6 reels is per box rate should be quoted for 6 reels ) , consumable 10.58 chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt 10.59 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair 10.6 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 as amended upto, 6.5 inch / pair ( pair ) , consumable 10.61 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 ( 7 inch / pair ) , consumable 10.62 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992, as amended upto, 7.5 inch / pair ( pair ) , consumable 10.63 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6 inch / pair 10.64 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6.5 inch / pair 10.65 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 7 inch / pair 10.66 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free ( 7.5 inch / pair ) , consumable 10.67 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 10.68 disposable syringes is 10258:2002 with needle is 10654:2002 ( 10ml ) , syrings 10.69 i.v. cannula with injection valve ( 20g ) , consumable 10.7 needle hypodermic size is ( 10654:2002 23g ) , needle 10.71 sterile hypodermic syring with needle ( 5 ml ) , syrings [ 10.72 sterile hypodermic syring with needle 10 ml [ 10.73 sterile hypodermic syring with needle 20 ml 10.74 disposable needles ( 23 no ) , needle 10.75 i.v. cannula with injection valve ( size 24 g ) , consumable 10.76 triway cannula ( 3 way stop cock ) , consumable 10.77 three way stop ( cock ) , consumable 10.78 syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup 10.79 formaldehyde ( formalin ) 37% acq dilute 34 ml formaledehyde solution with water to produce 100ml ( 450 ml bottle ) ( 34 ml ) , bottle 10.8 irinotecan 100 mg inj ( 1 ml amp ) [ 10.81 azithromycin ( 100mg / 5ml ( 15 ml bottle ) ) , suspension 10.82 compound sodium lactate injection ip ( ringers lactate ) 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500 ml bottle ) ( ) , solution 10.83 gram iodine ( gram stain ) ( 100ml bottle ) ( bottle ) , consumable 10.84 trisodium citrate 3.8% ( 500 ml bottle ) 10.85 basic carbol fuchsin for afb staining 25 gm / pkt 10.86 carbol fuchsin for zn stain ( 500ml bottle ) 10.87 fouchets reagent ( 100 ml bottle ) , consumable [ mis56 ] 10.88 kit for total protein ( including albumin and total protein ) 100ml bottle 10.89 methyl blue for ( z n ) ( 125 ml bottle ) , consumable 10.9 platelet dilution fluid ( 100 ml ) , consumable 10.91 safranine ( gram stain ) ( 500 ml bottle ) , consumable 10.92 papaniculau stain kit ( 125ml bottle ) 10.93 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 2 lit can ( to make 9 liters working solution ) ( bromodex mp developer concentrate ) 9ltr packing 10.94 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 3 lit can ( to make 13.5 liters working solution ) ( bromodex mp developer concentrate ) 13.5 ltr packing 10.95 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life ( 5 ltr can to make 22.5 liters working solution ) 10.96 echo jelly 250ml bottle ( bottle ) , jelly 10.97 surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material 10.98 surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material 10.99 developer powder ( 22.5 ltr ) 11 brain thromboplastin for prothrombin time ( pt reagent ) 5ml ( liquiplastin ) 11.01 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) 11.02 hiv kit card ( 25 test / kit ) , kit 11.03 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 11.04 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 11.05 auto pippets fixed volume ( 10 micro liters each ) , consumable [ mis11 ] 11.06 auto pippets fixed volume ( 20 micro liters each ) , consumable [ mis13 ] 11.07 auto pippets fixed volume ( 1000 micro liters each ) , consumable [ mis12 ] 11.08 central venous catheter kit ( single lumen ) , kit 11.09 desferioxamine injection 500mg ( 500mg ) , injection 11.1 octreotide lar ( 30mg ) , injection 11.11 vildagliptin + metformin ( 50mg + 500mg ) , tablet 11.12 levofloxacin 500 mg ( 100 ml ffs bottle ) , injection 11.13 imatinib ( 400 mg ) , tablet 11.14 imatinib 100 mg cap 11.15 calcium leucovorin ( 50 mg / vial inj ) , injection 11.16 tamoxifen ( 10 mg ) , tablet 11.17 paclitaxel nanoparticle / protein bound particles inj. ( 100mg vial ) , vial 11.18 amlodipine ( 2.5mg ) , tab 11.19 oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup 11.2 sitagliptin ( 100 mg ) , tablet 11.21 methyl prednisolone sod. succinate ( 500 mg vial ) ( inj 40mg / ml , 12.5 ml vial ) , injection 11.22 hydrocortisone inj 100 mg / vial ( ) , injection 11.23 oseltamivir 30mg ( capsule ) , capsule 11.24 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet 11.25 a v blood lines with av pressure transducer protector for all machines types and dialysers ( acceptable for fitting to all standard dialysers ) , set 11.26 femoral catheters single lumen size adult ( set of 12 different sizes set ) , consumable 11.27 femoral catheters single lumen size size pediatrics ( ( set of 12 different sizes ) , set ) , consumable 11.28 femoral catheters double lumen kit curved double lumen catheter set ( 12 f ( curved ) adult ) , consumable 11.29 adult double lumen catheter ( set 11.5 f 12 fr, 13cm ( curved ) , kit ) , consumable 11.3 adult double lumen catheter set ( 11.5 f 12 fr, 13cm ( straight ) , set ) , consumable 11.31 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( curved ) , kit 11.32 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( straight ) , set 11.33 jugular catheters : double lumen kit ( curved ) , set [ 700233 ] 11.34 femoral guide wires : straight ( 0.325 mm size ) should meet the following standards : european ce, iso13485, sterile, fda, set 11.35 blood vessel introducers needles 16g, sterilized, set 11.36 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 11.37 tourniquet with belt ( good quality pairs ) ( each ) , consumable 11.38 kores indelible ink marker pen 11.39 ecg paper ( chemical coated ) ( 50mm*20 mm roll ) , each 11.4 tmt graph paper a4 size, 100 piece / pkt 11.41 ecg roll three channel 20m 11.42 iv cannula size with inj.valve ( port ) ( 22g ) , consumable 11.43 1.3 / 1.4 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) ( 200ml bottle ) , consumable 11.44 1.5 / 1.6 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) 11.45 rpr rapid card test kit ( 50 test / pkt ) 11.46 disposable sharp collection containers ( 1.5 l ) , consumable 11.47 polybutylate coated with polyester braided ( green ) with 1 / 2 cir tap cut v 5 da needle 17mm, non abs surg suture usp 2 0 length 90cm ( 12 foils / pkt ) 11.48 mva kit ( mannual vaccum aspiration kit 11.49 fistula 16g, single sterilized eto single needle packing fistula 17g, single sterilized eto single needle packing 11.51 disinfectant renaclean cold sterilant ( 5 ltr can ) 11.52 disinfectant renasteril hot disinfectant ( 5 ltr can ) 11.53 hemodialysis fluid for bicarb made ( part a 10 ltr +part b 500gm 2 / pkt ) , consumable 11.54 intracath cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) , consumable 11.55 quincke bevel pediatric spinal needle, g 25, length 1.2 inch 11.56 exchange transfusion catheter with four way adaptor ( size 4 cm, l 40 cm ) , consumable [ mis52 ] 11.57 single umbilical catheter with luer lock stopcock fr 2, l 40 cm 11.58 single umbilical catheter with luer lock stopcock fr 3, l 40 cm ] 11.59 single umbilical catheter with luer lock stopcock ( fr 4, l 40 cm ) , consumable [ mis113 ] single umbilical catheter with luer lock stopcock ( fr 5, l 40 cm ) , consumable [ 11.61 short iv catheter with straight / j tip guidewire ( l 20, fr 2, g 22 ) , consumable [ mis108 ] 11.62 long line silicon catheter ( g 24, fr 2, l 30cm ) , consumable [ mis76 ] 11.63 short iv catheter with straight guidewire. l 20, fr 2, g 22 11.64 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm size : 1 / 0 ( 12 foils / pkt ) , consumable [ 11.65 skin closure stapler ( 35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure ( 7.2 x 4.3 mm ) , consumable 11.66 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 15cm 11.67 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 20cm 11.68 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20 ( length 8cm ) , consumable 11.69 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, ( length 15cm ) , consumable 11.7 spinal needle g 23 with metal stylet. 11.71 low profile titenium chemo port with cilicon catheter ( 9.6 fr, 6.6fr, 3.9fr, ) length 60cm, guide wire, peel away desilet, hubsite needle ( 22g*20mm ) ( 22g*20mm ) , needle 11.72 i.v cannula size with injection valve ( port ) ( 18g ) , consumable 11.73 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 22 ) , consumable 11.74 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 20 ) , consumable 11.75 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 18 ) , consumable ] 11.76 ptfe material, i.v. safety cannula, with luer lock, g 16 ] 11.77 quincke pediatric spinal needles g 25, length 2.0 inch 11.78 central venous catheter kit single lumen ( 18 g ) , consumable 11.79 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg ( 250mg ) , capsule 11.8 polyethylene high pressure extension tube, length 100cm 11.81 polyethylene high pressure extension tube ( length 150cm ) , consumable [ mis94 ] 11.82 polyethylene high pressure extension tube, length 200cm 11.83 a.v fistula needle 17 g 11.84 a.v fistula needle 16 no 11.85 guide wire 3mm 11.86 urosticks ( 50 / pkt ) , consumable 11.87 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 11.88 adhesive roll 1 inch x 5 m / roll 11.89 light weight composite mesh : polypropylene and polyglycolic acid partially absorbable composite mesh with large pore size 6 x 11 cm 11.9 chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) 11.91 a.v. blood line ( post haemodialysis tubing ) high quality 11.92 endotreheal tube size 3 cuffed piece, should have silicon tube with radio opaque blue line 11.93 endotreheal tube size 4 cuffed piece, should have silicon tube with radio opaque blue line 11.94 disposable sharp collection containers ( 5 ltr ) , consumable 11.95 ondansetron syrup 2mg / ml 11.96 insulin intermediate inj 11.97 doxorubicin ( lypholozed ) 10 mg / vial 11.98 doxorubicin ( lypholozed ) 50 mg / vial ( 50 mg / vial ) , injection 11.99 pemetrexed ( 100 mg vial ) , injection 12 bleomycin 15 units / vial 12.01 daunorubicin ( 20 mg / vial ) , injection 12.02 egc roll ( 66 mm x 15 mm ) , consumable 12.03 umbical cord clamps ( plastic material ) , consumable 12.04 nebulization mask kit ( pediatrics ) , consumable 12.05 1 / 2 ccs cut needle 48 mm stainless steel ( length 45 cm size 4 ) , needle [ mis03 ] 12.06 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 5 ) , needle [ mis01 ] 12.07 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 6 ) , needle 12.08 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 40 mm length 70 cm size 1 ( 12 foils / pkt ) , needle 12.09 poly propylene mesh ( 15 x 15 cm ) , consumable [ 12.1 polymaide mono filament ( nylon ) with cd cut needle 20 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) 1 ] 12.11 polyglactin 30 mm 1 / 2 circle round body 90 cm size 1 / 0 ( 12 foils / pkt ) , consumable [ 12.12 polyglactin 40 mm 1 / 2 circle round body 90 cm size 1 ( 12 foils / pkt ) , consumable 12.13 polyglecaprone with 1 / 2 cir oval / rb needle 26 mm length 70 cm size 3 / 0 ( 12 foils / pkt ) , consumable [ mis95 ] 12.14 poly propylene mono filament sterile precut with 1 / 2 cir rb d needle 16mm length 70 cm non absorbable surgical sutures usp size 5 / 0 ( 12foils / pkt ) , consumable 12.15 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 16 mm length 70 cm non absorbable surgical sutures usp 5 / 0 ( 12 foils / pkt ) 12.16 polyester braided coated with cd white dn 25mm ( curved rb ) 2 0 length 90cm ( 12 foils / pkt ) 12.17 polyester braided coated with 1 / 2 cir cd white dn 17 mm taped cut 90 cm 2 / 0 size ( 12 foils / pkt ) , consumable [ mis93 ] 12.18 polyester braided coated with cd white dn 17 mm ( curved rev cut ) cut 90 cm 2 / 0 ( 12 foils / pkt ) 12.19 polyester braided coated with cd white dn 17 mm curved rb 90cm 2 / 0 ( 12 foils / pkt ) 12.2 5 0 da polyglactin 910 coated with polyglactin 910 and calcium state mono with 1 / 4 circle spatulated needle ( 12 foils / pkt ) , consumable 12.21 whitacre pencil point spinal needle 25 g with introducer [ 12.22 lead letter 0 9 sets ( 100 clips / pkt ) 12.23 lead letter a to z set [ 12.24 cassette ( 12 x 15 ) , consumable 12.25 cassette ( 10 x 12 ) , consumable 12.26 gloves latex autoclavable ( 8 no ( pair ) made of natural latex micro rough finish for better grip ) , consumable [ mis59 ] 12.27 sulfamethoxazole and trimethoprim suspension 50ml ( ) , suspension [ 12.28 sargramostim ( recombinant human granulocyte macrophage colony stimulating factor ) ( 500 mcg / ml ) , injection 12.29 magnesium suplhate injection i.p.50 % w / v 10ml amp 12.3 gentamicin inj. 40 mg / ml, 2ml amp 12.31 white petrollium jelly 1kg 12.32 white petrollium jelly 20 kg 12.33 hypodermic syringe for single use ( 10ml bp / bis ( without needle ) ) , syrings 12.34 hypodermic syringe for single use 2ml bp / bis ( without needle ) , syrings 12.35 hypodermic syringe for single use 5ml bp / bis ( without needle ) , syrings [ 700356 ] 12.36 ptfe material, iv cannula ( with luer lock, g 18 ) , consumable [ 700357 ] 12.37 diclofenac gel 1% 10gm tube 12.38 schirmer strip for ophthalmic use 12.39 actinomycin d ( 0.5mg vial ) , injection [ 12.4 cytra.bine 100 mg vial 12.41 ifosphamide + mesna ( 1gm ) , injection [ 12.42 vincristin sulphate 1 mg vial ( ) , vial [ 12.43 azithromycin ( 500 mg / 5ml inj ) , vial 12.44 carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection 12.45 metformine 500mg + glibenclamide 5mg ( tab ) , tablet 12.46 ampicillin ( 250 mg ) , capsule [ 12.47 metronidazole 100mg / 5ml ( 30ml ) , syrup 12.48 prednisolone ( dt tablets also accepted ) ( 5mg ) , tablet 12.49 salmeterol 25 mcg + fluticasone 125 mcg ( 120mdi ) , inhaler 12.5 salmeterol 25 mcg + fluticasone 250 mcg inhaler ( 120mdi ) ( 250 mcg ) , inhaler 12.51 enoxaparin sodium 40mg ( 20mg / 0.2ml ) prefilled syringe inj ( syringe inj ) , syrings [ 12.52 meropenem ( 1000 mg ( vial ) ) , injection 12.53 ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection 12.54 paracetamol 1000mg i v infusion ( 100 ml ffs bottle ) , injection 12.55 vitamin d3 granules ( 60000 iu sachet ) , powder 12.56 risperidone ( 1mg ) , tablet 12.57 hcg ( human chorionic gonadotropin ) inj 5000 iu vial 12.58 azithromycin 1gm + cefixime 400mg ( ( 1 + 1 tab ) ) , tablet 12.59 vitamin a ( soft gelatin cap ) 50000 i.u 12.6 chlorpromazine ( 50 mg ) , tablet 12.61 surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial 12.62 sterlium 500 ml 12.63 glucometer strip ( 1x100 ) 12.64 aceborophylline ( 100 mg ) , capsule 12.65 sildenafil ( 50 mg ) , tablet 12.66 ursodeoxycholic acid ( 150 mg tab ) , tablet 12.67 ursodeoxy cholic acid 300 mg tab 12.68 vitamin e usp ( 400 mg ) , capsule 12.69 benzyl benzoate lotion 25% ( 100ml bottle ) , bottle 12.7 disposable needles is ( 10654:2002 26 g ) , needle 12.71 hypodermic syringe for single use 1ml, is : 10258 ( 10 ml vial ) , syrings 12.72 spinal needle g 22 l 120 mm*0.71 / piece 12.73 spinal needle g 27 l 120 mm*0.40 / piece 12.74 hypodermic needles for single use gauze 22 bis length, 25 +1 / 2 12.75 hypodermic needles for single use gauze 23 bis length, 25 +1 / 2 12.76 feeding tube ( catheter ) ( 10 g, each ) , consumable ] 12.77 amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet ] 12.78 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet 12.79 phenytoin sodium 250 mg / 5 ml ( 5ml vial ) , injection 12.8 dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup 12.81 diphtheria antitoxin 10000 iu ( 10ml vial ) , injection 12.82 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 12.83 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 12.84 spinal needle ( 24 g ) , consumable 12.85 absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) [ 12.86 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet ( needle 30 mm length 70cm no. 1 0, 12 foils per packet ) , consumable [ 12.87 kellys pad ( rubber / each ) , consumable 12.88 disposable syringe with needle ( 3ml each ) , syrings 12.89 disposable syringe with needle ( 2ml each ) , syring ] 12.9 medical x ray film polyester based imaging film 30.5 cm x 30.5cm ( 12x12 ) size: 50 sheets in one packet 12.91 medical x ray film polyester based imaging film 35.6cm x 35.6cm ( 14x14 ) size: 50 sheets in one packet 12.92 medical x ray film polyester based imaging film 35.6 cm x 43.2cm ( 14x17 ) size: 50 sheets in one packet 12.93 syrup cefpodoxime ( 50 mg ) , syrup 12.94 a.v. blood line ( post haemodialysis tubing ) 12.95 non foldable iol sterile lens pc+14d ( 2 ) , pc+16d ( 3 ) , pc+18d ( 5 ) , pc+19d ( 5 ) , pc+19.5d ( 5 ) , pc+20d ( 15 ) , pc+20.5d ( 15 ) , pc+21d ( 13 ) , pc+21.5d ( 10 ) , pc+22d ( 10 ) , pc+22.5d ( 5 ) , pc+23d ( 5 ) , pc+24d ( 3 ) , pc+26d ( 2 ) , ac+19d ( 2 ) ( box ) , lens 12.96 total protein test kit ( 100 ml bottle ) , consumable 12.97 cervical collar / each soft, ( medium sized ) , consumable 12.98 baby diapers small ( 10 diaper per pkt ) , consumable 12.99 gauze sponge / each ( size 3 x 3 ) , consumable 13 chadar medical bleach ( name print ) ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) 13.01 chadar medical bleach ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.02 chadar medical bleach ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.03 dr sheet bleach ( 45 inch x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.04 sheeting cloth bleach ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.05 pillow cover cloth bleach ( 1 m x 40 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.06 chadar rangeen check ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.07 chadar rangeen ( ( name print ) 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.08 chadar rangeen ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.09 chadar rangeen ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.1 table cloth rangeen ( 54 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.11 table cloth rangeen ( 72 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) 13.12 curton cloth rangeen ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 34 / inch ) ) 13.13 curton cloth rangeen design ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 36 / inch ) ) , 13.14 honeycomb towel bleach ( 54 inch x 27 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.15 napkin bleach ( 27 inch x 17 inch tana x bana ( 2 / 20 x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.16 do suti bleach ( 1 m x 50 inch tana x bana ( 20 s x 14 s ) reed x pik ( 32 x 32 / inch ) ) 13.17 gaadi pot patta ( 1 m x 45 inch tana x bana ( 2 / 20 s 10 s ) reed x pik ( 36 x 32 / inch ) ) 13.18 basta cloth ( 36 inch x 36 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.19 basta cloth ( 44 inch x 44 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.2 patient cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 48 x 52 / inch ) ) 13.21 astar cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 reed x pik ( 48 x 52 / inch ) ) 13.22 peticote / blauge cloth shuti bleach ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.23 peticote blauge cloth shuti rangeen ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.24 gray duster cloth ( 24 inch x 24 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.25 gray duster cloth ( 28 inch x 28 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.26 macchardaani kapda cotten ( 1 m x 53 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 40 x 40 / inch ) 13.27 chadar check rangeen ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.28 chadar check rangeen naam print ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.29 blauze cloth tericat rangeen ( 1 m x 40 inch tana x bana ( 83 / 34d x40 cott. ) reed x pik ( 72 x 72 / inch ) ) , 13.3 tericat shirting cloth ( 1 m x 36 inch tana x bana ( 2 / 60s x 60 p.v. ) reed x pik ( 68 x 64 / inch ) ) , 13.31 tericat shuting ( 1 m x 56 inch tana x bana ( 2 / 30p : vx2 / 30 p:v ) / 65:35 reed x pik ( 60 x 48 / inch ) ) , 13.32 gauze cloth bleach 91cm x 20m tana x bana ( 26 s 26 s ) reed x pik ( 17 x 14 / inch ) , 13.33 bandage cloth bleach 1 m x 20 m tana x bana ( 26 x 26 s ) reed x pik ( 34 x 24 / inch ) , 6 ] 13.34 blazer cloth ( woolen 1 m x 54 inch tana x bana ( 8 n.m. x 8 n.m. ) reed x pik ( 28 x 24 / inch ) ) , 13.35 cotten sharee safed / rangeen ( 46 inch x 5.50m tana x bana 2 / 120sx80s reed pik 80 x 70 72 / inch ) ) , 13.36 tericot sharee rangin ( 46 x 5.50m tana x bana ( 2 / 120sx83 / 34 poly reed x pik ( 72 x80 / inch ) ) , 13.37 razai cloth ( 1 mts x 54 inch tana x bana ( 2 / 40s x 20s ) reed x pik ( 44 x44 / inch ) ) , 13.38 tericot astar cloth ( 1 mts x 54 inch tana x bana ( 2 / 60pv x 155d. ) reed x pik ( 68 x64 / inch ) ) , 13.39 tericat macchardani gray cloth ( 1 mts x 53 inch tana x bana ( 2 / 60pv x 30 p.v. ) reed x pik ( 48 x46 / inch ) 13.4 roll bandage 15 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.41 roll bandage 10 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.42 roll bandage 7.5 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.43 roll bandage 05 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , ] 13.44 chadar medical bleach ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.45 sodium hypochlorite solution 100 ml bottle 13.46 lignocaine hydrochloride for spinal anaesthesia ( heavy ) ( 0.05 2 ml amp ) , injection 13.47 bupivacaine hcl for spinal anaesthesia ( 0.5% ( heavy ) ) , injection 13.48 medical oxygen steel / aluminium cylinder ( 10 water cap ) with gas specific pin system ( 10 liters ) , inhalation 13.49 flumazenil 0.1 mg / ml 5 ml multiple dose vial 13.5 carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , 13.51 amoxicillin ( 250 mg / vial ) , injection 13.52 amoxicillin + clavulanic acid ( 125 mg + 25 mg ) , injection 13.53 cefixime 10 ml bottle ( 100 mg / 5 ml ) , suspension 13.54 cefpodoxime ( 50 mg ( dt tablet also acceptable ) ) , tablet 13.55 cephalexin dispersible ( 125 mg ) , tablet 13.56 chloramphenicol ( 500 mg ) , capsule 13.57 penicillin v 125 mg 13.58 penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet 13.59 tinidazole 150 mg / 5 ml ( 60 ml bottle ) , suspension 13.6 diethylcarbamazine ( 50 mg ) , tablet 13.61 epirubicin inj 100mg / vial vial ( each ) , injection 13.62 methotrexate tab ( 5 mg ) , tablet 13.63 levodopa + carbidopa 200 mg + 50 mg 13.64 dobutamine ( 12.5 mg / ml 20 ml vial ) , injection 13.65 fusidic acid 0.02 ( 15 gm ) , cream 13.66 metronidazole 1% ( 15 gm tube ) , ointment 13.67 salicylic acid ( 0.02 30 gm ) , ointment [ 13.68 chlorthalidone ( 50 mg ) , tablet 13.69 torasemide ( 20 mg / 2 ml vial ) , injection 13.7 dicyclomine hydrochloride oral solution 10 mg 30 ml bottle ( 10 mg ) , solution 13.71 doxylamine succinate ( 10 mg ) , tablet 13.72 ondansetron ( 2 mg ) , tablet 13.73 dydrogesterone ( 10 mg ) , tablet 13.74 micronised progestrone ( 200 mg ) , tablet 13.75 cabergoline ( 0.5 mg 4 tablets / strip ) , tablet 13.76 fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye [ 13.77 gentamycin + hydrocortisone 0.3% + 1% ( 5 ml vial ) , ear drops 13.78 fluconazole 0.3% eye / ear ( 5 ml ) , drop 13.79 cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops 13.8 fluphenazine ( 2.5 mg ) , tablet 13.81 fluoxetine ( 10 mg ) , tablet or capsule 13.82 sertraline ( 50 mg ) , tablet 13.83 venlafaxine ( 75 mg ) , capsule 13.84 salbutamol sulphate ( 2 mg ) , tablet 13.85 formaldehyde ( formalin ) 34% acq 450 ml bottle 13.86 sodium hypochlorite ( 0.03 5 ltr ) , solution 13.87 albendazole 100 mg ( tab ) , tablet 13.88 albendazole tab ( 200 mg ) , tablet 13.89 alfacalcidiol capsule ( 0.25 mcg ( soft gelatin capsule also acceptable ) ) , capsule 13.9 amitryptiline tab ( 50 mg ) , tablet 13.91 amitryptiline ( 75 mg ) , tablet 13.92 atorvastatin ( 5 mg ) , tablet 13.93 benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment 13.94 benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube 13.95 busulphan ( 2 mg ) , tablet 13.96 capreomycin 1000 mg / vial injection ( 10 ml ) , vial 13.97 chlorambucil ( 2 mg ) , tablet 13.98 ciprofloxacin 125 mg / 5 ml 60 ml bottle ( 125 mg / 5 ml 60 ml bottle ) , suspension 13.99 ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet 14 clindamycin ( 1% w / w 10 gm ) , gel 14.01 clobazam ( 5 mg ) , tablet [ 14.02 clobazam ( 10 mg ) , tablet 14.03 clonazepam 0.25 mg ( tablet ) , tablet 14.04 clonazepam ( 1 mg ) , tablet 14.05 cloxacillin cap ( 250 mg ) , capsule 14.06 cloxacillin ( 250 mg / vial ) , injection 14.07 cloxacillin ( 125 mg / 5 ml 40 ml bottle ) , syrup 14.08 colistin sulphate ( 12.5 mg / 5 ml 30 ml bottle ) , suspension 14.09 crystalline penicillin 5 lakh iu / vial ( vial ) , injection 14.1 cycloserine 250mg ( capsule ) , capsule 14.11 daunorubicin 50 mg / vial vial 14.12 didanosine 250 mg 14.13 didanosine ( 400 mg ) , capsule 14.14 dimercaprol 50 mg / ml ( 2 ml amp ) , injection 14.15 ephedrine 30 mg / ml ( 1 ml amp ) , injection 14.16 estradiol cypionate + medroxy progesterone acetate 5 mg + 25 mg / 0.5 ml 0.5 ml ( ) , injection 14.17 ethacridine lactate 1 mg / ml ( 50 ml ) , infusion 14.18 ethinyl estradiol 0.01 mg 10 tablets 14.19 ethinyl estradiol 0.05 mg 10 tablets 14.2 etoposide ( 50 mg ) , capsule 14.21 fluconazole ( 50 mg ) , tablet 14.22 fluconazole 100 mg [ 14.23 fluconazole ( 200 mg ) , tablet [ 14.24 flunarizine ( 10 mg tab ) , tablet 14.25 human chorionic gonadotropin 2000 iu / ml 1 ml amp 14.26 hydrochlorthiazide ( 12.5 mg ) , tablet 14.27 iron dextran 50 mg / ml ( 2 ml amp ) , injection ] 14.28 levamisole ( 50 mg ) , tablet 14.29 levocetirizine + monteleukast ( ( 2.5 mg + 4 mg ) / 5 ml, 30 ml bottle ) , syrup [ 14.3 lithium carbonate ( sr ) ( 450 mg ) , tablet 14.31 medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection 14.32 mesalamine ( 5 aminosalicylic acid ) usp ( 800 mg ) , tablet 14.33 methotrexate ( 7.5 mg ) , tablet 14.34 methylcobalamin inj ( 500 mcg / ml ( 10 ml vial ) ) , injection 14.35 methylcobalamin / mecobalamin ( 500 mcg ) , tablet 14.36 metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup 14.37 mirtazapine ( 7.5 mg ) , tablet 14.38 misoprostol 400 mcg ( 4 tablets / strip ) , tablet 14.39 ofloxacin + ornidazole ( 50 mg + 125 mg ) / 5ml 30 ml bottle ( 30 ml ) , suspension 14.4 olanzapine ( 2.5 mg ) , tablet [ 14.41 olanzapine ( 7.5 mg ) , tablet 14.42 omeprazole ( 10 mg ) , capsule 14.43 omeprazole capsule ( 40 mg ) , capsule 14.44 ornidazole tab ( 500 mg ) , tablet 14.45 oxcarbazepine 150 mg 14.46 oxcarbazepine ( 300 mg ) , tablet 14.47 oxcarbazepine ( 600 mg ) , tablet 14.48 pancuronium 2 mg / ml ( 2 ml amp ) , injection 14.49 procaine penicillin 4 lac iu / vial vial ( ) , injection 14.5 ribavirin ( 200 mg ) , tablet capsule 14.51 roxithromycin ( 50 mg / 5 ml 30 ml bottle ) , syrup 14.52 roxithromycin ( 300 mg ) , tablet [ 14.53 secnidazole ( 500 mg tab ) , tablet 14.54 sodium valproate + valproate ( 333 mg + 145 mg ) , tablet 14.55 venlafaxine er / pr ( 37.5 mg ) , tablet or capsule 14.56 venlafaxine ( 150 mg ) , tablet or capsule 14.57 acarbose ( 25 mg ) , tablet 14.58 atenolol ( 25 mg ) , tablet 14.59 cefadroxil 250 mg ( tab ) , tablet 14.6 cefepime ( 250 mg / vial ) , injection 14.61 cefpodoxime tablet 100 mg ( dt tablet also acceptable ) , tablet 14.62 dextrose, d 50 0.5 25 ml ( 25 ml ) , injection [ 14.63 dextrose, d 25 0.25 25 ml ( 25 ml ) , injection 14.64 aceclofenac + paracetamol + chlorzoxazone ( 100 mg + 500 mg + 500 mg ) , tablet 14.65 amisulpride ( 100 mg ) , tablet 14.66 amisulpride ( 50 mg ) , tablet 14.67 amisulpride ( 200 mg ) , tablet 14.68 amitriptyline ( 10 mg ) , tablet 14.69 amoxicillin 100 mg / ml ( 10 ml with dropper ) , drop 14.7 amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet 14.71 aripiprazole ( 10 mg ) , tablet 14.72 aripiprazole 15 mg ( tablet ) , tablet 14.73 aripiprazole ( 20 mg tab ) , tablet 14.74 aripiprazole ( 5 mg tab ) , tablet 14.75 atropine + dexamethasone + chloramphenicol 1% + 0.1% + 0.5% ( 5 ml ) , eye drop 14.76 benzathine penicillin ( 24 lac iu / vial vial ) , injection 14.77 bismuth iodoform paraffin paste ( 200 gm jar ) , ointment 14.78 butorphanol tartrate 1mg / ml ( 1 ml ) , injection 14.79 calcitriol cap ( 0.25 mcg ) , tablet 14.8 calcium acetate ( 667 mg ) , tablet 14.81 cefixime + azithromycin 200 mg + 250 mg ( tab ) , tablet 14.82 cefoperazone 1gm / vial vial 14.83 cefotaxime + sulbactam 1000 mg + 500 mg vial ( 1000 mg + 500 mg ) , injection 14.84 ceftriaxone tab ( 250 mg ) , tablet 14.85 cefuroxime 500 mg 10 x 10 ( 500 mg ) , tablet 14.86 cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet 14.87 cephalexin 100 mg / ml ( 10 ml with dropper ) , drop 14.88 cetrimide + choline salicylate 0.01% + 8% all w / v ( 10 gm tube ) , gel 14.89 chloramphenicol 1% w / w ( 50 / pack ) , eye applicap 14.9 chloraxozone + paracetamol ( 250 mg + 500 mg ) , tablet 14.91 chlordiazepoxide ( 20 mg ) , tablet 14.92 chlordiazepoxide ( 25 mg ) , tablet [ 14.93 chlordiazepoxide ( 10 mg ) , tablet 14.94 cholecalciferol ( 60000 iu ) , tablet 14.95 gel containing choline salicylate + benzalkonium chloride 9% + 0.02% ( 10 gm ) , gel [ 20200913 ] 14.96 clobetasol propionate 0.05% ( 15 gm tube ) , cream [ 14.97 clomiphene citrate ( 100 mg tab ) , tablet 14.98 clomipramine ( 75 mg ) , tablet 14.99 clomipramine 25 mg ( tablet ) , tablet 15 clomipramine ( 50 mg ) , tablet 15.01 clotrimazole ( 1% 100 gm ) , powder [ 15.02 clotrimazole 1% w / v ( 15ml ) , mouth paint 15.03 clotrimazole ( 1% 15 ml ) , lotion 15.04 clotrimazole ( 1% w / w 30 gm ) , powder 15.05 clozapine ( 100 mg ) , tablet 15.06 cyclobenzaprine ( 5 mg ) , tablet [ 15.07 cyclopentolate 1% w / v ( 5 ml ) , eye drop 15.08 cyclosporine 50 mg 15.09 cyclosporine 25 mg 15.1 des venlafaxine ( 50 mg ) , tablet 15.11 des venlafaxine ( 100 mg ) , tablet 15.12 diacerein + glucosamine ( 50 mg + 750 mg ) , capsule 15.13 diazepam ( 10 mg ) , tablet 15.14 diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet 15.15 diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet 15.16 dicyclomine 20mg+paracetamol 325mg ( tab ) , tablet 15.17 disodium acid phosphate + sodium phosphate 10 gm + 8 gm / 100 ml 100 ml ( ) , enema 15.18 divalproex sodium ( 500 mg tab ) , tablet 15.19 divalproex sodium ( 750 mg ) , tablet 15.2 divalproex sodium ( 250 mg ) , tablet 15.21 domperidone ( 1 mg / ml 10 ml with dropper ) , drop 15.22 doxophylline ( 400 mg ) , tablet 15.23 duloxetine ( 40 mg ) , tablet 15.24 duloxetine ( 20 mg ) , tablet 15.25 elemental iron 50 mg / ml 15 ml with dropper ( 15 ml with dropper ) , drop 15.26 elemental iron ( 50 mg / 5 ml ) , syrup 15.27 eltrombopag ( 25 mg ) , tablet 15.28 eplerenone ( 25 mg ) , tablet 15.29 escitalopram ( 5 mg ) , tablet 15.3 escitalopram ( 20 mg ) , tablet 15.31 escitalopram + clonazepam ( 10 mg + 0.5 mg ) , tablet 15.32 esmolol 100 mg / vial ( vial ) , injection 15.33 estradiol 1 mg / gm ( 15 gm tube ) , cream 15.34 estradiol 10 mg / vial ( vial ) , injection 15.35 fluvoxamine ( 50 mg ) , tablet 15.36 fluvoxamine ( 100 mg ) , tablet 15.37 flurbiprofen sodium 0.03% ( 5 ml ) , eye drop 15.38 gabapentine ( 100 mg ) , tablet 15.39 gentamicin + betamethasone 0.3% w / v + 0.1% w / v 5 ml ( ) , eye drop 15.4 gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection 15.41 glimepiride + metformin hydrocloride sr ( 1 mg + mg ) , tablet 15.42 glycerine + sodium chloride enema ( 15% + 15% 20 30 ml / pack ) , enema 15.43 glycerine suppository usp ( 3 gm bottle / 10 ) , suppository 15.44 glycerine + mag sulphate crystal 250 ml jar 15.45 granisetron 1 mg / ml ( 1 ml amp ) , injection 15.46 haemocoagulase 1 iu / ml 10 ml 15.47 heparin 25000 iu ( 5 ml ) , injection 15.48 homatropine 2% ( 1 ml vial ) , eye drop 15.49 hyaluronidase 1500 iu / 2 ml ( 2 ml amp / vial ) , injection 15.5 ibuprofen ( 200 mg ) , tablet 15.51 icthyol glycerine 1% 30 ml 15.52 intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs ( ) , infusion 15.53 isoprenaline 2 mg / ml ( 1 ml ) , injection 15.54 lactobacillus 150 million spores ( 1 sachet ) , powder 15.55 lamotrigine dt tab ( 100 mg ) , tablet [ 15.56 lamotrigine dt ( 50 mg ) , tablet 15.57 levetiracetam 500 mg 15.58 levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet 15.59 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup 15.6 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 15.61 mefenamic acid + drotaverine hcl ( 250 mg + 80 mg ) , tablet 15.62 metformin + glimepiride ( 500 mg + 2 mg tablet ( sr form also acceptable ) ) , tablet 15.63 methocarbamol 100 mg / ml ( 10ml ) , injection 15.64 methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule 15.65 methylcobalamine ( vitamin b12 ) 500 mcg / ml 3 ml 15.66 metoprolol + amlodipin ( 25 mg + 2.5 mg ) , tablet ] 15.67 metoprolol + ramipril ( 25 mg + 2.5 mg ) , tablet 15.68 micronised progesterone ( 400 mg ) , capsule 15.69 micronised progestrone ( 50 mg / ml 4 ml amp ) , injection 15.7 mirtazapine 15 mg ( tablet ) , tablet 15.71 mometasone 0.10% ointment / cream ( mometasone furoate also acceptable ) , ointment [ 15.72 moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 15.73 moxifloxacin + prednisolone 5 mg + 3 mg / 5 ml 5 ml ( ) , eye drop 15.74 moxifloxacine + dexamethasone 0.5% + 0.1% w / v 5 ml ( ) , eye drop 15.75 netilmycin 25 mg / ml 1 ml ( vial ) , injection 15.76 nicorandil ( 5 mg 10 x 10 ) , tablet 15.77 nicotine 2 mg ( 2 mg ) , gum 15.78 nicotine 4 mg ( 4 mg ) , gum 15.79 nicotine 14 mg ( 14 mg ) , transdermal patch 15.8 nicotine ( 2 mg ) , lozenges 15.81 nicotine transdermal patch ( 21 mg ) , transdermal patch 15.82 nicotine transdermal patch ( 7 mg ) , transdermal patch 15.83 nifedipine ( sublingual ) ( 10 mg ) , capsule 15.84 nimesulide +paracetamol ( 100 + 325 mg ) , tablet 15.85 nimesulide +paracetamol+serratiopetidase ( 100 + 325 + 10 mg ) , tablet 15.86 nitrazepam ( 5 mg ) , tablet 15.87 norethisterone enanthate 200 mg / ml ( 1 ml ) , injection 15.88 norfloxacin ( 200 mg ) , tablet [ 15.89 nortriptyline ( 10 mg ) , tablet 15.9 omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule 15.91 paracetamol + chlorphenaramine+ phenylephrine ( 250 mg + 2.5 mg + 10 mg ) , tablet 15.92 paracetamol + phenylephrine + chlorpheniramine maleate ( 125mg+2.5 mg+1mg ) / ml ( 15 ml bottle with dropper ) , drop 15.93 paroxetine cr ( 25 mg ) , tablet 15.94 paroxetine cr ( 12.5 mg ) , tablet [ 15.95 petrollium jelly ip ( 500 gm ) , gel 15.96 phenylepherine hcl & tropicamide 5% + 1% 5 ml [ 120566 ] 15.97 piperacillin + tazobactam 2000 mg + 250 mg 20ml vial ( 2000 mg + 250 mg 20ml vial ) , injection 15.98 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection 15.99 piracetam 200 mg / 15 ml ( 15 ml ) , injection [ 16 pregabalin + methylcobalamin ( 75 mg + 750 mcg ) , tablet or capsule [ 16.01 promethazine ( 50 mg ) , tablet 16.02 proparacaine 0.50% 5 ml / vial 16.03 propranolol ( tab 20 mg ) , tablet 16.04 povidone iodine + metronidazole ( 5 % + 1 % ) , ointment 16.05 providone iodine 1% ( 5 ml ) , eye drop 16.06 pyridostigmine ( 60 mg ) , tablet 16.07 quetiapine ( 200 mg ) , tablet 16.08 quetiapine ( 100 mg ) , tablet 16.09 quetiapine ( 50 mg ) , tablet 16.1 quinine dihydrochloride 150 mg / ml 2 ml ( amp ) , injection 16.11 rabeprazole ( 10 mg ) , capsule 16.12 ranitidine 15 mg / ml ( 100 ml bottle ) , syrup 16.13 risperidone + trihexiphenidyle ( 3 mg + 2 mg ) , tablet 16.14 risperidone + trihexiphenidyle ( 2 mg + 2 mg ) , tablet 16.15 risperidone + trihexiphenidyle ( 4 mg + 2 mg ) , tablet 16.16 rosuvastatin ( 10 mg ) , tablet 16.17 s adenosyl l methionine ( 400 mg ) , tablet 16.18 salbutamol 2.5 mg / 3 ml ( 3ml ) , injection 16.19 serratiopeptidase ( 10 mg ) , tablet 16.2 sertraline ( 100 mg ) , tablet 16.21 silver nitrate ( 500 ml each ) , liquid 16.22 sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop 16.23 sodium hyaluronate ( intraocular ) ( 10 mg / ml 2ml ) , injection 16.24 sodium valporate ( 300 mg ) , tablet 16.25 tamsulosin + dutasteride 0.4 mg + 0.5 mg ( tab ) , tablet 16.26 tannic acid with glycerine ( gum paint ) 80% + 20% 10 ml vial ( 10 ml ) , lotion 16.27 teicoplanin ( 200 mg / vial ) , injection 16.28 tetracycline eye ointment 1% 5 gm 16.29 thalidomide 100 mg 16.3 thiocholchecocide ( 8 mg ) , tablet 16.31 thiocholchecocide ( 4 mg ) , tablet 16.32 thyroxine sodium 25 mcg ( 100 per bottle ) , tablet 16.33 thyroxine sodium ( 75 mcg ) , tablet 16.34 tricholine citrate + sorbitol ( 550 mg + 7.15 g / 10 ml ) , syrup 16.35 trifluoperazine + trihexyphenidyle 5 mg + 2 mg ( tab ) , tablet 16.36 vitamin b12 500 mcg / ml 10 ml vial ( 10 ml vial ) , injection 16.37 vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup 16.38 vitamin e 200 mg ( capsule 10 x 10 ) , capsule 16.39 vitamin e 50 iu / ml 10 ml ( bottle with dropper ) , drop 16.4 zinc sulphate / gluconate 10 mg elemental zinc / 5 ml ( 10 mg / 5 ml ) , syrup 16.41 zinc sulphate 10 mg elemental zinc / 5 ml ( 200 ml bottle ) , syrup 16.42 bleomycin ( 15 mg / vial vial ) , injection 16.43 hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop 16.44 diltiazem 5mg / 1ml ( 5 ml ) , injection 16.45 acamprosate ( 333 mg ) , tablet 16.46 agomelatine ( 25 mg ) , tablet 16.47 aripiprazole ( 30 mg ) , tablet 16.48 atomoxetine ( 10 mg ) , tablet 16.49 atomoxetine ( 25 mg ) , tablet 16.5 baclofen ( 20 mg ) , tablet 16.51 baclofen ( 30 mg tab ) , tablet 16.52 baclofen ( 40 mg tab ) , tablet 16.53 blonanserin ( 2 mg ) , tablet 16.54 blonanserin ( 4 mg ) , tablet 16.55 bupropion ( 150 mg ) , tablet 16.56 buspirone ( 10 mg ) , tablet 16.57 buspirone ( 5 mg ) , tablet 16.58 carbamazepine ( sr ) ( 100 mg ) , tablet 16.59 donepezil ( 10 mg ) , tablet 16.6 duloxetine ( 30 mg ) , tablet 16.61 fluoxetine ( 40 mg ) , capsule 16.62 flupenthixol ( 20 mg / ml 1 ml ) , injection 16.63 haloperidol ( 1.5 mg ) , tablet 16.64 imipramine ( 75 mg ) , tablet 16.65 lithium carbonate ( 400 mg ) , tablet 16.66 memantine ( 10 mg ) , tablet 16.67 methyl phenidate 10 mg ( tab ) , tablet 16.68 methyl phenidate ( 20 mg ) , tablet 16.69 mirtazapine ( 30 mg ) , tablet 16.7 modafinil ( 100 mg ) , tablet 16.71 naltrexone ( 50 mg ) , tablet 16.72 olanzapine ( 10 mg / vial vial ) , injection 16.73 paliperidone 1.5 mg ( tab ) , tablet 16.74 paliperidone ( 3 mg ) , tablet 16.75 procyclidine ( 5 mg ) , tablet 16.76 risperidone ( 4 mg ) , tablet 16.77 sodium valproate ( 100 mg / ml 5 ml ) , injection 16.78 tadalafil 10 mg 16.79 tianeptin 12.5 mg ( tab ) , tablet 16.8 topiramate 25 mg ( tab ) , tablet 16.81 topiramate 50 mg ( tab ) , tablet 16.82 topiramate 100 mg ( tab ) , tablet 16.83 trifluoperazine 5 mg 16.84 vitamin b1 ( thiamine ) 75 mg ( tab ) , tablet 16.85 zonisamide ( 50 mg ) , capsule 16.86 zonisamide 100 mg ( capsule ) , capsule 16.87 urine container 5ml disposable ( 50 per pkt ) 16.88 disposable syringe with needle ( 5ml each ) , needle 16.89 infant feeding tube ( catheter ) size: 3g ( no. ) , consumable 16.9 infant feeding tube ( catheter ) size: 4g 16.91 suction catheter assorted 9 no / each ( each ) , consumable 16.92 suction catheter assorted 10 no / each 16.93 dental x ray film size 31 x 41 mm ( 150 films / pkt ) ( size 31 x 41 mm ) , film 16.94 disposable syringe with needle ( 20ml each ) , needle 16.95 synthetic absorbable suture 3 / 0 with cd cutting needle size : 3 / 0 22mm length 45cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( needle circle size is 1 / circle ) , needle 16.96 infant feeding tube size: 5g 16.97 adhesive tape 7.5cm x10 ( mtr / roll ) , consumable 16.98 disposable plastic appron ( full size ) , consumable 16.99 hydralazine hydrochloride 20mg / ml injection ( 1 ml amp / vial ) [ 700449 ] 17 glycerine ip solution ( 100ml bottle ) , bottle 17.01 etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup 17.02 disposable surgeon cap ( box of 100 caps ) , consumable 17.03 paediatric epidural set ( 19g needle, metal stylet, 22g catheter, 0.22micron epidural catheter lor syringe ) ( ) , consumable 17.04 oxygen nasal canula ( neonatal ) 7 white colour tubing and threaded nut ( 25 pcs / pkt ) , consumable 17.05 catgut chromic with 1 / 2 cir cutting needle 12mm ( length 70cm no.3 0, 12 foils per pakt ) , consumable 17.06 electrolyte e ( multiple electrolytes and dextrose inj type v ip ) i / v fluid ( each 100ml contains inj dextrose 5g, sod.acetate 0.64g, sod.chloride 0.50g, sodium citrate 0.075g, kcl 0.075g, ccl 0.035g, magnesium chloride 0.031g ) , infusion 17.07 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) intravenous fluid ( each 100ml contains: anhydrous dextrose 5 gm, sod.chloride 0.37g, potassium chloride 0.13g, ammonium chloride 0.37g ) , infusion 17.08 cetrimide 15% w / v + chlorhexidine 1.5% w / v ( 1 liter bottle ) , bottle 17.09 human albumin solution i.p. 20%w / v ( 100 ml ffs bottle / glass bottle ) , bottle 17.1 k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable 17.11 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 30mm length 90cm polyglycolic acid ( pga ) 12 foils / pkt ( 12 foils per pkt ) , needle 17.12 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ( size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ) , needle 17.13 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle ( size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 12 foils / pkt ) , needle 17.14 b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm ( length at least 75 cm, 12 foils per packet ) , needle 17.15 prolene 1 0 rb 1 / 2 circle 30 mm, l 70 cm ( 12 foils / pkt ) , needle 17.16 prolene mesh ( 7.5 x 15 cm ) , needle 17.17 dengue ns 1 elisa ( antigen ) kit ( pack of 96 / as per attached specification in tender ) , consumable 17.18 blood bag 100ml 17.19 blood bag 350ml 17.2 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 17.21 silk no 1 cutting needle 1x12 ( 1x12 ) , consumable 17.22 neomycin and sulfacetamide sprinkling powder 5 gm ( each ) , consumable 17.23 distilled water 5 litre ( each ) , consumable 17.24 meropenem 250 mg / vial ( 250mg / vial ) , injection 17.25 ambu bag adult ( silicon ) ( each ) , consumable 17.26 ambu bag child ( silicon ) ( each ) , consumable 17.27 multivitamin with protein 200 ml ( 200 ml ) , syrup 17.28 aprin polyster ( std size ) , consumable 17.29 bed sheet white ( 60 inch x 90 inch ) , consumable 17.3 bed sheet cloured 50 inch x 80 inch 17.31 basta cloth ( 36 inch x 36 inch ) , consumable 17.32 compounder coat / lab tec / xry tec ( std size ) , consumable 17.33 curtain green redymade ( 45 inch x 60 inch ) , consumable 17.34 chair cushion box type ( 18 inch x 18 inch ) , consumable 17.35 chair cushion cover ( 19 inch x 19 inch ) , consumable 17.36 front aprin ( std size ) , consumable 17.37 livirise set female saree white polyster green / blue border [ saree + peticot + blouse ] 5 meter 17.38 livirise set male [ pent and shirt ] std size 17.39 mattress 5kg cotton ( 3 ft x 6 ft ) , consumable 17.4 napkin sup. quality std size 17.41 new born baby kit ( [ 4 piece set ] ) , consumable 17.42 whole sheet 35 inch x 35 inch 17.43 patient suit for male / female ( std size ) , consumable 17.44 pillow cover sup. quality ( 17 inch x 27 inch ) , consumable 17.45 pillow with 2kg cotton ( 16 inch x 26 inch ) , consumable 17.46 turkish towel sup. 25 inch x 50 inch 17.47 wollen saluka / coat for 4th class std size 17.48 chloramphenicol eye ointment 1% ( 4 gram ) , tube 17.49 ketoconazole tab 200mg ( ) , tablet 17.5 bupivacaine hydrochloride 0.25% ( 20 ml vial ) , injection 17.51 ondansetron inj ( 2 mg / ml ) , injection 17.52 vitamin b complex injection ( nfi formula 30ml / vial ) , injection 17.53 norfloxacin + metronidazole suspension 100mg+100mg / 5ml ( 30 ml bottle ) , bottle 17.54 temephos ( 50 % ec 5 litre pack ) , consumable 17.55 paper adhesive microporous surgical tape 3 inch m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable 17.56 hydroxypropyl methylcellulose eye drops ( 2% 5 ml vial ) , eye drop 17.57 alpha beta arteether inj 75 mg / ml 1ml 1ml amp ( ) , injection 17.58 metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet 17.59 aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( 10x10 ) , tablet 17.6 micronised progesterone ( 100 mg ) , tablet 17.61 disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup 17.62 cefuroxime 750mg powder for solution for injection ( 750mg ) , injection powder for 17.63 gluteraldehyde solution 2% ( 5 litre can ) , solution 17.64 chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , solution 17.65 milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup 17.66 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable 17.67 multivitamine 100ml syrup ( 100 ml ) , syrup 17.68 multivitamin with zinc drop 15ml ( 15 ml ) , drop 17.69 drotaverine ( 80 mg ) , tablet 17.7 isotonic 18 ltr ( each ) , consumable 17.71 hemolynac 3n 2340 500ml ( each ) , consumable 17.72 split septum transparent closed needles connector with two 10 cm pur extension and one non return valve, consumable 17.73 pe arterial catheter with visualization chamber and anti kinking color 20 g, 8 cm length, consumable 17.74 electrolyte solution a 250ml ( 250ml ) , consumable 17.75 tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg pack of 200mdi, inhaler ( 200mdi ) , inhaler 17.76 spinal needle 26 g ( each ) , needle 17.77 cotton khadi dari 3x6 feet 1.4kg per piece 17.78 cotton khadi dari, 4x7 feet, 2.0 kg, per piece 17.79 cotton khadi dari, 4x7 feet, 4.0kg, per piece 17.8 cotton khadi dari, 9x10 feet, 5.0kg, per piece 17.81 cotton khadi dari, 9x12 feet, 6.0kg, per piece 17.82 cotton khadi dari, 10x1.5 feet, 1.2kg, per piece 17.83 cotton khadi dari floor mota per sq. ft 17.84 cotton khadi yoga dari , 2x6 feet, 800gm, per piece 17.85 cotton khadi asana dari, 24x24 inch, per piece 17.86 cotton khadi white bedsheet, 54x90 inch, 500gm, per piece [ kha010 ] 17.87 cotton khadi printed bedsheet, 54x90 inch, 500gm, per piece 17.88 cotton khadi printed bedsheet tiger print, 54x90 inch, 500gm, per piece 17.89 cotton khadi pillow cover, 16x26 inch, per piece 17.9 cotton khadi blanket cover, 54x90 inch, per piece 17.91 cotton khadi pillow, 15x24 inch, 1.0kg, per piece 17.92 cotton khadi matress, 3x6 feet, 5.0kg, per piece 17.93 cotton khadi matress, 3x6 feet, 10.0kg, per piece 17.94 cotton khadi curtain, 2.30mt, per piece 17.95 cotton khadi curtain, 1.75mt, per piece 17.96 cotton khadi bag, 36x36 inch, per piece 17.97 cotton khadi bag, 48x48 inch, per piece 17.98 polyvastra kapda coating, 28 inch, 2 suti, per meter 17.99 polyvastra kapda shirting, 36 inch, 1.5 suti, per meter 18 polyvastra uniform ( pent / shirt / topi ) , 2 suti, per set 18.01 polyvastra uniform ( kurta / payjama / topi ) , 1.5 suti, per set 18.02 polyvastra white sari, 5.50mtr, 1 suti, per piece [ kha026 ] 18.03 polyvastra plane sari colored , 5.50mtr, 1 suti, per piece 18.04 polyvastra blouse, 1.00mtr, 1.5 suti, per piece 18.05 polyvastra peticote, 2.00mtr, 1.5 suti, per piece 18.06 blanket jammu woolen plane, 54x90 inch, 2.200 kg, per piece 18.07 woolen shawl meriono ladies, 40x80 inch, per piece 18.08 woolen coating, 28 inch, per meter 18.09 woolen coating, 54 inch, per meter 18.1 woolen coat, per piece as per measurment 18.11 shoes uniform , per pair as per measurment 18.12 amunation boot, per pair as per measurment 18.13 ankle boot, per pair as per measurment 18.14 ladies sleeper, per pair as per measurment 18.15 leather belt without backaal, per piece as per measurment 18.16 leather belt with backaal , per piece as per measurment 18.17 cream sumag ( ) , cream 18.18 aceclofenac 100mg+paracetamol 325mg tab ( ) , tablet 18.19 h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable 18.2 plain vial ( 12 x 75 with screw cap each ) , consumable 18.21 abdominal belt ( 32 inch each ) , consumable 18.22 ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable 18.23 x ray film fixer ( powder to make 13.5 liters pkt ) , consumable 18.24 x ray film fixer ( powder to make 9 liters pkt ) , consumable 18.25 potassium chloride syrup 200ml ( each ) , syrup 18.26 hematology cell counter reagents lysis solution 500ml ( each ) , solution 18.27 e z cleaner 100ml ( each ) , solution 18.28 rifampicin cap ( 300 mg ) , capsule 18.29 rifampicin cap ( 450 mg ) , capsule 18.3 rifampicin cap ( 600 mg ) , capsule 18.31 diproex er tablet 500mg ( 500mg ) , tablet 18.32 hyoscine butyl bromind 1 mg ( amp ) , injection 18.33 bone wax sterilised ( 2 gm / packet ) , consumable 18.34 i v cannula with inj.valve ( port ) ( size 26g each ) , consumable 18.35 surface and fogging disinfectant stabilised h202, 10 11%w / v with diluted silver nitrate sol. 0.01%w / v ( 5 litre can ) , each 18.36 liquid paraffin 50ml ( bottle ) , consumable 18.37 troponin 1 kit ( 10 test per pack ) , consumable 18.38 serum t3 kit, elisa ( 96 test kit each ) , consumable 18.39 serum t4 kit, elisa ( 96 test kit each ) , consumable 18.4 serum tsh kit, elisa ( 96 / pkt ) , consumable 18.41 silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream 18.42 cannula fixer set ( piece ) , each 18.43 latex examination gloves ( large ) ( 100 / pkt ) ( packet ) , consumable 18.44 latex examination gloves ( medium ) ( 100 / pkt ) ( packet ) , consumable 18.45 latex examination gloves ( small ) ( 100 / pkt ) ( packet ) , consumable 18.46 chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle 18.47 polyamide size 2 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.48 polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , consumable 18.49 chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle 18.5 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 90 cm size 2 / 0 ) , needle 18.51 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 20 mm, length 70 cm size 3 / 0 ) , needle 18.52 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 7 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.53 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 8 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.54 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 4 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.55 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 5 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.56 urinary drainage bag ( paediatric ) ( 100 ml / pc, each ) , consumable 18.57 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 16, each ) , consumable 18.58 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 18, each ) , consumable18.59 polyamide size 1 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.6 polypropylene size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 45 mm, length 90 cm ) , needle 18.61 chromic size 1 / 0 ( 12 foils / pkt ) ( 3 / 8 cir rb needle 40 mm, suture length 76 cm ) , needle 18.62 chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle 18.63 human albumin 20% ( 50 ml vial ffs glass bottle ) , bottle 18.64 temozolomide ( 20 mg ) , capsule 18.65 ambu bag / resuscitator silicon 200 250 ml infant size each, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) should be multiple times autoclavable ) , consumable 18.66 ldh kit pack ( 50 ml bottle ) , consumable 18.67 neubauers chamber ( each ) , consumable 18.68 biomedical waste collection plastic bag ( yellow ) ( as per attached detail specifications ) ( 450x450 mm 55 micron 100 / pkt ) , consumable 18.69 aso kit ( 25 test / packet ) , consumable 18.7 ambu bag ( silicon type ) paediatrics each 1400 1700 ml with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.71 ambu bag / adult each 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.72 draw sheet ( each ) , consumable 18.73 urine ( multi stripe ) , consumable 18.74 voglibose ( 0.3mg ( mouth dissolving tablet also acceptable ) ) , tablet 18.75 clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop 18.76 diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup 18.77 ondansetron ( drops ) syrup ( 2mg / 5ml ( 10 ml bottle ) ) , syrup 18.78 paracetamol oral drops ( 100 mg / ml ( 15 ml bottle with dropper ) ) , drop 18.79 gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection 18.8 multivitamin syrup 60 ml ( each 5ml contains vitamin a ( palmitate ) ip 1600 iu+vitamin d3 ip 200 iu ( +vitamin b2 ip 1.00mg+vitamin b6 ip 0.50mg+niacinamide ip 15.00mg+d panthenol ip 1.00mg ( 20% variability in strength or with additional contents acceptable ) ) , syrup 18.81 diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet 18.82 vitamin d3 drop 10ml ( cholecalciferol 400 iu ) ( 10 ml drop ) , drop 18.83 aceclofenac 100mg+paracetamol 325mg+chlorzoxazone 250mg tab ( 250mg ) , tablet 18.84 glutaraldehyde solution 2% in 5 litre can ( 2 strips / vials per each can ) ( 5 litre can ) , consumable 18.85 acyclovir 5% ( 5gm ) , ointment or cream 18.86 biomedical waste collection plstic bag ( black 750 x 900 mm 55 micron 100 / pkt ) , bag 18.87 biomedical waste collection plstic bag ( black 900 x 900 mm 55 micron 100 / pkt ) , bag 18.88 biomedical waste collection plstic bag ( blue 750 x 900 mm 55 micron 100 / pkt ) , bag 18.89 biomedical waste collection plstic bag ( blue 900 x 900 mm 55 micron 100 / pkt ) , bag 18.9 biomedical waste collection plstic bag ( red 750 x 900 mm 55 micron 100 / pkt ) , bag 18.91 biomedical waste collection plstic bag ( red 900 x 900 mm 55 micron 100 / pkt ) , bag 18.92 biomedical waste collection plstic bag ( yellow 750 x 900 mm 55 micron 100 / pkt ) , bag 18.93 biomedical waste collection plstic bag ( yellow 900 x 900 mm 55 micron 100 / pkt ) , bag 18.94 glucometer strips 1 should be able to use capillary blood samples 2 should have expiry as printed on the label of the supplied box ( 3 all strips should have at least one year expiry date from the date of supply 1 glucometer free with each 1 thousand strips rate should be quoted for 50 strip / packet ) , consumable 18.95 endotracheal tubes size 5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.96 endotracheal tubes size 5.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , combi blister pack 18.97 endotracheal tubes size 6 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.98 endotracheal tubes size 6.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.99 endotracheal tubes size 7 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19 endotracheal tubes size 7.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.01 endotracheal tubes size 8 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.02 endotracheal tubes size 8.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable [ 700627 ] 19.03 endotracheal tubes size 9 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.04 foleys catheter size 12 2 way ( 10 each ) , consumable 19.05 foleys catheter size 16 2 way ( 11 each ) , consumable 19.06 foleys catheter size 20 2 way ( 12 each ) , consumable 19.07 foleys catheter size 22 2 way ( 13 each ) , consumable 19.08 foleys catheter size 24 2 way ( 14 each ) , consumable [ 700633 ] 19.09 post operative bag with window size 70 mm ( 1 each ) , consumable [ 700634 ] 19.1 post operative bag with window size 100 mm ( 1 each ) , consumable 19.11 cresent knife ( 1 each ) , consumable 19.12 lenstip ( 1 each ) , consumable 19.13 sodium chloride 0.3% iv 100ml ( 1 each ) , injection 19.14 imipenem 250mg+cilastatin 250mg powder for solution ( 1 each ) , injection powder for 19.15 terlipressine inj. 1mg / 10ml vial ( 1 each ) , injection 19.16 clindamycin 300 mg / ml inj ( 1 each ) , injection 19.17 anti h sera 10 ml vial ( each ) , consumable 19.18 anti d sera igg+igm 10ml vial ( each ) , consumable 19.19 anti ab sera igm 5 ml vial ( each ) , consumable 19.2 anti a1 lection sera5 ml vial ( each ) , consumable 19.21 albumin 100 ml bottle ( each ) , consumable 19.22 coombs reagent 5 ml bottle ( each ) , consumable 19.23 hba ag elisa 96 kit 1x96 ( each ) , consumable 19.24 hba ag rapid card test ( each ) , consumable 19.25 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 19.26 test tube medium ( 12x100 ) 100eack / pkt ( each ) , consumable 19.27 dionised water 5 ltr cane ( each ) , consumable19.28 double blood bag 450 ml cpda ( each ) , consumable 19.29 quadraple blood bag 450 ml sagm ( each ) , consumable 19.3 triple blood bag 450 ml ( cpda ) ( each ) , consumable 19.31 transfer bag ( each ) , consumable 19.32 tissue paper roll ( each ) , consumable 19.33 plain disposable vial 3ml ( each ) , consumable 19.34 edta vaccutainer 3 ml + needle ( each ) , consumable 19.35 v.p shunt high pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.36 v.p shunt medium pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.37 balanced salt solution 500 ml bottle ( each ) , consumable 19.38 hydroethyl starch 6% solution with sodium chloride 0.9% 500 ml bottle ( each ) , consumable 19.39 pyrazinamide 750mg tablet ( 10x10 ) , tablet 19.4 folic acid tab ( 400 mcg ) , tablet 19.41 ofloxacin infusion ( 2mg / 1ml ( 100ml ffs bottle ) ) , bottle 19.42 ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection 19.43 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle 19.44 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 4 , each ) , tube 19.45 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 3 ) , tube 19.46 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle 19.47 polypropylene size 2 / 0 ( 12 foils / pkt ) ( 1 / 2 cir rb needle 25mm, length 45 cm ) , needle 19.48 ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.49 cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.5 methyline blue ( 100 ml ) , solution 19.51 pop bandage ( 6 inch ) , consumable 19.52 pop bandage ( 4 inch ) , consumable 19.53 x ray cassets ( 6.5x8.5 ) , consumable 19.54 x ray cassets ( 8x10 ) , consumable 19.55 x ray hangers ( 6.5x8.5 ) , consumable 19.56 x ray hangers ( 8x10 ) , consumable 19.57 x ray hangers ( 10x12 ) , consumable 19.58 x ray hangers ( 12x15 ) , consumable 19.59 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag 19.6 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag 19.61 foldable iol sterile lens pc+14d ( lens 2 ) , pc+16d ( lens 3 ) , pc+18d ( lens 5 ) , pc+19d ( lens 5 ) , pc+19.5d ( lens 5 ) , pc+20d ( lens 15 ) , pc+20.5 ( lens 15 ) , pc+21d ( lens 13 ) , pc+21.5d ( lens 10 ) , pc+22d ( lens 10 ) , pc+22.5d ( lens 5 ) , pc+23d ( lens 5 ) , pc+24d ( lens 3 ) , pc+26d ( lens 2 ) ( ( one box should contain 100 pieces as per specification of power given ) , lens ( attached specification ( 100 lens per box ) ) , consumable 19.62 erythromycin ( as estolate ) ( 125mg / 5ml, 60ml bottle ) , suspension 19.63 abdominal belt ( 36 inch each ) , consumable 19.64 abdominal belt ( 38 inch each ) , consumable 19.65 abdominal belt ( 34 inch each ) , consumable 19.66 dengu card antigen ( 25 card / pkt ) , consumable 19.67 povidone iodine solution 5% ( 500 ml ) , bottle 19.68 total parenteral nutrition ( including carbohydrate + proteins + fats solution 2000 ml ) , infusion 19.69 pregnancy test card ( 10 card pack ) , consumable 19.7 glucose pouch ( 100 gram pack ( mfg bhandari products ) ) , consumable 19.71 brain thromboplastin ( 5ml bottle ) , consumable 19.72 swab stick with tube sterile ( 70 80 mm length 10 15 mm diameter ) , unit 1 ( 100 / pkt , packet ) , consumable 19.73 blood grouping anti sera a monoclonal ( 10 ml vial ) , consumable 19.74 blood grouping anti sera b monoclonal ( 10 ml vial ) , consumable 19.75 blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 19.76 safranine ( gram stain ) ( 500 ml bottle ( mfgsunlabs ) ) , consumable 19.77 anti a sera igm ( 10 vial ) , consumable 19.78 anti b sera igm ( 10 vial ) , consumable 19.79 bovine albumin ( each ) , consumable 19.8 coombs ahg sera 5ml ( each ) , consumable 19.81 flow regulator ( dial flow ) ( each ) , consumable 19.82 l alanyl l glutamine solution for infusion ( 20%w / v ) ( each ) , consumable 19.83 disinfectant with stabilizer by 0.01%w / v agn03 and h2p04 ( each ) , consumable 19.84 insulin syringe ( each ) , consumable 19.85 disposable sterile hypodermic syringe 10ml ( each ) , consumable 19.86 iv mannitol ( 100 ml ) , injection 19.87 human normal immunoglobin ( 5gm / 100ml ) , injection 19.88 iv cannula with inj valve ( 20g ) , consumable 19.89 iv cannula with inj valve ( 18g ) , consumable 19.9 sevoflurane 20cc ( each ) , consumable 19.91 patch buprenorphine ( 10mcg ) , consumable 19.92 patch buprenorphine ( 20mcg ) , consumable 19.93 propofol 1% ( 10ml / 5ml 20ml ) , injection 19.94 intravenous immuglobin ( ivig ) ( each ) , injection 19.95 sodium thiopentone ( 500mg ) , injection powder for 19.96 ranibizumab inj ( 10ml / mg ) , injection 19.97 trastuzumav inj ( 440mg ) , injection 19.98 ibandronic acid inj ( 6mg ) , injection 19.99 everolimus tab 10mg ( 4x7 ) , tablet 20 cell pack for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 20000 ml ) , consumable 20.01 stromatolyser 4dl for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.02 sstromatolyser 4ds for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 126 ml ) , consumable 20.03 sulfolyser for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.04 cell clean for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 50 ml ) , consumable 20.05 isotonac 3000 pack size 18 l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.06 hemolynac 3n 2340 pack size 500 ml ( cell counter ( model no mek 6420p japan ) ) , consumable 20.07 cleanac 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.08 cleanac 3 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.09 albumin ( mfg pathogyme diagnostics ) ( 200 ml ( 4 x 50 ml ) ) , consumable 20.1 barium chloride 10% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.11 basic carbol fuchsin for afb staining ( mfg precious life care pvt ltd ) ( 25 gram / packet ) , consumable 20.12 crp test kit ( latex / card ) , kit of 25 tests ( 25 test / kit ) , consumable 20.13 field stain a ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.14 field stain b ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.15 fouchets reagent ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.16 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 20.17 gram iodine ( gram stain ) ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.18 leishman stain ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable [ 700732 ] 20.19 methyl blue for ( z n ) ( mfg precious life care pvt ltd ) ( 125 ml bottle ) , consumable 20.2 platelet dilution fluid ( mfg precious life care pvt ltd ) ( 100 ml ) , consumable 20.21 rbc dialuation fluid ( 500 ml bottle ) , consumable [ mis98 ] 20.22 serum creatinine ( 100 ml bottle ( 2 x 50 ml ) ) ( consumable ) , consumable 20.23 sgot ( 25 ml ) , consumable 20.24 sodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.25 trisodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.26 uric acid ( mfg pathogyme diagnostics ) ( 50 ml ( 2 x 25 ml ) ) , consumable [ 700739 ] 20.27 usg gel ( 250 ml bottle ) , consumable 20.28 wbc dialuation fluid ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.29 foleys urinary catheter 2 way ( size 22 each ) , consumable 20.3 suction catheter, sterile ( size fg 20 ( disposable, sterile each ) ) , consumable 20.31 suction catheter, sterile ( size fg 22 ( disposable, sterile each ) ) , consumable 20.32 suction catheter, sterile ( size fg 6 ( disposable, sterile each ) ) , consumable 20.33 corrugated drainage sheet, sterile, multichannel, single use ( 2 inch x 6 inch ( pvc ) piece ) , consumable 20.34 infant feeding tube ( 10 g each piece, each ) , consumable 20.35 infant feeding tube ( 7g each piece, each ) , consumable 20.36 ryles tube ( size 14 each piece ) , consumable 20.37 cyanemeth solution for hb ( mfg by beacon diagnostic ) ( 5 lit can ) , consumable 20.38 edta solutions k3 ( 500 ml bottle ) ( bottle ) , consumable 20.39 total protein ( mfg by beacon diagnostic ) ( 100 ml ) , consumable 20.4 vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable 20.41 serum amylase ( 100 ml ) , consumable 20.42 ra factor rapid kit 1 ) should be based on latex agglutination slide test 2 ) qualitative and semi quantative testing facility possible 3 ) test speed must be less than 2 minutes ( 25 test / kit ) , consumable 20.43 leuprolide depot inj ( 3.75mg ) , injection 20.44 linazolid ( 300ml ) , injection 20.45 moxifloxacin ( 100ml ) , injection 20.46 ofloxacin+ metronidazole ( 30ml ) , syrup 20.47 amphotericin b inj ip ( 50 mg ) , injection 20.48 colistinethate sodium inj bp ( 1 million iu ) , injection 20.49 permethrin 5% ( 30 gm ) , cream 20.5 n s 3% hypotonic ( 100ml ) , injection 20.51 pilocarpine nitrate inj. ip 0.5 % w / v ( 1 ml ) , injection 20.52 carboxymethyl cellulose 0.5% eye drop ( 5 ml ) , eye drop 20.53 hydroxyethylstarch 3% ( 500 ml ) , injection 20.54 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) ( d ) cotton gauze pieces 1, e ) artery forceps 1 no ( disposable ) ) , consumable 20.55 tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable 20.56 medical nitrous oxide gas in jambo size cylinder ( d type ) , miscellaneous 20.57 medical nitrous oxide gas in medium size cylinder ( b type ) , miscellaneous 20.58 medical nitrous oxide gas in small size cylinder ( a type ) , miscellaneous 20.59 medical oxygen gas ip in jambo size cylinder ( d type ) , consumable 20.6 medical oxygen gas ip in medium size cylinder ( b type ) , miscellaneous 20.61 medical oxygen gas ip in small size cylinder ( a type ) , miscellaneous 20.62 carbondioxide gas in medium size cylinder ( b type ) , miscellaneous 20.63 carbondioxide gas in small size cylinder ( a type ) , miscellaneous 20.64 amlodipine ( 10mg ) , tablet 20.65 erythomycin stearate ( 250mg ) , tablet 20.66 intravenous fat emulsion 20% w / v ( 20% w / v ) , bottle 20.67 sevoflurane usp inhalation anesthetic 250 ml ( 250 ml ) , bottle 20.68 dexmedetomidine hydrochloride injection 1ml amp ( 1 ml amp ) , ampule 20.69 co trimoxazole oral suspension ip ( 5 ml each trimethoprim 40 mg sulphamethoxazole 200 mg ) , bottle 20.7 fistula sterilized twin needle ( 16 g ( two needle pack ) ) , consumable 20.71 a v fistula sterilized twin needle ( 17 g ( two needle pack ) ) , consumable 20.72 a v blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzers ) with side tubing ( for heparinization and av pressure monitoring ) ce and iso certificate essential with protector for all machines types and dialysers ( post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality, each ) , consumable 20.73 protien ( total ) mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.74 protien ( urine ) ba 400 biosystems diagnostics pvt ltd ( 240 ml ) , consumable 20.75 creatinine mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.76 protein ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.77 creatinine 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.78 glucose 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.79 cholesterol 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.8 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.81 urea / bun � uv 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.82 uric acid 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.83 triglyceride 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.84 ast / got 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.85 alt / gpt 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.86 albumin 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.87 calcium arsenazo 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.88 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.89 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.9 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.91 conc washing solution 500 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.92 reaction rotor 10 pc ( model ba 400 system ( mfg bybio system ) ) , consumable 20.93 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.94 biochemistry calibrator 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.95 hdl / ldl standard 1x1 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.96 biochemistry control serum l1 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.97 biochemistry control serum l2 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.98 sodium chloride 0.45% + dextrose 5% ( 500 ml ffs bottle ) , injection 20.99 femoral catheters single lumen set adult ( size 6f to 8f, length 13 cm to 15 cm, each ) , consumable 21 femoral catheters single lumen set pediatric ( size 3f to 4f, length 13 cm to 15 cm or less ) , consumable 21.01 calcium phosphate ( 2 : 1 ratio ( 100 ml bottle ) ) , syrup ( each 5 ml contains : calcium 82 mg + vitamin d3 ( cholecalciferol ) 200 iu + vitamin b12 ( cynocobalamin ) 2.5 mcg ) , syrup 21.02 imatinib cap / tab ( 100 mg ) , tablet or capsule 21.03 tamsulosin ( 0.4mg ) , tablet 21.04 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid ( 5 ltr can ) , consumable 21.05 sterilant hot disinfectant for dialysis containing 21% ( approx ) citric acid, malic acid, lactic acid ( 5 ltr can ) , consumable 21.06 hemodialysis powder for bicarb made ( part a powder to make 10 ltr + part b 500gm 2 / pkt ) , consumable 21.07 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( straight ) ) , consumable 21.08 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( curved ) ) , consumable 21.09 femoral guide wires : straight / j tip ( ( 0.325 mm size ) sterile: ce / iso13485 marked ) , consumable 21.1 electrolyte m ( multi electrolyte with 5% dextrose injection type iii ip ) i / v fluid each 100ml contains: ( anhydrous dextrose 5g; sodium acetate trihydrate ) ( 500 ml ffs bottle ) , injection 21.11 disposable pricking lancet ( mfg by precious life care ) ( pkt of 200 units ) , consumable 21.12 echo jelly 250 ml ( mfg by precious life care ) , bottle 21.13 hub cutter non electric lockable safety portable box for disposal of hypodermic needles ( cuts the needle from the hub of machine ) , each 21.14 disposable sharp collection containers ( 1.5 l mfg by precious life care ) , each 21.15 disposable sharp collection containers ( 5 l ( mfg by precious life care ) ) , each 21.16 ecg jelly 250 gms bottle ( mfg by precious life care ) , bottle 21.17 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 21.18 rib belt large ( each ) , each 21.19 rib belt medium ( each ) , each 21.2 rib belt small ( each ) , each 21.21 diagnostic strips for urine sugar / albmin packing: amber colored, 100 strips / pkt ( packet ) , consumable 21.22 nitrofruantoin ( 100mg ) , tablet capsule 21.23 biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection 21.24 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( 5 kg packet ( mfg by zenith chemicals allied industries ) ) , consumable 21.25 iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup 21.26 hypodermic needles for single use bis gauze ( 23 length, 25 mm + 1 ) , needle 21.27 bcg ( 1 ml each ) , syrings 21.28 disposable ( 24 g each ) , needle 21.29 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized. ( 10 ml ) , syrings 21.3 disposable needles is 10654:2002 ( 23g ) , needle 21.31 short iv catheter with straight / j tip guidewire ( l 4, fr 2, g 22 ) , consumable [ mis109 ] 21.32 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 21.33 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings [ 700846 ] 21.34 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 3ml ) , syrings 21.35 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , syrings 21.36 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 2 way each ) , consumable 21.37 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 18 2 way, each ) , consumable 21.38 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 16 2 way each ) , consumable 21.39 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( 2 way size 8, each ) , consumable 21.4 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( size 10 , each ) , consumable 21.41 sgpt100 ml ( 4 x 25 ) , consumable 21.42 alkaline phosphate ( 100 ml ( 5 x 20 ) ) , consumable 21.43 reagent for hdl cholestrol test ( 100 ml ( 4 x 25 ) ) , consumable 21.44 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) , consumable 21.45 clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule 21.46 alphacypermetherin 5% wdp ( as per attached specifications in rc ( confirming to is 15603 standards to be supplied in in 25kg or 20kg pack . 1 metric ton ) ) , consumable 21.47 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ( 5 / 0 12 foils / pkt ) ) , sutures 21.48 testcha ( 23 ) , ampoule 21.49 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable [ mis18 ] disposable syringes is 10258:2002 with needle is 10654:2002, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.51 sterile hypodermic syring with needle, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.52 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable [ 700863 ] 21.53 double lumen polyurethane cvp catheter 5 fr ( length 13 to 15 cm ) , consumable [ 700864 ] 21.54 double lumen polyurethane cvp catheter 4 to 5 fr ( length 8 to 13 cm, sample to be submitted by firm latest by 10 days from the date of bid opening , each ) , consumable [ 700865 ] 21.55 triple lumen polyurethane cvp catheter 7 to 7.5 fr ( g 14 16x18x18x18, length 15 16cm, each ) , consumable 21.56 triple lumen polyurethane cvp catheter 7 to 7.5fr ( g 14 16x18x18, length 16 20 cm, each ) , consumable 21.57 spinal needle ( g 22 l 120 mm ) , consumable 21.58 triple lumen jugular catheter kit, ( size 12f, 16+ / 1cm, kit ) , consumable 21.59 nylon suture spatulated micropoint reverse cutting needle, double armed suture size 9 0 ( 12 foils / pkt ) , sutures nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , sutures 21.61 endotracheal tube internal with radioopaque line ( dia 2.5 mm to 5 mm, each ) , consumable 21.62 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line ( size 9.5 , each ) , consumable 21.63 latex based baloon ( capacity 30 50 ml ) foleys urinary catheter ( 3 way size 20 ) , consumable 21.64 spinal needle with metal stylet, ( g 23 ) , needle [ 700875 ] 21.65 urinary drainage bag cap with non return valve ( eo sterile ) ( 2 litre, each ) , consumable 21.66 disposable spinal needle, mfg by alpha medicare & devices pvt. ltd. ( 18 no ) , needle 21.67 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 22 no ) , needle 21.68 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 23 no ) , needle 21.69 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 20 mtr roll ) , consumable 21.7 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 30 mtr. roll ) , consumable 21.71 ecg paper ( wax coated ) ( 50mm x 30 mtr, roll ) , consumable 21.72 ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable 21.73 egc roll, mfg by life o line technologist ( 66 mm x 15 mm roll ) , consumable 21.74 icd bag, mfg by life o line technologist ( 1000 ml ) , bag 21.75 nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable 21.76 cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable 21.77 mva kit ( mannual vaccum aspiration kit ) ( as per attached specification ) , consumable 21.78 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 3 way ) , consumable 21.79 latex based baloon capacity ( 3 ml ) foleys catheter ( way, size 12 ) , consumable 21.8 scalp vein set ( size 24g, disposable , each ) , consumable 21.81 paracetamol + chlorpheniramine ( 100 ml syrup ) , syrup 21.82 calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup 21.83 size of film 14 inch x 17 inch ( dihl ) , consumable 21.84 size of film 10 inch x 12 inch ( dihl ) , consumable 21.85 size of film 8 inch x 10 inch ( dihl ) , consumable 21.86 size of cassette ( 14 inch x 17 inch ) , consumable 21.87 size of cassette ( 10 inch x 12 inch ) , consumable 21.88 size of cassette ( 8 inch x 10 inch ) , consumable 21.89 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 21.9 hcv elisatest kit pack size: 96 well per kit ( rate should be quoted for 1 kit containing 96 wells ) , consumable 21.91 triple blood bag ( sagm ) ( 450 ml ) , consumable 21.92 size of film 10 inch x 12 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.93 size of film 14 inch x 17 inch digital x ray film ( dihl ( pack of 100 ) ) , film 21.94 size of film 8 inch x 10 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.95 mindray bc 5300, auto hematology analyzer part 5 ( m 53 diluent ) , consumable 21.96 mindray bc 5300, auto hematology analyzer part 5 ( m 53 lh lyes ) , consumable 21.97 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( i ) lyes ) , consumable 21.98 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( ii ) lyes ) , consumable 21.99 mindray bc 5300, auto hematology analyzer part 5 ( m 53 cleaner ) , consumable 22 mindray bc 5300, auto hematology analyzer part 5 ( m 53 probe cleaner ) , consumable 22.01 mindray bc 5300, auto hematology analyzer part 5 ( quality control ) , consumable 22.02 mindray bc 2800, auto hematology analyzer ( m 18 diluent ) , consumable 22.03 mindray bc 2800, auto hematology analyzer ( m 18 cfl lyes ) , consumable 22.04 mindray bc 2800, auto hematology analyzer ( m 18 rinse ) , consumable 22.05 mindray bc 2800, auto hematology analyzer ( m 18 cleanzer ) , consumable 22.06 mindray bc 2800, auto hematology analyzer ( m 18 probe cleanzer ) , consumable 22.07 mindray bc 2800, auto hematology analyzer ( paper roll ) , consumable 22.08 mindray bc 2800, auto hematology analyzer ( quality control ) , consumable 22.09 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( pt � sta neoplastin cl + 5 ) , consumable 22.1 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable 22.11 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable [ 700045 ] 22.12 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( sta cacl2 ) , consumable 22.13 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stadesorb u ) , consumable 22.14 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacoagcontrol n+p ) , consumable 22.15 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stasatellite cuvette ) , consumable 22.16 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacleaner solution ) , consumable 22.17 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( white stirrer for pt test ) , consumable 22.18 carelyte 503 ( calibrator 1&2 ) , consumable 22.19 carelyte 503 ( enzyme cleaning solution ) , consumable 22.2 carelyte 503 ( thermal printer roll ) , consumable 22.21 carelyte 503 ( sodium electrode ) , consumable 22.22 carelyte 503 ( pottasium electrode ) , consumable 22.23 carelyte 503 ( refernce electrode ) , consumable 22.24 carelyte 503 ( pump tubing ) , consumable 22.25 carelyte 503 ( complete tubing set ) , consumable 22.26 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 22.27 blood urea ( bun ) uv ( 1000 ml ) , consumable 22.28 s direct billirubin ( 1000 ml ) , consumable 22.29 hba 1 c ( glycosylated hb ) ( 100 tests ) , consumable 22.3 microalbumin urine ( 100 tests ) , consumable 22.31 apo a ( 100 tests ) , consumable 22.32 apo b ( 100 tests ) , consumable 22.33 crp ( hs ) ( 100 tests ) , consumable 22.34 s. transferin ( 100 tests ) , consumable 22.35 s. tibc kit ( 100 tests ) , consumable 22.36 s. b12 ( 100 tests ) , consumable 22.37 s. folate ( 100 tests ) , consumable 22.38 s.vitamin d3 ( 100 tests ) , consumable 22.39 s. iron ( ferrozine ) ( 100 tests ) , consumable 22.4 hdl ( each ) , consumable 22.41 s. ferritin ( each ) , consumable 22.42 s.calcium ( each ) , consumable 22.43 s. phosphorus ( each ) , consumable 22.44 s. total protein ( each ) , consumable 22.45 s.albumin ( each ) , consumable 22.46 s.lipase ( each ) , consumable 22.47 pt kit ( time ) ( ist 1.00 1.20 ) ( 2x4 ml ) , consumable 22.48 apit ( 2x4 ml ) , consumable 22.49 fdp kit ( 4 ml ) , consumable 22.5 d dimer ( 10x3 ml ) , consumable 22.51 thrombin time kit ( 10x3 ml ) , consumable 22.52 factor vii deficient plasma ( less than 1% ) ( 10x30 ml ) , consumable 22.53 factor ix deficient plasma ( less than 1% ) ( 10x1 ml ) , consumable 22.54 staining kit reticulin ( 100 test ) , consumable 22.55 staining kits ( 100 test ) , consumable 22.56 ptah staining kits ( 100 test ) , consumable 22.57 masson trichrome staining kits ( 100 test ) , consumable 22.58 quick diff staining kits for pap smear ( 100 test ) , consumable 22.59 troponin t ( ctn t ) card test ( 50 test ) , consumable 22.6 coombs serum ( anti human globulin ) ( polyvalent ) ( 1x5=5 ml ) , consumable 22.61 bovine albumin ( 22% w / v ) ( 1x5=5 ml ) , consumable 22.62 anti d ( polyvalent ) ( 1x10 ml ) , consumable 22.63 benedicts qualitative reagent ( 1x5 lit ) , consumable 22.64 absolute alcohol ( ethanol ) ( 1x500 ml = 500 ml ) , consumable 22.65 isopropyl alcohol ( propanol ) ( 1 x 2.5 lit ) , consumable 22.66 xylene ( sulphur free ) ( 1 x 2.5 lit ) , consumable 22.67 clotrimazole 1%w / v +lignocaine 2%w / v ( 10ml ) , eye drop 22.68 aztreonam inj ( 500 mg ) , injection 22.69 glycopyrolate 0.5 mg + neostigmine 2.5 mg ( 5ml ) , injection 22.7 dexmedetomidine hydrochloride injection ( 100mg ) , injection 22.71 dextran iv 40% ( 500ml ) , injection 22.72 ampicilline + cloxacilline ( 250 mg + 250 mg ) , injection per vial 22.73 losartan ( 25 mg ) , tablet 22.74 hydroxyethyl starch 6% ( each ) , suspension 22.75 antacid ( 250mg ) , syrup 22.76 dinoprostone gel ( 0.5 mg ) , gel 22.77 insulin biphasic / premix 50:50 ( 40 iu / ml ( 10 ml vial ) ) , injection 22.78 insulin biphasic lispro 25:75 100 iu / ml ( 3 ml cartridge ) ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) , cartridges [ 120713 ] 22.79 dpx ( 1 x 250 lit ) , consumable 22.8 ea 50 ( modified ) ( for cytology ) ( 1x125 ml ) , consumable 22.81 og6 ( for cytology ) ( 1x125 ml ) , consumable 22.82 paraffin wax histology ( 58 60 ) ( 1x1 kg = 1 kg ) , consumable 22.83 polytaxine powder ( 1x5 gm ) , consumable 22.84 haematoxyline solution ( harris ) ( 1x125 ml ) , consumable 22.85 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable [ 710021 ] 22.86 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 22.87 ( ss ) powder ( 1x25 gm = 25 gm ) , consumable 22.88 eosin 2% solution ( 1x250 ml ) , consumable 22.89 reticulocyte kit ( 100 tests ) , consumable 22.9 leishmann stain sol with buffer tablet ph ( 1x5 lit ) , consumable 22.91 giemsa stain ( merck / span ) ( 125 ml ) , consumable 22.92 stain ( 1x25 gm = 25 gm ) , consumable 22.93 cytochrome stain with buffer ( 500 ml ) , consumable 22.94 methanol ( acetone free ) for leishman staining ( 1x2.5 lit ) , consumable 22.95 fauchets reagents ( 125 ml ) , consumable 22.96 esbachs reagent ( 125 ml ) , consumable 22.97 sodium nitroprusside ( 100 gm ) , consumable 22.98 occult blood test kit ( haem test kit ) ( 1 x 100 strips ) , consumable 22.99 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 23 ehrilichs aidehyde reagen ( 2x250 ml ) , consumable 23.01 conc hcl ( 1x500 ml = 500 ml ) , consumable 23.02 con. ( hno3 ) nitric acid ( 2.5 liter ) , consumable 23.03 glacial acetic acid ( 2.5 liter ) , consumable 23.04 liquor ammonia ( 500 ml ) , consumable 23.05 pandys reagent csf ( 125 ml ) , consumable 23.06 ammonium sulphate ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.07 sodium metabisuiphite ( na2s2o3 ) ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.08 sodium hydroxide ( naoh ) ( analar / gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.09 citric acid analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.1 trisodium citrate analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.11 nah2 po4 ( anhydrous ) analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.12 poly l lysine sol ( for immunochisto chemistry ) ( 1x100 ml ) , consumable 23.13 poly l lysine coated slides ( 50 lidess x 1 ) , consumable 23.14 indicator sol, for ph ( litmus sol ) ( 1x500 ml = 500 ml ) , consumable 23.15 sodium chloride nacl analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.16 iron alum a ) ferric amino sulphate ( 1x500 ml = 500 ml ) , consumable 23.17 aluminium potassim sulphate ( each ) , consumable 23.18 mercuric oxide ( 25 gm ) , consumable 23.19 gold chloride ( 1x1 gm ) , consumable 23.2 sliver nitrate ( 1x25 gm = 25 gm ) , consumable 23.21 drabkin solution for hb ( 1x5 lit ) , consumable 23.22 distilled water ( 1x5 lit ) , consumable 23.23 centchroman ip ( 30 mg ) , tablet 23.24 non ionic contrast media ( 350 mg , 100ml ) , consumable 23.25 protein ( total ) ( 600 ml ) , consumable 23.26 hdl / ldl standard ( 1x1 ml ) , consumable 23.27 biochemistry control serum l1 ( 5x5 ml ) , consumable 23.28 biochemistry control serum l2 ( 5x5 ml ) , consumable 23.29 dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection 23.3 tablet domeperidone ( 10mg ) , tablet 23.31 pantaprazole ( 40mg ) , injection 23.32 ceftriaxone ( 1g ) , injection 23.33 human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection 23.34 human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection 23.35 basal insulin glargin ( 100iu / ml ( 10ml vial ) ) , injection 23.36 ultravist 300mg ( 50 ml / vial ) , injection 23.37 tab amitryptyline ( 25 mg ) , tablet 23.38 tab citalopram ( 20 mg ) , tablet 23.39 sics blade cresent ( 15 degree ) , consumable 23.4 sics blade sideport ( sideport entry knife ) , consumable 23.41 eye drape disposable towel ( size 70*70cm area 08*08 ) , consumable 23.42 id wrist band ( identification for mother / child specific colour ) ( wrist band / no ) , consumable 23.43 balance salt solution for irrigation 500 ml ffs bottle ( 500ml bottle ) , eye applicap 23.44 trypan blue dye ( 1ml ) , consumable 23.45 x ray developer powder ( 13.5 liter ) , consumable 23.46 surgical spirit ( 100ml ) , bottle 23.47 hemotocyto meter ( meter ) , consumable 23.48 haemoglobin tube ( tube ) , consumable 23.49 multivitamin without iron syrup ( 100ml ) , syrup 23.5 haemoglobi pippate ( pippate ) , consumable 23.51 bloting paper ( paper ) , consumable 23.52 blood cell counter key ( key ) , consumable 23.53 barium chloride powder ( powder ) , consumable ] 23.54 edta powder ( 250 gm ) , consumable [ ] 23.55 insulin biphasic / premix 50:50 ( 100 iu / ml ( 10 ml vial ) ) , injection 23.56 montex test 2tu ( 1 vial ) , consumable 23.57 stainic rack ( each ) , consumable 23.58 intra camral saline ( r.l ) sep ( eto sterelied, specialy ( manufactured for intra camral ) , consumable [ 23.59 plastic bottle ( 300ml ) , consumable 23.6 plastic bottle ( 500 ml ) , consumable 23.61 sics blade ( disposable ) cresent nife 2.8 ( specialy long matel handle, micro sharp edge, isi / iso ( manufaturer, eto stereliged ) , consumable 23.62 suter ( 8 / 0 ( 01 box ) ) , consumable 23.63 pistol grip curvedcoagulating shears ergonomic handle with att shaft lenght 36cm can seal blood vessel upto and inclding ( 5mm in diameter ) , consumable [ 23.64 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 14cm and should be both hand and ( foot activated ) , consumable ] 23.65 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 9cm can seal blood vessels upto and including 5 mm in diameter ) , each [ 710092 ] 23.66 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 25cm and should be both hand and ( foot activated ) , consumable [ 710095 ] 23.67 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 17 cm can seal blood vessels upto and including 5 mm in 23.68 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated ) , consumable 23.69 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 35cm and should be both hand and ( foot activated ) , consumable [ 710096 ] 23.7 pistol grip curved coagulating shears with ergonomic handle in the ( folloeing shaft lengths 36 cm can seal blood vessels upto and including 5 mm in diameter ) , consumable [ 710099 ] 23.71 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated with curved tip ) , consumable 23.72 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 45cm and should be both hand ( foot activated with curved tip ) , consumable 23.73 pistol grip curved coagulating shears with ergonomic handle shaft ( langths 36 cm can seal blood vessels upto and including 5 mm in diameter att ) , each 23.74 complete absorbable mesh fixation device with minimum strap length 7mm2point fixation to hold the mesh and device should be of ( 25 absorbable straps ) , consumable 23.75 handpiece ( transducer ) , each 23.76 handpiece ( blue ) , consumable 23.77 fistula and wound management system ( size 104 159 mm ) , consumable 23.78 fistula and wound management system ( size 156 228 mm ) , consumable 23.79 fistula and wound management system ( size 208 297 mm ) , consumable 23.8 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 1x2 approved by us fda ) , consumable 23.81 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 2 x 4 approved by us fda ) , consumable 23.82 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 4 ) , consumable 23.83 v.p.shunt ( medium pressur ) , consumable 23.84 v.p.shunt ( low pressur ) , consumable 23.85 pistol grip curved coagulating shears with ergonomic handle in the following shaft lengths 23 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable 23.86 pistol grip curved coagulating shears with ergonomic handle shaft lengths 45 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable [ 720016 ] 23.87 dissecting hook having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.88 curved blade having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.89 5mm lap dissecting hook ( 32 cm long ) , consumable 23.9 blood culture media aerobic for adult ( bact / alert fa plus ) , each 23.91 blood culture media aerobic for pediatric ( bact / alert pf plus ) , each 23.92 advanced rf energy hand instruments of 5mm shaft diameter for open procedures with shaft ( lengths 14cm and should be both hand & foot activated with curved tip ) , consumable 23.93 blood culture media anaerobic for pediatric ( bact / alert pf plus ) , each 23.94 blood culture media anaerobic for adult ( bact / alert fa plus ) , each 23.95 blood culture media fungus bottles per year, fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.; fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested. ( ) , consumable 23.96 blood culture media mycobacterium spp ( bact / alert mp ( plastic ) ) , each 23.97 individual identification panel for aerobic gram positive organism ( gpid ) , each 23.98 individual identification panel for aerobic gram negative organism ( gnid ) , each 23.99 individual ast panel for gram positive organism ( gp p628 ) , each 24 advanced rf energy hand instruments of ( 5mm shaft diameter for open procedures with shaft lengths 25cm and should be both hand & foot activated with curved tip ) , consumable 24.01 individual ast panel for gram negative organism ( gn n280 ) , each 24.02 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 35cm and should be both hand & foot activated with curved tip ) , consumable 24.03 individual identification panel for anaerobic gram negative organism ( anc ) , each 24.04 individual identification panel for anaerobic gram positive organism ( anc ) , each 24.05 individual identification panel for fungus ( yst ) , each 24.06 individual ast panel for fungus ( ast ys07 ) , each 24.07 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 45cm and should be both hand & foot activated ) , consumable 24.08 advanced rf energy hand instruments of 12mm shaft diameter for open procedures with shaft lengths ( 22cm and should be both hand & foot activated ) , consumable [ 720039 ] 24.09 diltiazem tablet ( 60 mg ) , tablet 24.1 altracurium ( 10mg / ml, 2.5ml vial ) , injection 24.11 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 24.12 paracetamol 150 mg / ml ( 15 ml bottle with dropper ) , drop 24.13 ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop 24.14 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet 24.15 spectra optia collection set, model : 10110 / 10120 ( packing size : 6 kits ) , consumable 24.16 spectra optia exchange set, model : 10220 ( packing size : 6 kits ) , consumable 24.17 optia granulocyte depletion set, model : 10300 ( packing size : 6 kits ) , consumable 24.18 spectra optia platelet kit, model : 10400 ( packing size : 6 kits ) , consumable 24.19 acd a solution 500ml, model : pb 1ac500j8b ( packing size : 2 bags / foil or 12 foils / box ) , consumable 24.2 hpmed solution consumable ( pack size: 16 bottles of 50 ml ) , make polti s.p.a. ; model sani system ( country of origin italy; ) , consumable 24.21 laser fiber for dental laser , make faith inovation ; model fd10b ; ( country of origin india ) , consumable 24.22 sterigen c electrolyte solution one pack of 10 ltr. for sterigen 400 daf , make faith inovation; model sterigen sg 400 daf ; ( country of origin india ) , consumable 24.23 tri iodothyronine ( t3 ) , consumable 24.24 thyroxine ( t4 ) , consumable 24.25 rhyroid stimulating hormone ( tsh ) , consumable 24.26 auto lyser solution for cbc machine ( 500ml ) , consumable 24.27 auto cleanser for cbc machine ( 2 liter ) , consumable 24.28 auto dill solution for cbc machine ( 20 liter ) , consumable 24.29 tranexamic acid ( 5ml ) , injection 24.3 tranexamic amp / vial ( 500mg ) , injection 24.31 serum electrolite na+ k+ kit analizer ( 50 test per kit ) , consumable 24.32 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ( ph neutral contact time 15 se 4. pack size 100 ml & 100 ml with dispensor ) , consumable 24.33 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ph neutral contact time 15 sec 4. ( pack size l& 500 ml with dispensor ) , consumable 24.34 aminoacid ( essential ) infusion ( 10% 100ml glass ffs ) , bottle ] 24.35 curved scissors laparoscopic 5mm size, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving jaws ) , consumable [ 720066 ] 24.36 maryland dissector laparoscopic 5mm curved maryland dissector with tapering end, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving ) , consumable 24.37 grasper laparoscopic 5mm straight 360 degree rotating with insulated shaft, toothed a traumatic grasper with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable [ 24.38 babcock laparoscopic 5mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable 24.39 babcock laparoscopic 10mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable ] 24.4 sutureless dural graft substitute ( 1x3 ) , cons 24.41 sutureless dural graft substitute ( 2x2 ) , consumable ] 24.42 sutureless dural graft substitute ( 3x3 ) , consumable 24.43 sutureless dural graft substitute ( 4x5 ) , consumable 24.44 1%w / v available iodine in a non oxynol with soluble iodine suractant base with sodium iodide ( less than 1% w / v and surfactant less than 5% w / v 500 ml ) , consumable 24.45 sanitary napkins ( as per attached specification / pack of 6 pads ) , consumable [ mis106 ] 24.46 methyl prednisolone ( 8mg ) , tablet 24.47 gentamycin sulphate 0.1% ( 15gm tube ) , ointment or cream [ 120143 ] 24.48 bss solution for opthalmic use ( 500ml ) , sol 24.49 fat emulsion 20% 0.2 ( 250ml ) , injection 24.5 ivf glutamine dipeptide ( 100ml ) , injection 24.51 rangeen baag print kapda ( 60x115 tanaxbana 2 / 20sx10s reedxpeek 36x36 ) , 24.52 rangeen design weft stripe kapda ( 60x115 tanaxbana 2 / 40x 20s, 2 / 6s reedxpeek 52x52 / inch ) , 24.53 rangeen design towel beev kapda ( 1mtrx56 tanaxbana 2 / 20sx10s reedxpeek 36x40 ) , 24.54 baag print kapda fine ( 94x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ) , 24.55 baag print kapda fine 64x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ( ) , 24.56 rangeen baag print kapda 60x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x52 ( ) , 24.57 tericat shirting cloth ( 1 m x 40 inch tana x bana ( 2 / 60s x 2 / 60 p.v.65:35 ) reed x pik ( 68 x 64 / inch ) ) , 24.58 levosalbutamol ( 1.25mg ) , ipratropium ( 500mcg ) respule ( 2.5ml ) , ampule 24.59 formoterol 6mcg + budesonide 200mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.6 salmeterol 50mcg +fluticasone 250 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.61 formoterol 6mcg + budesonide 400mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.62 salmeterol 50mcg +fluticasone 500 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps [ 120781 ] 24.63 blood urea ( arba ) , consumable 24.64 alkaline phosphate kinetic 2*25 ml ( semi auto end point ) , consumable 24.65 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 24.66 clarithromycin ( 500mg ) , injection 24.67 i / v polysacchride or conjugate pneumococcal ( 0.5 ml ) , vaccine 24.68 imipenem 500 mg with cilastatin 500mg ( vial / amp ) , injection 24.69 ivf ( l alanine + l glutamine ) ( 50 ml ) , injection 24.7 surgical spirit ( 450 ml ( isopropyl rubbing alcohol ) ) , consumable 24.71 anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup 24.72 bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule 24.73 griseofulvin ( tablet 250 mg ) , tablet 24.74 budesonide ( inhalation 200 mcg per dose ) , inhaler 24.75 salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule 24.76 dextran 40 i / v 10% ( 500 ml ffs bottle ) , bottle 24.77 aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethecon ( tab 300 mg+50mg + 25 mg+25 mg ) , tablet 24.78 phenylephrin eye drop 2.5 % ( 5 ml vial ) , drop 24.79 calcium with vitamin d3 calcium equivalent to ( 500 mg ) , tablet 24.8 titenium chemo port with silicon catheter ( 8 9.6 fr ) length 60cm 80cm, guide wire, peel away desilet, hubsite needle ( 22 g * 20 25.4mm ) , consumable [ mis137 ] 24.81 single umbilical catheter with leur lock ( fr 3 to fr 3.5 , l 40 cm ) , consumable [ mis112 ] 24.82 alcohal based hand sanitizer ( 500ml bottle with dispenser ) , consumable 24.83 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x1 ( approved by us fda ) , consumable 24.84 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x3.5 ( approved by us fda ) , consumable 24.85 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 3x 4 ( approved by us fda ) , consumable 24.86 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 6x 9 ( approved by us fda ) , consumable 24.87 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 1x2 ( approved by us fda ) , consumable 24.88 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 2x4 ( approved by us fda ) , consumable 24.89 sutureless dural graft substitute ( 2x2 ) , consumable 24.9 sutureless dural graft substitute ( 3x3 ) , consumable 24.91 clip applier laparoscopic 10 mm reusable ligaclip medium / large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.92 clip applier laparoscopic 10 / 12 mm reusable ligaclip large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.93 needle holder laparoscopic 5mm straight reusable needle holder with ratchet mechanism with high quality tungsten plated jaws for enhanced needle grip ( 36 cms metal shaft ) , consumable 24.94 all human ( bovine aprotinin free ) fibrin sealant ( 1 ml ) , consumable 24.95 all human ( bovine aprotinin free ) fibrin sealant ( 2 ml ) , consumable 24.96 polyamide with cd cut needle ( 16 mm length 70 cm â� � 3 / 0 ) , consumable 24.97 polyamide with cd cut r cut extra penetrating needle ( 16 mm length 70cm â� � 4 / 0 ) , consumable 24.98 polyamide with cd reverse 5 / 0 cut needle ( 12 mm length 70cm â� � 5 / 0 ) , consumable 24.99 poly propylene with 1 / 2 circle rbd needle ( 13 mm length 60 cm â� � 5 / 0 ) , consumable 25 poly propylene with rbd needle ( 8 mm length 60 cm â� � 7 / 0 ) , consumable 25.01 poly propylene with 1 / 2 cir cc double needle ( 13 mm ( dential guage needle and suture ) length 75 cm 4 / 0 ) , consumable 25.02 poly propylene with 1 / 2 cir cc double needle ( indentical guage needle and suture ) ( 13 mm length 60 cm 5 / 0 ) , consumable 25.03 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 25 mm length 90 cm 2 / 0 ) , consumable 25.04 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 4 ) , consumable 25.05 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 6 ) , consumable 25.06 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 5 ) , consumable 25.07 polyglecaprone with 1 / 2 cir oval rb contrast needle ( 26 mm length 70 cm 3 / 0 ) , consumable 25.08 sterile raney scalp clips ( ) , consumable 25.09 raney scalp clip forceps ( ) , consumable 25.1 polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , consumable 25.11 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.12 patient drapes ( ) , nasal drop 25.13 bio membrane ( ) , consumable 25.14 polydioxanone with 1 / 2 cir reverse cutting orthopaedic surgery ( os ) nededle ( 40 mm length 90 cm 1 ) , consumable 25.15 collagen dry ( 6x6 cm ) , sheet 25.16 collagen dry ( 15 x 30 cm ) , sheet 25.17 polydioxanone with 1 / 2 cir round body heavy needle ( 40 mm length 90 cm 1 ) , consumable 25.18 collagen dry ( 20 x 40 cm ) , sheet 25.19 collagen wet ( 6x6 cm ) , sheet 25.2 collagen wet ( 10 x 10 cm ) , sheet 25.21 collagen wet ( 15 x 30 cm ) , sheet 25.22 collagen wet ( 20 x 40 cm ) , sheet 25.23 collagen granules ( ) , consumable 25.24 coated polyster braided with cd white d needle ( 25 mm ( curved reverse cutting round body or taper cut ) length 90 cm 2 / 0 ) , consumable 25.25 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 17 mm length 90 cm 25.26 polyglecaprone with 1 / 2 cir oval rb jb needle ( 26 mm length 70 cm 2 / 0 ) , consumable 25.27 polydioxanone with 3 / 8 cir round body needle ( 11 mm length 45 cm 6 / 0 ) , consumable 25.28 coated braided fast absorbing polyglactin 910 sut. ) with 3 / 8 cir cutting needle ( 16 mm length 45 cm size 4 / 0 undyed ) , consumable 25.29 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir round body and 1 / 2 cir reverse cutting double needle ( 36 mm length 140 cm size 2 / 0 undyed ) , consumable 25.3 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir taper cut needle ( 36 mm length 100 cm size 2 / 0 undyed ) , consumable 25.31 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 75 cm size 3 / 0 ) , consumable 25.32 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 2 / 0 ) , consumable 25.33 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 1 / 0 ) , consumable 25.34 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 ) , consumable 25.35 sabourauds dextrose agar powder ( 100gms ) , consumable [ mis104 ] 25.36 nutrient agar ( 500 grm ) , consumable [ mis88 ] 25.37 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 36 mm length 90 cm size 3 / 0 ) , consumable 25.38 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 70 cm size 4 / 0 ) , consumable 25.39 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 90 cm size 2 / 0 ) , consumable 25.4 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 / 0 ) , consumable 25.41 coated braided polyglactin 910 with triclosan coating sut. ) with cd cutting needle ( 22 mm length 45 cm size 3 / 0 ) , consumable 25.42 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 36 mm length 90 cm size 1 / 0 ) , consumable 25.43 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 40 mm length 100 cm size 1 ) , consumable 25.44 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 23 mm length 35 cm size 1 ) , consumable 25.45 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 2 / 0 ) , consumable 25.46 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 / 0 ) , consumable 25.47 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 ) , consumable 25.48 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 15 x 15 cm ) , consumable 25.49 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10x 15 cm ) , consumable 25.5 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.51 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 x 15 cm ) , consumable 25.52 disposable intraluminal stapler curved circular stapler ( 21 mm with controlled tissue compression ) , consumable 25.53 curved circular stapler ( 25 mm with controlled tissue compression ) , cons ] 25.54 curved circular stapler ( 29 mm with controlled tissue compression ) , consumable [ ] 25.55 curved circular stapler ( 33 mm with controlled tissue compression ) , consumable [ 25.56 hemmorhoidal circular stapler 33mm with controlled tissue compression ( leg length of 4mm ) , consumable [ 7 ] 25.57 linear cutter ( of 55 mm with inbuilt selectable staple height ) , consumable 25.58 universal black reload compatible with the ( 55mm linear cutter with inbuilt selectable staple height ) , consumable 25.59 linear cutter of ( 75 mm with inbuilt selectable staple height ) , consumable 25.6 universal black reload compatible with the ( 75mm linear cutter with inbuilt selectable staple height ) , consumable 25.61 5 mm optic view bladeless trocar ( with bilateral tissue separator ) , consumable 25.62 optic view bladeless trocar with bilateral tissue separator ( 11 mm ) , consumable 25.63 optic view bladeless trocar with bilateral tissue separator ( 12 mm ) , consumable 25.64 optic view bladeless trocar with bilateral tissue separator ( 15 mm ) , consumable 25.65 polyglactin 910 with triclosan coating 2 0, 1 / 2 circle round body ( 30 mm, 100 cm ) , consumable 25.66 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle round body ( 40 mm, 100cm ) , consumable 25.67 polyglactin 910 with triclosan coating 1, 1 / 2 circle round body ( 40 mm, 100 cm ) , consumabl 25.68 polyglactin 910 with triclosan coating 1, 1 / 2 circle reverse cutting o.s ( 40 mm, 100cm ) , consumable 25.69 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle reverse cutting o.s ( 40 mm, 100 cm ) , consumable 25.7 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.71 polydioxanone irgacare mp 90cm m4 usp1 sgle armed ctx, i / 2 circle ( 48 mm ) , consumable 25.72 polydioxanone irgacare mp 70cm m3 usp2 / 0 sgle armed ( sh, 1 / 2 circle , round body, 26mm ) , consumable 25.73 polydioxanoneirgacare mp 70cm m2 usp3 / 0 sgle armed ( rb 1, 1 / 2 circle , round 25.74 polydioxanoneirgacare mp coated ( 150cm usp1 0 rb ctx, i / 2 circle, 48mm ) , consumable 25.75 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.76 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400080 ] 25.77 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400081 ] 25.78 polyglactin 910 with triclosan coating ( 4 0, 1 / 2 circle round body, 20 mm, 70 cm ) , consumable [ 7400082 ] 25.79 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh ( size 15 x 15 cm ) , consumable [ 7400083 ] 25.8 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10 x 15 cm ) , consumable 25.81 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.82 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 15 cm ) , consumable ] 25.83 2 octyl cynoacrylate propen, topical skin adhesive ( 0.5ml ) , consumable 25.84 non absorbable ( 10 0 ) monofilament polymide black 6mm 3 / 8 circle spatulated micro point doublw arm ( 38 cm ) , consumable 25.85 absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 cm ) , consumable 25.86 non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable 25.87 absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable 25.88 non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable 25.89 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.9 suture copolymer of glycolide and ecaprolactone ( 2 0, , 20cm, 26mm, 20 anchors / inch unidirectional ) , consumable 25.91 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400095 ] 25.92 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400096 ] 25.93 composite mesh polypropylene and polyglactine 910 ( 6x11 cm ) , consumable 25.94 composite mesh polypropylene and polyglactine 910 ( 10x15 cm ) , consumable 25.95 blood agar powder ( 500 grm ) , consumable [ mis19 ] 25.96 composite mesh polypropylene and polyglactine 910 ( 15x15 cm ) , consumable 25.97 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 24x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.98 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 14x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.99 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 15 cm ) , consumable 26 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 20 cm ) , consumable [ 26.01 polyglactin 910 with triclosan ( irgacre mp ) coating 2 0, 1 / 2 circle round body ( 30 mm 90 cm ) , consumable 26.02 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.03 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.04 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.05 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 1 / 2 circle round body ( 20 mm 90 cm ) , consumable 26.06 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.07 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 3 / 8 circle reserve cutting ( 26 mm 70 cm ) , consumable 26.08 8 0 double arm nylon monofilament with ( 3 / 8circle taper point needle ) , consumable 26.09 polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , consumable [ 7410013 ] 26.1 polyglactin 8mm 1 / 4 , circle spatulated micro point double needle ( length 45 cm size 6 0 ) , consumable 26.11 10 0 double arm nylon monofilament with ( 3 / 8 circle taper point needle ) , consumable 26.12 opsite dressing ( 15x28 ) , consumable 26.13 collagen dry sheet ( 10x10 cm sheet ) , consumable 26.14 collagen dry sheet ( 15x30 cm sheet ) , consumable 26.15 collagen dry sheet ( 20x40 cm sheet ) , consumable 26.16 oxidised cellulose absorbable hemostate ( 2x3 ) , consumable 26.17 oxidised cellulose absorbable hemostate ( 4x8 ) , consumable 26.18 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.19 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.2 oxidised regenerated cellulose absorbable hemostate ( 1x2 ) , consumable 26.21 oxidised regenerated cellulose absorbable hemostate ( 2x4 ) , consumable 26.22 oxidised regenerated cellulose absorbable hemostate ( 4*4 ) , consumable 26.23 dura patch ( g.patch ) ( 8x10 ) , consumable 26.24 dura patch ( g.patch ) ( 10x12 ) , consumable 26.25 incise drape mini ( 10x10 cm ) , consumable 26.26 opsite dressing ( 30x28 ) , consumable 26.27 tube ex changer and insertion aid in one size ( 2.5, 6.0 ) , consumable 26.28 soft and gentle adhesive for sealing area around stoma ( 60 gm ) , consumable 26.29 absorbent powder for covering excoriated / damaged skin around stoma ( size 25 gm ) , consumable 26.3 1 pc self adhesive drainable stoma bag for colostomy & illeostomy swiss roll self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 75mm ) , consumable 26.31 1 pc self adhesive drainable stoma bag for colostomy & illeostomy double layered self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 76 mm ) , consumable 26.32 1 pc self adhesive drainable stoma bag for urostomy with no return valve and easy flexible outlet ( 15 45mm ) , consumable 26.33 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 40 mm ) , consumable 26.34 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 50 mm ) , consumable 26.35 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 60 mm ) , consumable [ 7410038 ] 26.36 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 70 mm ) , consumable 26.37 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 40 mm ) , consumable 26.38 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 50 mm ) , consumable 26.39 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 60 mm ) , consumable 26.4 tooke corneal knife ( num ) , consumable 26.41 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 70mm ) , consumable 26.42 flexible self adhesive protective sheet to prevent excoriation ( 20x20 cm ) , consumable 26.43 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 26.44 e.d.t.a. vacunater with needle ( 3 ml ) , consumable 26.45 plain vial with screw cap ( 12x75 ) , consumable 26.46 barraquer wire speculum, large ( num ) , consumable 26.47 disposable cresent knife ( 2.2mm ) , consumable 26.48 disposable keratom knife ( 2.8mm ) , consumable [ mis40 ] 26.49 disposable keratom knife ( 3.2mm ) , consumable [ mis41 ] 26.5 disposable sideport knife ( num ) , consumable 26.51 k wire ( length 375mm size:1.6mm roll ) , consumable 26.52 k wire ( length 375mm size:1.8mm roll ) , consumable 26.53 simcoe i / a cannula, direct, ( num ) , consumable [ mis110 ] 26.54 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable [ mis20 ] 26.55 malaria bivalent antigen detecting rapid diagonstic tests ( rdts ) for p.f and pv ( 10 card, 10 apillary, 1 buffer solution, 10 alcohol swab, 10 sterile lancet for pricking, ( as per attached specification ) ) ( pack of 10 test.total tests:1cr, rate shall be quoted for pack of 10 ) , consumable [ 7004051 ] 26.56 rpr test kit ( 100 test ) , kit [ mis103 ] 26.57 set of phaco tip and test chamber ( phacoemulsification machine ) , consumable 26.58 test chamber sleeves ( 1 set consist of 2 pieces ) ( phacoemulsification machine ) , consumable 26.59 sets of i a system ( phacoemulsification machine ) , consumable 26.6 disposable cassette ( phacoemulsification machine ) , consumable 26.61 hb electrophoresis ( 200 test ) , consumable 26.62 protein electrophorosis in blood ( serum ) , urine , csf ( 200 test ) , consumable 26.63 conventional medical x ray film polyster based imaging film 35.6cmx43.2cm ( 14x17 ) ( size 50 sheet in one packet ) , consumable 26.64 conventional medical x ray film polyster based imaging film 35.6cmx35.6cm ( 14x14 ) ( size 50 sheet in one packet ) , consumable 26.65 conventional medical x ray film polyster based imaging film 30.5cmx30.5cm ( 12x12 ) ( size 50 sheet in one packet ) , consumable [ 7004063 ] 26.66 conventional x ray film 12x15 ( 50 sheet / pack ) , consumable 26.67 conventional x ray film 10x12 ( 50 sheet / pack ) , consumable 26.68 conventional x ray film 8x10 ( 50 sheet / pack ) , consumable [ 7004066 ] 26.69 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 26.7 anastrozole tablet ( 1 mg ) , tablet 26.71 ppe kit ( as per attached specification ) , consumable 26.72 chewable antacid containing magnesium hydroxide minimum 250mg to 500mg+aluminimum hydroxide minimum 250mg to 500mg +simethecon / dimethicon minimum 25mg to 50mg tab ( additional component will also be accept ) , tablet 26.73 etanercept 25mg / vial ( pack of 2 vials ) , injection 26.74 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 26.75 oxygen cylinder with instrument set for oxygen delivery b type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.76 oxygen cylinder with instrument set for oxygen delivery d type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.77 m 30 d diluent ( 20ltr ) , consumable 26.78 m 30 r rinse ( 20ltr ) , consumable 26.79 filter for complete pulmonary function testing ( including dlco ) with body box ( 100 filters per pack, make medisoft sa ) , consumable 26.8 needle no 2 ( 1.5 ) , consumable 26.81 ophthalmic needles ( ) , consumable 26.82 silk suture ( 9 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.83 silk suture ( 10 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.84 chloranphenicol + dexamethasone ( 5ml ) , ointment 26.85 chloranphenicol 1% + dexamethasone 0.1% ( 5ml vial ) , eye drop 26.86 prednisolone acetate ( 1% 5ml / 10ml ) , eye drop 26.87 nepafenac ( 1mg / ml ) , eye drop 26.88 artificial tear ( 5ml ) , eye drop 26.89 sprit ( 450ml ) , solution 26.9 sensoracaine injection 0.25% ( 30ml ) , injection 26.91 hylase inj ( 1500iu ) , consumable 26.92 hpmc ( hydroxy propylmetty cellulose ) ( 5ml ) , injection 26.93 sinskey ii lens manipulating hook ( angled ) , consumable 26.94 nightingale capsule polisher ( posterior ) , consumable 26.95 castroviejo caliper ( straight ) , consumable 26.96 colibri forceps 1x2 teeth ( 0.12 mm ) , consumable 26.97 mc pherson tying forceps ( long handle ) , consumable 26.98 mc pherson forceps ( 11 mm angled ) , consumable 26.99 vannas capsulotomy scissors ( angled forward 11 mm blade ) , consumable 27 bard parker handle ( handle ) , consumable 27.01 anterior chamber washout cannula ( 16 g ) , consumable 27.02 pearce hydrosdissection cannula ( 35 inc ang 25 g ) , consumable 27.03 kellan hydrodelineation ( curved bevel tip 25g ) , consumable [ 750018 ] 27.04 jensen capsule polisher ( sand blast olive tip 23g ) , consumable 27.05 knolle pearce irrigating vectis ( ) , consumable 27.06 sterlization box with two sillicon mats ( ) , consumable 27.07 kratz barraquer wire speculum ( big ) , consumable 27.08 castoviejo cyclodialysis spatula ( 0.50 mm wide ) , consumable [ 750023 ] 27.09 utrata capsulorhexis forceps ( flat handle ) , consumable 27.1 eye scissors straight ( 4 1 / 2 lenth ) , consumable 27.11 kramer corneal fixation forceps ( ) , consumable 27.12 air injection canula ( 27g ) , consumable 27.13 desmarres lid retractor ( size 0 ) , consumable [ 750028 ] 27.14 ranibizumab 10mg / ml injection ( intenvitral 0.25ml ) , injection 27.15 prochlorperazine tab ( 5mg ) , tablet 27.16 bed sheet colored 60x90 ( 60x90 ) , consumable 27.17 blanket cover 54x90 ( for cover of above size blanket ) , consumable 27.18 blanket cover 60x90 ( for cover of above size blanket ) , consumable 27.19 mattress cover 3x6 ( for cover of above size mattress ) , consumable 27.2 livery set pants and shirt without stitching ( 3 meter cloth ) , consumable 27.21 ladies livery set saree white polyester green / blue border with blouse ( 6.50 mtr ) , consumable 27.22 surgeon gown ( std size ) , consumable 27.23 micro pipette tips 5 300ul ( 100 per pack ) , consumable 27.24 collection tube polystrene ( 100 per pack ) , consumable 27.25 baby suit plain phalalane suit ( 5 peace ) , consumable 27.26 gram staining kit ( crystal ) ( 125ml x 4 ) , consumable 27.27 acid fast staining kit ( carbol ) ( 125ml x 3 ) , consumable 27.28 widal slide test ( 4x5ml with control ) , consumable 27.29 hbv elisa test kit pack size : 96 wells per kit ( rate should be quoted for 1kit containing 96 27.3 hbv rapid test kit quantity is in no. of test card only ( and rate should be quoted for one test card ) , consumable 27.31 torsemide ( 20mg ) , tablet 27.32 temephose 50% ec ( 5 litre ) , chemical 27.33 bti 5% as ( biolarvicide ) , consumable 27.34 diflubenzuron 25% wp ( chemical larvicide ) , consumable 27.35 cyphenothrin 5% ec ( spray ) , consumable 27.36 technical malathion ( spray ) , consumable 27.37 triple sugar iron agar ( 100gm pack ) , consumable 27.38 selenite f broth ( 100gm pack ) , consumable 27.39 nutrient broth ( 500 gm ) , consumable 27.4 muller hinton agar ( 500 gm ) , consumable 27.41 sabroud dextrose agar with chlorophenicol ( 100 gm ) , consumable 27.42 simmons citrate agar ( 100 gm ) , consumable 27.43 brain heart infusion broth ( 500 gm ) , consumable 27.44 columbia blood agar base ( 500 gm ) , consumable 27.45 cled agar ( 500 gm ) , consumable 27.46 glucose phosphate broth ( 100 gm ) , consumable 27.47 cristensens urea agar base ( 100 gm ) , consumable 27.48 salmonella shigella agar ( 100 gm ) , consumable 27.49 cary blair medium base ( 100 gm ) , consumable 27.5 tcbs agar ( 100 gm ) , consumable 27.51 bile salt agar ( 100 gm ) , consumable 27.52 bile esculin agar ( 100 gm ) , consumable 27.53 cetrimide agar ( 100 gm ) , consumable 27.54 cedar wood oil ( 125 ml ) , consumable 27.55 amikacin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.56 imipenem 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.57 co trimoxazole ( sulpha / trimethoprim ) 25 mcg ( 23.75 / 1.25 ) ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.58 nitrofurantion 300 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.59 nalidixic acid 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.6 amoxyclav ( amoxycillin / clavulanic acid ) 20 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.61 gentamicin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.62 ciprofloxacin 5mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.63 ceftriaxone 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.64 cefuroxime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.65 teicoplanin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.66 piperacillin 100 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.67 norfloxacin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.68 colistin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.69 cefoperazone 75 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.7 piperacillin / tazobactam 100 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.71 ceftazidime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.72 cefazoline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.73 ampicillin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.74 tobramycin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.75 polymyxin b ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.76 doxycycline hydrochloride 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.77 chloramphenicol 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.78 tetracycline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.79 azithromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.8 levofloxacin 5 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.81 erythromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.82 clindamycin 2 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable [ 121051 ] 27.83 penicillin 10 units ( 50 100 disc per pack ) , consumable 27.84 vancomycin 30 mcg ( 50 100 disc per pack ) , consumable 27.85 cisplatin 0.5 mg / ml injection ( 20 ml vial ) , injection 27.86 clonidine 150 mcg / ml ( injection 1 ml amp ) , injection 27.87 clonidine hydrochloride ( 500 mcg injection vial / amp ) , injection 27.88 dextrose d 50 0.5 infusion ( 500 ml ffs bottle ) , infusion 27.89 dicyclomine hydrochloride 10 mg / ml ( injection 2 ml vial ) , injection 27.9 electrolyte e ( multiple electrolytes and dextrose injection type v ip ) type v ip infusion ( 500 ml ffs bottle ) , infusion 27.91 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) type iv ip infusion ( 500 ml ffs bottle ) , infusion 27.92 etophylline + theophylline ( 46.5 + 40 ) ( mg / 5 ml syrup 100 ml bottle ) , syrup 27.93 heparin 25000 iu injection ( 5 ml ) , injection 27.94 formoterol + fluticasone 250 mg + 500 mg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 27.95 heparin sodium + benzyl nicotinate 50 iu + 2 mg ( ointment 20 gm ) , ointment 27.96 homatropine 2 % ( eye drops 5 ml ) , eye drop 27.97 hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion i / v hydroxyethylstarch 6% solution with sodium chloride 0.9% ( infusion 500 ml ffs bottle ) , infusion 27.98 iron & folic acid 20 mg / ml + 100 mcg / ml syrup ( 50 ml with dropper ) , syrup 27.99 ivf hydroxy ethyl starch 3% injection ( 500 ml ) , injection 28 levobupivacaine 0.01 injection ( vial ) , injection 28.01 levosalbutamol + ipratropium 100 mcg + 40mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.02 levosalbutamol 1 mg / 5 ml ( syrup 100 ml ) , syrup [ 121081 ] 28.03 levosalbutamol 100 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.04 lignocaine spray 0.1 spray ( 100 ml ) , miscellaneous 28.05 lignocaine spray 2 % spray ( 30 ml ) , spray 28.06 linazolid 200 mg / 100 ml infusion ( 300 ml ) , infusion 28.07 liposomal doxorubicin ( 20 mg injection vial ) , injection 28.08 liquid fluoxetine ( 20 mg / 5 ml liquid 30 ml ) , liquid 28.09 liquid risperidone ( 1 mg / ml liquid 60 ml ) , liquid 28.1 morphine sulphate ( 30 mg ) , tablet 28.11 afatinib ( 40 mg ) , tablet 28.12 albendazole + ivermectin ( 400mg + 6mg ) , tablet 28.13 chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tablet 28.14 artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ( 50 mg ( 3 tab ) � � � � � � + 500 mg ( 2 tab ) + 25 mg ( 2 tab ) tablet 1 combi pack ) , tablet 28.15 artesunate + sulphadoxine + pyrimethamine ( age group of less than 1year ) ( 25 mg ( 3 tab ) + 250 mg ( 1 tab ) + 12.5 mg ( 1 tab ) tablet 1 combi pack ) , tablet 28.16 rifampicin + ethambutol + isoniazid pyrazinamide ( 150 mg + 225 mg + 400 mg + 750 mg ) , tablet [ 120801 ] 28.17 lactic acid bacillus ( 5 mg ) , tablet [ 120805 ] 28.18 chloramphenicol + dexamethasne ( 1% + 0.1% ) ( 5 ml ) , eye ointment [ 120682 ] 28.19 chlorpheniramine melate + phenylephrine ( 5 mg + 2 mg each 5ml infusion 100 ml bottle ) , infusion 28.2 isoniazid ( 100mg ( as per attached specification ) ) , tablet 28.21 isoniazid ( 300 mg ( as per attached specification ) ) , tablet 28.22 adenosine ( 2 ml amp ) ( 3 mg / ml ) , injection 28.23 disposable needle 20 g no ( isi marked needle ) , consumable 28.24 polyester braided coated with cd white dn 17 mm taped cut 90 cm 2 / 0 ( 12 foils / pkt ) ( surgical suture ) , consumable 28.25 gauge than ( 91cm x 20 mtr ) , consumable 28.26 chlorhexidine gluconate ( antiseptic ) ( 0.004 solution 500 ml bottle ) , solution 28.27 lmwh low molecular weight heparin inj ( 4000iu / ml. injection 4000iu / ml injection solution for ) , injection solution for 28.28 lmwh low molecular weight heparin inj. 6000 x 000d iu / ml, injection ( injection solution for 6000 x 000d iu / ml ) , injection solution for 28.29 lysol ip ( cresol with soap solution ) 5ltr jar ( medicine 5ltr jar ) , liquid 28.3 lysol ( cresol with soap solution ) 53% + 47% ( solution 5 ltr ) , liquid 28.31 magnesium hydroxide ( syrup 400 ml ) , syrup 28.32 meropenem + sulbactum ( 1 gm + 500 mg ) ( 1.5 gm injection vial ) , injection 28.33 micronised progestrone 50 mg / ml ( injection 2 ml amp ) , injection 28.34 milk of magnesia + liquid paraffin + phenolphthalein ( cremaffin pink formula ) ( ( 11.25 ml + 3.75 ml + 50 mg ) / 15 ml syrup 170 ml bottle ) , syrup 28.35 multi vitamin each ml containvit a 3000 iu vit b1 1mg riboflavin phosphate sodium 2mg, panthenol 2.5mg niacinamide 10mg pyridoxin 1 mg cynacobalamine 1mcg lysine 10 mg ( 15ml oral drop 15ml ( with dropper, which should be able to screw & cap the bottle ) in unit carton ) , drop 28.36 neomycin + bacitracin zinc + sulphacetamide sodium ( 5 mg + 250 unit + 60 mg powder 10 gm ) , powder 28.37 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) powder 10 gm ) , powder 28.38 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) ointment 28.3 gm ) , ointment 28.39 neomycin sulphate + bacitracin zinc ( 5 mg + 500 iu / gm ointment 15 gm ) , ointment 28.4 nicotinamide + folic acid + cyanocobalamin 200 mg + 15 mg + 500 mcg ( injection 10 ml ) , injection 28.41 nicotine 14 mg transdermal patch ( strip ) , transdermal patch 28.42 nicotine 2 mg gum ( strip ) , gum 28.43 nicotine 2 mg lozenges ( strip ) , lozenges 28.44 nicotine 4 mg gum ( strip ) , gum 28.45 nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml injection ( 5 ml amp ) , injection 28.46 paracetamol for iv 10 mg / ml infusion ( 100 ml ffs bottle ) , infusion 28.47 pilocarpine 0.02 eye drops ( 5 ml vial ) , eye drop 28.48 cyproheptadine hcl ( 200ml syrup ) , syrup 28.49 bisacodyl ( 10 mg ) , suppository 28.5 basal insulin glargin ( 40 iu / ml vial / cartridge ) , injection 28.51 basal insulin glargin 300 iu injection penfill 300 iu with free permanent pens one pen for ( each five cartridge and 10 needles per pen ) , injection 28.52 biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin 70% isophane insulin ) ( 40 iu / ml 10ml vial ) , injection 28.53 bethanechol ( 25mg ) , tablet [ 120806 ] 28.54 ciprofloxacin 0.003 ( 3 / 3.5 gm ) , eye ointment 28.55 alkaline citrate with potassium ( sodium citrate 1gm + potassium citrate 0.65gm +citric acid 1gm ) / ) ( 10ml oral solution 100ml bottle ) , solution 28.56 benzyl nicotinate topical + heparin topical ( 2mg + 50iu ( 20gm ) ) , ointment 28.57 calcium dobusulate calcium dobesilate + lignocaine + hydrocortisone + zinc oxide ( 0.25% + 3% + 0.25% + 5% w / w ( 30 gm ) ) , cream 28.58 calcium dobusulate ( 500 mg ) , capsule 28.59 folic acid + l glutamic acid + pyridoxin + thiamine ( 1.5mg + 45mg + 5mg + 5mg ) , tablet 28.6 iron and folic acid sugar coated pink ( as per nipi guidelines ) ( 45mg + 0.4mg ) , tablet 28.61 surgical suture ( ) , consumable 28.62 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens ( one pen per five cartridges and ten needles per pen 300iu injection vial / amp ) , injection 28.63 povidone iodine vaginal ( 200 mg ) , pessary 28.64 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , suspension 28.65 salmetrol + fluticasone 250 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.66 salmetrol + fluticasone 500 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.67 terbutaline suplhate 0.5 mg / ml ( injection 1 ml amp ) , injection 28.68 tiotropium 9 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.69 torasemide 10 mg / ( vial injection vial ) , injection 28.7 vitamin k 1 mg / 1 ml injection ( 1ml amp ) , injection 28.71 acetaminophen + tramadol hydrocloride 325 mg + 37.5 mg ( tablet 10 x 10 ) , tablet 28.72 frusemide + amiloride 40 mg + 5 mg ( tablet 10 x 10 ) , tablet 28.73 potassium chloride 175 mg tablet ( strip ) , tablet 28.74 prazosin 1 mg ( tablet 10 x 10 ) , tablet 28.75 rifampicin + isoniazid 450 mg + 300 mg capsule ( 750 mg ) , capsule 28.76 theophylline + etophylline ( 35mg ) + ( 115mg ) ( 150mg tablet strip ) , tablet 28.77 dextrose, d 50 0.5 infusion ( 100 ml ffs bottle ) , infusion 28.78 dextrose, d 50 50% injection ( 10 ml amp ) , injection 28.79 isoxsuprine hcl 40 mg injection ( vial / amp ) , injection 28.8 liquid piracetam 500 mg / 5 ml ( liquid 100 ml ) , liquid 28.81 nacl drip 3 % infusion ( 100 ml ffs bottle ) , infusion 28.82 saline ( nacl ) 0.9 % nasal drops ( 10 ml ) , nasal drop 28.83 theophylline + etophylline ( 25.3mg ) + ( 84.7mg ) injection ( 2 ml ) , injection 28.84 synthetic pyrethrum ( 5% ) , solution 28.85 temephos ( 5% ) , solution 28.86 dextran 40 0.4 injection ( 500 ml ) , injection 28.87 dextran 70 0.06 infusion ( 500 ml ffs bottle ) , infusion 28.88 tinidazole i.v. 2 mg / 1ml infusion ( 400 ml ) , infusion 28.89 ambu bag / adult each 1000 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c ) should be multiple times autoclavable ) , consumable 28.9 tranexamic acid 500 mg / 5ml injection ( 5 ml amp ) , injection [ 121094 ] 28.91 blood bag double 350ml ( as per attached specification ) , each [ 121210a ] 28.92 blood bag triple 350ml as per attached specification ( each ) , bag 28.93 blood bag triple sagam 450ml ( as per attached specification ) , each 28.94 blood bag triple sagam 350ml ( each ) , bag [ 121212 ] 28.95 single blood bag ( as per attached specification ) , each 28.96 i.v cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) consumable ( each ) , consumable 28.97 i.v cannula ( two way ) size ( 16 nos ) , consumable 28.98 i.v cannula size with inj. valve ( port ) ( 22g ) , consumable 28.99 quadruple blood bags as per attached specification ( each ) , consumable 29 placenta extracts ( 0.1gm vial / amp ) , injection 29.01 ambu bag ( silicon type ) paediatrics each 300 500 ml with oxygen connecting tube, should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c, should be multiple times autoclavable ) , consumable 29.02 b.b silk ( 12 foils / pkt ) ( 3 / 8rcut needle 45mm length 76cm, size 2 / 0 ) ( consumable ) , consumable 29.03 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6 inch / pair ( pair ) , consumable 29.04 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6.5 inch / pair ( pair ) , consumable [ 13002 ] 29.05 polyamide mono filament ( nylon ) with cd cut needle 20 / 16 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) , consumable [ 121206 ] 29.06 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable [ 13003 ] 29.07 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7.5 inch / pair ( pair ) , consumable [ 13004 ] 29.08 black braided silk with 1 / 2 cir cutting needle 16mm length 75cm size 3 / 0 ( 12 foils / pkt ) , consumable [ 121207 ] 29.09 draw sheet ( each ) one side linen and one side autoclavable water proof sheet size 58x36 ( each ) , consumable [ 13005 ] 29.1 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } with 31g needle ( single unit pack ) is marked, 40 iu ( each ) , consumable [ 13006 ] 29.11 insulin syringe with 31g needle ( single unit pack ) is marked, 100iu, { auto disabled ( ad ) / re use prevantion ( rup ) syringe ( each ) , consumable 29.12 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } / each ( graduation upto 100 units ) 30g needle, 40 units / ml ( 30 g needle, 40units / ml ) syringe ( each ) , consumable 29.13 mackintosh ( as per attached specification ) , quantity amended as 300000 meter i.e 15000 roll of 20 meter roll, rate should be quoted for 20 meter, is 8164 1976 or conforming to is 8164 1976 ( roll ) , consumable 29.14 vial 5ml, vial test tube, leak proof, ungraduated, polypropylene / polyethylene capacity 5ml each ( each ) , consumable 29.15 solubility test kit ( for sickle cell ) , 50 test / kit, as per attached specification, control sample is not mandatory acessories required 1. dropper 2.test tube ( standard size ) / vial 3. reading stand 4.micropipette with tip / capillary tube 5.lancet ( 6.alcohol swab , kit ) , kit 29.16 nestroft test kit ( for thalasemia traits ) , 50 test / kit, as per attached specification ( kit ) , kit 29.17 screw cap vial with o ring ( 2ml ) , screw cap, leak proof self standing / flat bottom with o ring, un graduated, polypropylene / polyethylene, 2ml capacity each ( each ) , consumable 29.18 steralised and autoclavable culture tube flat bottom, 5ml ( plastic ) ( each ) , consumable 29.19 recombiant fviii ( 1000 iu / vial ) , vial 29.2 bone wax sterilised ( 2.5 gm / packet ) ( consumable ) , consumable 29.21 formaline 37% ( 500 ml bottle ) , consumable 29.22 iv cannula with inj.valve ( port ) ( size 26g each consumable ) , consumable 29.23 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 18 ) ) , consumable 29.24 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 20 ) ) , consumable 29.25 radio opague catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 22 ) ) , consumable 29.26 safe delivery kit 1 plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) face mask 2 free size ( 4 ) plastic disposable cap ( non woven plastic laminated, leak proof ) ( ( 1pair, ( 5 ) long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) ( 6 ) disposable shoe covers till calf ( plastic ) 2pair umbical cord clamps plastic material ( 1pair ) ( free size ) ( as per attached specification ) ) ) , consumable 29.27 potassium free, hemodialysis fluid for bicarb made ( ( part a 10 ltr +part b 500gm2 / pkt ) ) , consumable 29.28 potassium free, hemodialysis powder for bicarb made ( ( part a powder to make 10 ltr +part b 500gm 2 / pkt ) ) , consumable 29.29 uric acid ( 50 ml ( 2 x 25 ml ) , consumable 29.3 disposable syringe { auto disabled ( ad ) / re use prevantion ( rup ) syringe } ( ( for vitamin k inj ) ( 1ml with needle 26g ) ) , consumable 29.31 albumin reagent kit, 200ml ( 4*50 ml ) , consumable 29.32 electric cautery lead / each disposable electro surgical pencil 4cm ( each ) , each 29.33 glycrine i.p. ( 400 gm ) , solution 29.34 glycrine i.p. ( 50 gm ) , solution 29.35 polybutester with polytribolate coating 7 0 60 cm, blue 8 mm 3 / 8 circle ( taper point double arm ) , surgical material 29.36 long term absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry 0, 30 cm ( green 37 mm 1 / 2 circle taper point ) , sutures 29.37 monofilament glycomer 1 , 90 cm ( violet 40mm 1 / 2 circle taper point ) , sutures 29.38 hemorrhoid stapler 33 mm diameter with detachable anvil ( staple height 3.5 mm ) , sutures 29.39 reusable gastro intestinal anastomotic stapler 60 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.4 reusable gastro intestinal anastomotic stapler 80 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.41 medium wound protector ( 5 9 cm ) , sutures 29.42 3 dimensional polyester mesh with micro porosity ( x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15 cm circular with nylon prefixed sutures ) , consumable 29.43 polyester self gripping mesh with poly lactic acid for open incisional hernia repair ( size 15 x 15 cm ) , consumable 29.44 titanium non absorbable 5 mm ( helical tacker for mesh fixation with 30 tacks ) , consumable 29.45 ag ion impregnated central venous triple lumen polyurethane catheter ( 7.5 fr, g 14x18x18 length 16 cm ) , consumable 29.46 therma coal box ( box ) , consumable 29.47 potassium di chromate ( chornicals formula:k2cr207, formula wt:294.2, minimum assay 99.5% 1kg ) , consumable 29.48 phenolic compounds containing disinfectants ( houschold disinfectant, containing ohcnolic compounds such as monochlorophenol, coal tar acid, oils and mulsifiers etc.the approx content of phenolic compounds should be at least 40% 5 ltrs ) , consumable 29.49 basie fuchsin chemical name:pararosaniline hydrochloride, chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green ( 25 gms glass bottle ) , consumable 29.5 sulphuric acid ( chemicals name sulphuric acid formula wt:98.08, specific gravity 1.84 minimum assay 98% 500ml ) , consumable 29.51 malachit green ( malachit green hydro chloride, chemical structure:c23h25ctn2 molecular wt 364.9 colour green dye co ) , consumable 29.52 methylene blue ( methylene thionine chloride, chemical structure:c23h25cin3s molecular wt:319.9 dye content:approx 82% ( dye content must be mentioned ) ) , consumable 29.53 hydrochloric acid ( concentrated hydro chloric acid molecular wt;36 46 specific gravity 1.18 1ltr ) , consumable 29.54 porassium permanganate ( kmno4 formula wt;158 500gms ) , consumable 29.55 auramine ( c17h22cin3 mol wt:303.84 25 gms ) , consumable 29.56 liquid paraffin ( heavy grade ) ( refractive index of 1.48 it should be colourless odurless transparent free from fluorescene in day light with relative density of 0.5 50 ml ) , consumable 29.57 sodium citrate ( trisodium citrate dihydrate, ar grade chemical structure na3c6h5o7.2ho molecular wt ( fw ) 294.10purity 500 gms ) , consumable 29.58 potassium phosphate ( potassium di hydrogen ortho phosphate kh2po4 molecular wt:136.1 minimum assay 99% 1kg ) , consumable 29.59 magnesium sulphate ( mgso4 7h2o;mol wt 246.48;purity 99.5% 1kg ) , consumable 29.6 magnesium citrate ( tribasic; c12h10mg3o14.9 h2o mol wt:613.28 500 gms ) , consumable 29.61 l asparagine monohydrate ( c4h8n23.h2o mol wt: 150.14 25 gms ) , consumable 29.62 glycerol ( ch2ohchohch2oh mol wt:92.1 purity 99.5% 1 ltr ) , consumable 29.63 sodium hydroxide pellets ( naoh formula wt:40 minimum assay:98% 500gm ) , consumable 29.64 cetyl pyridinium chloride ( chemical structure: c21h38cin.h2o / 358 500gms ) , consumable 29.65 sodium chloride ( chemical structure: nac1 molecular weight:58.44 minimum assay:99.9% 1 kg ) , consumable 29.66 dihydrostreptomycin sedquisulphate ( sigma d 7253 25 gms ) , consumable 29.67 isonicotinic acid hydarazide ( sigma i 3377 25 gms ) , consumable 29.68 rifampicin ( sigma r 3501 25 gms ) , consumable 29.69 ethambutol dlhydrochloride ( sigma e 4630 25 gms ) , consumable 29.7 pnb ( para nitro benzonic acid formula wt: 167.12 min assay 99% c6h4coohno2 100 gms ) , consumable 29.71 cyanogen bromide ( cnbr cisco research lab:mol wt:105.9 100 gms ) , consumable 29.72 o tolidine a.r ( dimethyl benzidine: c14h16n2 from wt 212.3 ) , consumable 29.73 hydrogen peroxide ( ar or gr grade assay 29 32% solution fw 34.01 1 ltr ) , consumable 29.74 tween 80 ( polyoxyethylenesorbitanmoonooleate ar or gr grade density 1.06 1.09g / ml 500 ml ) , consumable 29.75 oxalic acid ( pure ) ( coohcooh.2h2 mol wt:126.07 purity 99.8% 500gms ) , consumable 29.76 absolute alcohol ( ethanol 1 ltr ) , consumable 29.77 liquor ammonia ( lr / gr grade 1ltr ) , consumable 29.78 sodium carbonate ( na2co3 wt: 106 minimum asay 99% 500 gms ) , consumable 29.79 n n dimethyl formamide ( hcon ( ch3 ) 2 mol wt:73.09 500 ml ) , consumable 29.8 formaldehyde ( hcho mol wt 30.03 wt per ml at 20oc 1.075 1.095g; methanol contant 10 15% assay ( acidimetric ) as hcho 37 11% 1 ltr ) , consumable 29.81 spare caps for universal containers ( spare caps with liner for universal containers 28 ml wide neck pack of 100 nos ) , consumable 29.82 diamond marker pencil ( 6 holder with artificial diamond ( hard stone ) embedded at one end with screw cap to mark on microscope glass slides 6 nos ) , consumable 29.83 grease marking pencil ( mps, blue or red coloured, length to write on glass ware / metal surfaces 8 nos ) , consumable 29.84 cotten ( absorbent, each roll of 0.5 kg 10 rolls ) , consumable 29.85 filter paper ( filter paper no 1, 12.5 cms diameter for filtering carbot fuchsin using a small funnel of 10cm maximum diameter smooth on one 120 packs ) , consumable 29.86 brown paper for packing ( 115 cm.x 75 cm size sheets 75 sheets ) , consumable 29.87 non absorbent cotton ( non absorbent cotten rolls of 1 / 2 kg cach surgical grade 4kg ) , consumable 29.88 lens paper ( soft microsope lens cleaning tissue, 4x6 booklet each booklet containning 100 sheets 50 booklets ) , consumable 29.89 slides ( glass microscope slides 76mm x 26mm x 1.3mm, plain one pack of 50 slides 50 packs ) , consumable [ 121178 ] 29.9 test tubes ( glass autoclavable and heat resistant standerd rimless 150 x 16mm with screw caps 1 ) , consumable 29.91 loop wire ( nichrome wire 24 standard wire gauge ( swg ) or 0.002 inches or 0.559 mm thickness swg 10 metres ) , consumable 29.92 glass beads ( acid washed 3mm diameter round transpatent for dispersing the clumps of microorganisms by vortexing or blending 500 29.93 bijou bottles ( borosilicate or corning glass of 5 ml capacity witj screw caps of aluminium with rubber liners suitable for bijou bottles, leak proof 250 ) , consumable 29.94 spare caps for bijou bottles ( screw caps of aluminium with rubber liners suitable for bijou bottles 500 ) , consumable 29.95 alcohol ( 500ml ) , consumable 29.96 basie fuchsin ( 25 gm glass bottle ) , consumable 29.97 carbolic acid phenol ( 500ml ) , consumable 29.98 falcon tube ( conical bottom ) ( 50ml each plastic containers with air tight screw cap printed graduation ) , consumable 29.99 artificial immersion oil refractive index of 1.48 it should be colorless, odorless, transparent and free from fluorescence in day light eith relative density of 0.827 to 0.890, viscosity of 110 to 230 m pa s; specific gravity of 0.76 0.78 at 15.5 c ( 50 ml bottle ) , consumable 30 methylated spirit ( 500 ml bottle ) , consumable 30.01 phenolic compound / phenol crystal chemical name: phenol, chemical structure: c6h5oh, molecular wt: 94.11, melting point:40 c+2 purity: 99.5% ( 500 gm glass bottle ) , consumable 30.02 sputum container ( 100 per box ) , consumable 30.03 sulphuric acid ( 500ml glass bottle ) , consumable 30.04 ice pack ( pack ) , consumable 30.05 para film sealing film ( film ) , consumable 30.06 therma coal box ( box ) , consumable 30.07 hydroxy propyl methyl cellulose injection 2% ( 3ml prefilled syringe ) , syrings 30.08 diflubenzuron 25% wp ( 1kg ) , consumable 30.09 cepodoxamine 200 mg + clavulanic acid 125mg tab ( 200mg + 125 mg ) , tablet 30.1 hiv ( rapid ) ( whole blood finger prick test kit ) , consumable 30.11 pre & pro biotic sachet each sachet ( 0.5 gm ) contain: streptococcus faecalis t 110 30 million clostridium butyricum toa 2million bacillus mesentericus to a 1 million lactic acid bacillus 50 million ( lactobacillus sporogenes ) ( 0.5 gm sachet ) , sachet 30.12 disposable under pad dimention of sheet 60*90 cm ( inside ) ( weight 80 gm unit ) , consumable 30.13 tetrastarch 6% infusion ( 500 ml bottle ) , infusion 30.14 milk of magnesia+liquid paraffin 11.25ml+3.75ml ) 15ml ) , syrup ( 200ml bottle ) , syrup 30.15 clindamycin 300mg capsule / tab ( 10x10 ) , tablet capsule 30.16 amoxycillin 250 mg + cloxacillin 250 mg cap ( 10x10 ) , capsule 30.17 each uncoated chewable tablet contains dride aluminium hydroxide i.p 240 mg magnesium ( hydroxide i.p 100mg activated dimethicone i.p 25mg light magnesium carbonate ip 60mg ) , tablet 30.18 promethazine 25 mg / ml ( 1ml amp ) , ampule 30.19 heamocoagulase 1 iu / ml ( 1ml amp ) , ampule 30.2 vancomycine eye drop 2.5% , 5ml ( 2.5% , 5ml ) , drop 30.21 chloranphenicol eye ointment 0.5% ( 0.5% ) , ointment 30.22 chloranphenicol + polymycin b eye drop, 4mg / ml, 5ml ( 4mg / ml, 5ml ) , eye drop 30.23 gancyclovir eye ointment 0.15%, 3gm tube ( 0.15%, 3gm tube ) , ointment 30.24 amphotericin b ointment 2.5%, 5gm ( 2.5%, 5gm ) , ointment 30.25 variconazole eye drop ( power form soulation ) 1%, 5gm ( ( power form soulation ) 1%, 5gm ) , eye drop 30.26 fluoro metholone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.27 dexamethalone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.28 betamethasone 0.1%, 5ml ( 5ml ) , drop 30.29 surgical blade 15 no ( 100 / pkt ) , surgical material 30.3 defluprednate eye drop, 5ml ( 5ml ) , drop 30.31 lotepredrrelol eye drop, 5ml ( 5ml ) , eye drop 30.32 indomethacin eye drop 0.5%& 1% ( 5ml ) , eye drop 30.33 ketorolac eye drop 0.4% ( 5ml ) , eye drop 30.34 diclofenac eye drop 0.1% ( 5ml ) , eye drop 30.35 tropicamide eye drop 0.5% ( 5ml ) , eye drop 30.36 tropicamide + phenylephirne eye drop 1% ( 5ml ) , eye drop 30.37 cmc + sodiumhyaluronate eye drop ( 5ml ) , eye drop 30.38 carboxymethye cellulose 1% eye drop ( 5ml ) , eye drop 30.39 phenylephrine eye drop 5% ( 5ml ) , eye drop 30.4 phenylephrine eye drop 10% ( 5ml ) , eye drop 30.41 timolol eye drop 0.25% ( 5ml ) , eye drop 30.42 betaxolol eye drop 0.25% ( 5ml ) , eye drop 30.43 betaxolol eye drop 0.5% ( 5ml ) , eye drop 30.44 dipverfrine eye drop 0.1% ( 5ml ) , eye drop 30.45 brimonidine eye drop 0.1% and 0.15% ( 5ml ) , eye drop 30.46 lantanoprost eye drop 0.005% ( 2.5ml ) , eye drop 30.47 bimatoprost eye drop 0.1% ( 5ml ) , eye drop 30.48 dorzolamide eye drop 2% ( 5ml ) , eye drop 30.49 bronlolamide eye drop, 0.2% ( 5ml ) , eye drop 30.5 xycocain preservative free 2% injection ( 2% ) , injection 30.51 xylocain injection 2%, 20mg / ml ( 30ml ) , injection 30.52 ophthalmic needles ( round body ) , needle 30.53 ophthalmic needles ( cutting ) , needle 30.54 keratom knife ( 2.8 mm ) , blade 30.55 vicryl 60 suture micropoint sparalated reverse cutting double armed ( reverse cutting double armed ) , blade 30.56 nvr blade ( 20 g ) , blade 30.57 wills hospital utility forceps ( na ) , sutures 30.58 castroviejo suturing forceps 0.12 mm ( 1x2 teeth ) , sutures 30.59 dastoor superior rectus forceps ( 1x2 teeth ) , sutures 30.6 hartman mosquito forceps, straight ( na ) , surgical material 30.61 hartman mosquito forceps, curved ( na ) , surgical material 30.62 baby jones towel clamp ( na ) , consumable 30.63 barraquer iris scissors ( na ) , surgical material 30.64 westcott tenotomy scissors ( na ) , surgical material 30.65 iris scissors, straight ( na ) , surgical material 30.66 kalt needle holder, straight ( na ) , surgical material 30.67 barraquer n holder, shirt model, m. jaws, curved jaws, w / o lock ( na ) , surgical material 30.68 barraquer n holder, standard jaws, curved jaws, w / o lock ( na ) , surgical material 30.69 rycroft air injection cannula, ( 23 g ) , consumable 30.7 lewicky anterior chamber maintainer cannula ( na ) , consumable 30.71 infusion cannula ( size 25.mm ) , consumable 30.72 keener arlt lens loop ( na ) , consumable 30.73 agarwal s phaco chopper ( 1mm fully cutting edge ) , consumable 30.74 beer cilia forceps ( na ) , consumable 30.75 harms traveculotomy probe, right ( na ) , consumable 30.76 harms traveculotomy probe, left ( na ) , consumable 30.77 castroviejo corneal trephine ( size 7.5mm dia ) , consumable 30.78 dastoor corneal graft holding forceps ( na ) , consumable 30.79 osher neumann radial marker ( 8 blades ) , consumable 30.8 tudor thomas corneal graft stand ( na ) , consumable 30.81 lieberman teflon block ( na ) , consumable 30.82 sterilization box ( na ) , consumable 30.83 barraquer solid wire speculum ( large ) , consumable 30.84 hoffer optic zone marker ( 3mm dia ) , consumable 30.85 osher neumann radial marker ( 4 blades ) , consumable 30.86 osher neumann radial marker ( 6 blades ) , blade 30.87 grene visual axis marker ( na ) , consumable 30.88 thornton fixation ring ( na ) , consumable 30.89 bores corneal fixation forceps, ( straight ) , consumable 30.9 bores incision spreading forceps ( na ) , consumable 30.91 lancaster eye speculum ( na ) , consumable 30.92 jaeger lid plate ( na ) , consumable 30.93 graefe muscle hook ( size 3 ) , consumable 30.94 berke ptosis forceps ( 20 mm ) , consumable 30.95 snellen entropium forceps, ( left small ) , consumable 30.96 snellen entropium forceps, ( right small ) , consumable 30.97 ayer chalazion forceps ( na ) , consumable 30.98 lambert chalazion forceps ( na ) , consumable 30.99 stevens tenotomy scissors, curved ( na ) , consumable 31 meyerhoefer chalazion curette ( size 1, 1.75 mm dia ) , consumable 31.01 jameson muscle hook, ( large ) , consumable 31.02 jameson muscle forceps, left, ( child 4 teeth ) , consumable 31.03 jameson muscle forceps, right, ( child 4 teeth ) , consumable [ 201269 ] 31.04 charles flute needle ( na ) , consumable 31.05 infusion cannula, ( size 2.5mm ) , consumable 31.06 schepens forked orbital retractor ( na ) , consumable 31.07 cefixime 200 mg + clavulanic acid 125 mg ( tab ) , tablet 31.08 natamycin eye drop 5%, ( 5ml ) , eye drop 31.09 hpmc ( hydroxy propylmetty cellulose ) eye drop, ( 5ml ) , eye drop 31.1 sodium hyaluronate injection ( pfs ) ( na ) , injection 31.11 45 diaptor irrigating contact lens ( 45 deg ) , consumable 31.12 90 diaptor irrgating contact lens ( 90 deg ) , consumable 31.13 scleral plugs ( sets of 3 ) , consumable 31.14 vitreous forceps, ( 20 g smooth jaws, straight ) , consumable 31.15 buprenorphine 20 mg patch ( each patch ) , each 31.16 vinorelbine ( 50mg inj ) , injection 31.17 linagliptin ( 5mg tab ) , tablet 31.18 tenecteplase ( 40mg ) , injection 31.19 levocetirizine 5mg ( mouth dissolving tablet also acceptable ) , tablet 31.2 cefixime + ofloxacin ( 200 mg + 200 mg ) , tablet 31.21 endotracheal tube no 5.5 ( uncuffed ) , each 31.22 endotracheal tube no 6.0 ( uncuffed ) , each 31.23 pressure monitor ( line ) , each 31.24 follyscathetor 8 no ( pediatrics ) , consumable 31.25 follyscathetor 10 no ( pediatrics ) , consumable 31.26 diclofenec sodium 75mg / ml injection, surfactant & transcutol p free. iv bolus ( 75mg / ml, amp of 1 ml ) , ampule 31.27 disposable eye dressing with adhesive pad ( each unit ) , consumable [ 201391 ] 31.28 vecuronium bromide injection ( 10mg / vial ) , injection 31.29 liposomal doxorubicin 20 mg or pegylated liposomal doxorubicin ( 2 mg / ml 10ml vial ) , injection 31.3 cefpodoxamine ( 200 mg tab ) , tablet 31.31 blood transfusion set ( each ) , consumable 31.32 insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges 31.33 surgical spirit ip ( 500 ml ) , bottle 31.34 flurbinprofen eye drop 0.03% ( 5 ml vial ) , eye drop 31.35 tropicamide + phenylephime eye drop 0.8% and 5% ( 5 ml vial ) , eye drop 31.36 amoxicillin + cloxacillin ( 250mg + 250mg ) , capsule 31.37 amoxicillin + cloxacilline ( 500 mg+500 mg cap ) , capsule 31.38 carboxymethyl cellulose ( 1% eye drop, 5ml ) , eye drop 31.39 cephalexine cap ( 125mg ) , capsule 31.4 chloramphenicol ( 250mg ) , capsule 31.41 clindamycin ( 150 mg ) , capsule 31.42 clindamycin ( 300 mg ) , capsule 31.43 clomipramine ( 25 mg ) , capsule 31.44 halothane ( ) , inhalation 31.45 medical oxygen ( ) , inhalation 31.46 iron sucrose ( 50mg ) , injection 31.47 alcohol ( absolute ) ( 500 ml ) , consumable 31.48 ulinastatin ( 1 lac iu ) , vial 31.49 cefuroxime ( 1.5 gm ) , injection 31.5 sitagliptin + metformin ( 50mg + 500mg ) , tablet 31.51 teneligliptin ( 20mg ) , tablet 31.52 telmisatran ( 80mg ) , tablet 31.53 ammonium chloride+diphenhydramine+sodium citrate+menthol ( 138mg+14.08mg+57.03mg+2.5mg each 5ml cough syrup ) , syrup 31.54 vildagliptin + metformin ( 50mg + 1000mg ) , tablet 31.55 etoricoxib ( 90mg ) , tablet 31.56 saxagliptin ( 5 mg ) , tablet 31.57 saxagliptin ( 2.5mg ) , tablet 31.58 ticagrelor ( 90mg ) , tablet 31.59 mycophenolate ( 360mg ) , tablet 31.6 sodium valporate + valproic acid cr ( 300mg ) , tablet 31.61 poc kit for syphilis ( as per attached specification ) ( 10 test per pack ) , consumable 31.62 sterlize single use lancing device ( penitration depth 1.5 and 28 guage ) , each 31.63 glargine 100 iu / ml, 3ml cartridge inj. ( firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost ) ( 100 iu / ml ) , cartridges 31.64 disposable bed sheet ( each ) , consumable [ mis1002 ] 31.65 sterile disposable bed sheet ( each ) , consumable 31.66 viral transport media with swabs ( vtm detail specifications ) : vtm ( 3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab ) 1.viral transport medium ( vtm ) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts for sa ) , consumable 31.67 anticold ( drop ) , drop 31.68 sevelamer carbonate ( 800mg ) , tablet 31.69 iron & folic acid with vitamin b12 capsules ( time released ) each timed release capsule contains: ( ferrous fumarate ( in sr form ) ip 200mg eq. to 64mg elemental iron cyanocobalamine ip 15mcg folic acid ip 1.5mg ) , capsule 31.7 degludec 100 iu / ml ( 3ml cartridge with pen inj. ) , injection 31.71 lactobacillus tab ( 60 million spores ) , tablet 31.72 phenytoin sodium ( 250 mg / 5 ml inj ) , injection 31.73 elemental calcium 150mg cap ( ( in the form of calcium hydroxide & calcium oxide pretreated with heated algae ) termed as lonic calcium ) , capsule 31.74 each 5ml contains aluminium hydroxide paste equilvalent to dired alluminium hydroxide i.p. 250mg magnesium hydroxide i.p. 250mg activated dimethicone i.p. 50mg sorbitol solution ( 70% ) ip.. 1.25mg ( non cristallising 170 ml bottle ) , bottle 31.75 sodium dichloroisocynaurate 35 mg tablet ( turnover criteria amended as average annual turnover 2cr. only gmp certified companies also eligible for this consumable item ) , tablet [ 121002a ] 31.76 febuxostat ( 40 mg tab ) , tablet 31.77 glimepride 2 mg + metformin 1000 mg ( tab ) , tablet 31.78 fluocinolone acetonide ip ( 0.1% w / w 30 gm cream ) , tube 31.79 darbepoetin ( 25mcg ) , injection 31.8 darbepoetin ( 40mcg ) , injection 31.81 racecadotril ( 100mg ) , capsule 31.82 methyl prednisolone ( 500mg ) , injection 31.83 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , consumable 31.84 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 10ml ) , consumable 31.85 garam coat / woolan saluka sup.quality ( std.size ) , consumable 31.86 duster ( 39x39 ) , consumable 31.87 ladies livirise set redymade saree whote polyster green / blue border ( saree + blouse + peticot ) ( std.size ) , consumable 31.88 pillow 1 kg. cotton ( 14x21 ) , consumable 31.89 mattress 10 kg. cotton ( 3x6 ) , consumable 31.9 dohar redymade ( 54x90 ) , consumable 31.91 table cloth ( 45x60 ) , consumable 31.92 hole sheet ( 39x39 ) , consumable 31.93 gents livirise set redymade ( pent + shirt + topi ) ( std.size ) , consumable 31.94 airway, nasopharyngeal, sterile, single use, set with 6.5mm external diameter ( make medisafe international, model:msi 1220 6.5 ) , consumable [ 20200835 ] 31.95 airway, nasopharyngeal, sterile, single use, set with 7.5 mm external diameter ( make medisafe international, model:msi 1220 7 ) , consumable 31.96 atorvastatin + asprin ( 10mg + 75mg ) , tablet or capsule 31.97 intravenous set with airway and needle ( children ) ( surgical material ) , consumable 31.98 ice pack ( 8 length x 6 widgth ) ( 200gm ) , consumable 31.99 serum electrolyte kit ( 50test per kit ) , consumable 32 filter paper ( 12.5 cm, 0.1 micron, 50 / pkt ) , consumable 32.01 spectacles for school children: durable non allergic plastic ( frame with english lenses in case ) , consumable 32.02 spectacles for old person: durable non allergic plastic ( frame with english lenses in case ( as per tender specification ) ) , consumable 32.03 cotton khadi dari pattil ( 10x1.5 feet, 800gram per piece ) , consumable 32.04 cotton khadi dari pattil ( 10x1.5 feet, 1kg per piece ) , consumable 32.05 cotton khadi white bedsheet ( 54x90 inch per piece ( by weaving the name of the concerned department ) ) , consumable 32.06 cotton khadi white bedsheet ( 54x90 inch per piece ( by printing the short name of the concerned department ) ) , consumable 32.07 polyvastra cloth coating white ( 36 inch per meter ) , consumable 32.08 polyvastra cloth shirting colour ( 36 inch per meter ) , consumable 32.09 polyvastra uniform colour ( pent / shirt / topi ) ( per set ( accourding to measure ) ) , consumable 32.1 polyvastra uniform ( kurta / payjama / topi ) ( per set ( accourding to measure ) ) , consumable 32.11 woolen coatin mix ( 54 inch per meter ) , consumable [ kha058 ] 32.12 woolen shawl mix ladies standard ( per piece ) , consumable [ kha059 ] 32.13 ammunition boot ( according to measure ) , consumable 32.14 ackle boot ( according to measure ) , consumable 32.15 alcohol based hand sanitizer liquid spray ( 500 ml bottle ) , consumable 32.16 alcohol based hand sanitizer ( 50 ml bottle ) , consumable 32.17 plastic gloves ( large size ) , consumable 32.18 alcohol based hand sanitizer ( 1 ltr. bottle ) , consumable 32.19 sodium hypochlorite solution 5% ( 500 ml bottle ) , consumable 32.2 alcohol based hand sanitizer ( 500 ml bottle ) , consumable 32.21 codeine opiod analgesic 15 mg tab ( 15 mg ) , tablet 32.22 pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) ( tablet ( with additional content acceptable ) ) , tablet each 5ml contain potassium citrate i.p. 1100 mgmagnesium citrate u.s.p. 375 mg pyridoxine hydrochloride i.p 20 mg colour caramel ( each contains approx.l meq, magnesium ion, 2meq. potassium ion, 3meq. citrate ion and 4mg of pyridoxine hydrochloride ) , bottle 32.24 afatinib ( 20 mg ) , tablet 32.25 alteplase ( 50 mg ) , injection 32.26 probiotic capsule each capusle contains lactobacillus ( rhamunousus gr 1 & lactobacillus reuteri rc 14 1 billion ) , capsule 32.27 doxketoprofen trometamol ( equivalent to dexketoprofen 25mg + paracitamol 325 mg ) , tablet 32.28 brimonidine eye drop 0.2% ( 5ml ) , vial 32.29 golimumab ( r dna origin ) solution for injection in prefilled syringe for single use 50 mg / 0.5 ml50mg / 0.5ml ( pre filled syringe in autoinjector ) , syrings 32.3 calcitriol 0.25 mcg + calcium 500mg+ mecobalamin 1500mcg+ omega 3 acid ethyl esters 60 bp+ folic acid 400mcg + elemental boron 1.5mg ( capsule / soft gelatin capsule ) , capsule 32.31 pembrolizumab inj ( 100mg / 4ml ( 25mg / mi ) solution in single dose ) , vial 32.32 peptonised iron 176.5 mg ( equivalent to 30 mg of elemental iron, protein ( as peptone ) 100 mg, folic acid 200 mcg, vitamin b12 2.5 mcg 100ml ) , bottle 32.33 feracrylum 1% gel ( 15gm ) , tube 32.34 disodium hydrogen citrate ( 1.4gm / 5ml ) ( 200ml ) , syrup 32.35 cost of reagent per test ( for blood cell counter 3 part ) ( blood cell counter 3 part ) , consumable 32.36 blood cell counter 3 part ( mek6510k ) ( blood cell counter 3 part ) , consumable 32.37 electrolyte solution for disinfectant generation system ( 10 lt. per pack ) , consumable 32.38 canagliflozin ( 100 mg ) , tablet 32.39 gabapantin300 mg + methylcobalamin 500 mcg ( 300 mg + 500 mcg ) , tablet 32.4 minicap ( capd ) with povidon iodine ( each ) , consumable [ 202106004 ] 32.41 serum amylase ( 2x25 ml ) , consumable 32.42 mackintosh ( as per attached specification ) , quantity amended as 136940 meter i.e. 6847 roll of 20 meter roll, rate should be quoted for 20 meter ( is 8164 1976 or conforming to is 8164 1976 ) , consumable 32.43 chromic with 1 / 2 cir rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 , surgical material ) , consumable 32.44 aceclofenac +thiocolchicoside ( 100mg+8mg ) , tablet 32.45 beclomethasone 0.025 % + fusidic acid 2.0 % cream ( 10 gm ) , tube 32.46 deflazacort ( 6mg ) , tablet 32.47 etizolam ( 0.25mg ) , tablet 32.48 etizolam ( 0.5mg ) , tablet 32.49 etoricoxib ( 60mg ) , tablet 32.5 febuxostat ( 80mg ) , tablet 32.51 itraconazole ( 200mg ) , capsule 32.52 levocetrizine ( 10mg ) , tablet 32.53 cefopodoxime 50 mg / 5 ml suspension ( 30ml ) , bottle 32.54 chlorpheniramine 2mg+ dextromethorphan 10mg / 5ml ( 100ml ) , syrup 32.55 trypsin chymotrypsin ( 1 lac iu ) , tablet 32.56 cisplatin ( 10 mg ) , injection 32.57 clindamycin 600mg ( 150mg / ml ) , injection 32.58 nebivolol ( 2.5mg ) , tablet 32.59 octriotide ( 50 mcg / ml ) , injection 32.6 rabeprazole + levosulpiride ( 20mg +75mg ) , tablet or capsule 32.61 rifaximin ( 400mg ) , tablet 32.62 rosuvastatin ( 20 mg ) , tablet 32.63 vitamin d3 ( 800iu / ml ) , drop 32.64 diclofenac sodium 75mg intended to use iv aqueous formulation ( 1ml amp ) , injection 32.65 gabapentin ( 300mg ) , tablet 32.66 fexofenadine + montelukast ( 120mg / 10 mg ) , tablet 32.67 fluticasone 50mcg / spray ( 70 120 meter dose nasal ) , spray 32.68 cr system film ( size 8x10 ) , consumable 32.69 cr system film ( size 10x12 ) , consumable 32.7 cr system film ( size 14x17 ) , consumable 32.71 films of size 14x17 inches compatible films to dr system ( 14x17 inches ) , film 32.72 films of size 11x14 inches compatible films to dr system ( 11x14 inches ) , film 32.73 films of size 10x12 inches compatible films to dr system ( 10x12 inches ) , film 32.74 films of size 8x10 inches compatible films to dr system ( 8x10 inches ) , film 32.75 alfacalcidol 0.25mcg, calcium 200mg ( 0.25mcg+200mg ) , capsule levetiracetam 100mg / ml syrup / solution ( 100ml bottle ) , syrup 32.77 paracetamol 500mg + chlorpheniramine 2mg+ phenylephrine 10mg ( 500mg+2mg+10mg ) , tablet 32.78 acenocoumarol ( 1 mg ) , tablet 32.79 alendronate ( 70 mg ) , tablet 32.8 methylcobalamin 1500mcg + pregabalin 75mg ( 1500mcg+75mg ) , tablet 32.81 alfuzosin ( 10mg ) , tablet capsule 32.82 amantadine ( 100mg ) , tablet 32.83 bosentan ( 62.5 mg ) , tablet 32.84 bisoprolol ( 5 mg ) , tablet 32.85 levetiracetam ( 100mg / ml ) , injection 32.86 sucralfate 500mg + oxetacaine 10 mg / 5ml syrup / suspension, 200ml bottle ( 500mg+10 / 5ml ) , bottle 32.87 pregabalin 75 mg + nortriptyline 10 mg ( 75mg+10mg ) , tab 32.88 adapalene ( 0.1%w / w ) , gel 32.89 oxymetazoline hydrochloride 0.05% w / v nasal spray, 10ml bottle ( 0.05% w / v ) , spray 32.9 disposable surgeon cap with cable tie ( each ) , consumable 32.91 weith machine mini ( 1gm to 5kg ) 32.92 heating mantle 32.93 inj multivitamine 32.94 onit eberconazole cream 1% w / w 32.95 cassette ( 10 x 12 ) , consumable fujji 32.96 cassette ( 8 x 10 ) , consumable fujji 32.97 cassette ( 14 x17 ) , consumable fujji 32.98 centrifuse machine 32.99 blood presure machine digital 33 codon set 33.01 acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet 33.02 albendazole ip ( 400mg ) , tablet 33.03 alprazolam ( tab 0.25mg ) , tablet 33.04 amiodarone 50mg / ml ( 3ml vial / amp ) , injection 33.05 amiodarone ( 100mg tab ) , tablet 33.06 amlodipin tab ( 5mg ) , tablet 33.07 amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection 33.08 amoxicillin ( 125 mg / 5ml ( 30 ml bottle ) ) , suspension [ 110074 ] 33.09 amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , syrup 33.1 amoxycilline ( 500mg ) , capsule 33.11 ampicillin ( 500 mg / vial ) , injection 33.12 ampicillin trihydrate capsules ( 500mg 33.13 anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection 33.14 anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection 33.15 artemether + lumefantrine ( 20mg+120mg ) , tablet 33.16 artesunate ( 60 mg / vial ) , injection 33.17 artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg + pyrimethamine 37.5 mg ip ( 2 tab ) ( age group 15 or above ) , combi blister pack 33.18 aspirin low dose ( 75mg tab ) , tablet 33.19 atenolol ( 50mg tab ) , tablet 33.2 atenolol ( 100mg ) , tablet 33.21 atorvastatin ( ip 10 mg ) , tablet 33.22 atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection 33.23 atropine sulphate 1% ( 5 ml vial ) , eye drop 33.24 atropine sulphate eye ointment ( 1% ) , ointment 33.25 atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection 33.26 azithromycin ( 500mg tab ) , tablet 33.27 azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , syrup 33.28 azithromycin ( 250mg ) , tablet 33.29 betahistine ( 8 mg tab ) , tablet 33.3 betamethasone sodium phosphate ( ml contain betamethasone sodium phosphate equal to 4mg of betamethasone ( 1ml amp ) ) , injection 33.31 biphasic isophane insulin ( 30 / 70 40iu / ml ( 10 ml vial ) ) , injection 33.32 bisacodyl ( 5 mg ) , suppository 33.33 bisacodyl ( 5mg tab ) , tablet 33.34 bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup 33.35 bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection 33.36 calcium gluconate ( 10% ( 10 ml vial ) ) , injection 33.37 calcium gluconate 10% ( 10ml amp ) , injection 33.38 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet 33.39 carbamazepine ( 200 mg ) , tablet 33.4 carboplatin ( 450mg 45ml multidose vial ) , injection 33.41 carboxymethylcellulose sodium eye drop 0.5% ( 10ml ) , eye drop 33.42 cefixime ( 200 mg tab ( dt tablet also acceptable ) ) , tablet 33.43 cefotaxime sodium ( 250 mg vial ) , injection 33.44 cefotaxime sodium ( 1 gm vial ) , injection 33.45 ceftazidime 1gm / vial inj ( 1 gm / vial ) , injection 33.46 ceftrioxone usp ( 1gm / vial ) , injection 33.47 ceftriaxone ( 250mg vial ) , injection 33.48 ceftriaxone ( 500mg vial ) , injection 33.49 cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup 33.5 cetirizine ( 10 mg ) , tablet 33.51 chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension 33.52 chloroquine phosphate tab. ( 250mg ) , tablet 33.53 chlorpheniramine maleate ( 10mg / ml inj 10 ml ) , 33.54 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 33.55 ciprofloxacin ( 500mg ) , tablet 33.56 clomiphene citrate ( 50 mg tab ) , tablet 33.57 clonazepam ( 0.5mg ) , tablet 33.58 clopidogrel ( 75 mg ) , tablet 33.59 clotrimazole i.p. 2%w / w ( 15gm tube ) , cream or 33.6 deferasirox dispersible ( 250mg ) , tablet 33.61 deferasirox dispersible ( 500mg ) , tablet 33.62 dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection 33.63 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 33.64 dextrose 25% ( 500ml ffs bottle ) , injection 33.65 dextrose 5% ( 500ml ffs bottle ) , injection 33.66 dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection 33.67 diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection 33.68 diclofenac ( 1% ) , gel 33.69 diclofenac sodium 25 mg / ml ( 3ml amp ) , injection 33.7 diclofenac sodium ( 50 mg ) , tablet 33.71 dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection 33.72 dicyclomine tab. 10mg 33.73 diethylcarbamazine tab ( 100mg ) , tablet 33.74 digoxin tab ( 0.25mg ) , tablet 33.75 zinc dispersible ( 20mg ) , tablet 33.76 docetaxel ( 120mg vial ) , injection 33.77 domperidone suspension 1mg / ml ( 30ml bottle ) , suspension 33.78 domperidone ( 10mg ) , tablet 33.79 dopamine hcl 40 mg / ml ( 5ml amp ) , injection 33.8 doxorubicin ( lypholozed ) ( 50mg vial ) , injection 33.81 doxycycline ( 100 mg ) , capsule 33.82 drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection 33.83 enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection 33.84 erythropoietin ( 10000iu inj ) , injection 33.85 escitalopram 10 mg tab ( 10 mg ) , tablet 33.86 etophylline ( 77 mg ) + theophylline ( 23 mg ) tab ( tablet ) , tablet 33.87 etiophylline and theophylline ( 220 mg / 2ml ) , injection 33.88 fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampule 33.89 fluconazole ( 150 mg ) , tablet 33.9 flunarizine ( 5 mg ) , tablet 33.91 fluoxetine cap ( 20 mg ) , capsule 33.92 folic acid ip ( 5 mg ) , tablet 33.93 framycetin sulphate 1% cream ( 30 gm tube ) , cream 33.94 frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection 33.95 furosemide tab ( 40mg ) , tablet [ 110265 ] 33.96 furazolidone ( 100mg ) , tablet 33.97 gamma benzene hexachloride solution / lotion 1% ( ( 100 ml ) ) , bottle 33.98 gentamicin inj ( 40 mg / ml 2 ml amp ) , injection 33.99 gentamicin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop 34 glibenclamide ( 5 mg ) , tablet 34.01 gliclazide ( 80 mg ) , tablet 34.02 glimepiride ( 1 mg ) , tablet 34.03 nitroglycerine ( glyceryl trinitrate ) ( sublingual tab mg ) , tablet 34.04 glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection 34.05 haloperidol inj ( 5mg / ml ( 1 ml amp ) ) , injection 34.06 haloperidol ( 5mg ) , tablet 34.07 halothane bp 250ml 34.08 heparin ( 1000iu / ml 5ml vial ) , injection 34.09 hepatitis b immunoglobulin ( 100 iu / vial ) , vial 34.1 human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection 34.11 hydrochlorothiazide tab ( 25 mg ) , tablet 34.12 hydrocortisone sodium succinate ( 100 mg / vial ) , injection 34.13 hydrogen peroxide 6% solution ( who gmp certification exempted for this item ) ( 400 ml ) , bottle 34.14 hydroxy urea ( 500mg ) , capsule 34.15 hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection 34.16 ibuprofen ( 400mg ) , tablet 34.17 insulin soluble inj. 40 iu / ml 34.18 ipratropium bromide inhaler 20mcg per puff ( 200 metered dose container ) , inhaler 34.19 iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to 60 mg elemental iron 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet 34.2 isosorbide dinitrate tab ip ( 5mg ) , tablet 34.21 isoxsuprine ( 10mg ) , tablet [ 34.22 ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection 34.23 labetalol ( 100 mg ) , tablet 34.24 levofloxacin ( 500mg ) , tablet 34.25 lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) ) , gel 34.26 lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection 34.27 lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial 34.28 mannitol ( 20% 100 ml ffs bottle ) , injection 34.29 mephentermine inj 30mg / ml ( 10 ml vial ) , injection 34.3 metformin ( 500 mg ) , tablet 34.31 methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection 34.32 methyl ergometrine maleate tab ( 0.125mg ) , tablet 34.33 methyl prednisolone sodium succinate inj.1000mg vial ( 1000mg vial ) , injection solution for 34.34 methyl prednisolone tab ( 16 mg ) , tablet 34.35 methyl prednisolone ( 4mg ) , tablet 34.36 methyldopa tab. 250mg 34.37 metoclopramide 5mg / ml ( 2 ml amp ) , injection 34.38 metoclopramide ( 10mg ) , 34.39 metoprolol ( 50mg ) , tablet 34.4 metronidazole tab ( 400mg ) , tablet 34.41 midazolam ( 1mg / ml ( 10ml vial ) ) , inje 34.42 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 34.43 mifepristone ( 200 mg ) , tablet 34.44 misoprostol ( 200mcg ) , tablet 34.45 morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection 34.46 naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for 34.47 neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection 34.48 nifedipine capsule ( 5mg cap ) , capsule 34.49 nifedipine ( 10mg tab ) , tablet 34.5 nitroglycerine inj. 25 mg / 5ml ( 5ml ) , ampule 34.51 norfloxacin tab. 400mg 34.52 ofloxacin tab 200mg 34.53 olanzapine ( 10mg tab ) , tablet 34.54 ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection 34.55 ondansetron ( 2mg / 5ml 30ml bottle ) , syrup or solution 34.56 ondansetron tab 4 mg 34.57 ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l ( as per attached pack specification ) , powder 34.58 oxaliplatin ( 100mg ) , injection 34.59 paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection 34.6 paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) ( syrup ) , syrup 34.61 paracetamol ( 500mg ) , tablet 34.62 pemetrexed ( 500mg ) , injection 34.63 pentaprazole inj vial ( 40 mg ) , injection 34.64 pentazocine lactate ( 30mg / ml ( 1 ml amp ) ) , injection 34.65 pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection 34.66 phenobarbitone ( 200 mg / ml ) , injection [ 34.67 phenobarbitone ( 30 mg ) , tablet 34.68 phenobarbitone ( 60 mg tab ) , tablet [ 34.69 phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection [ 34.7 phenytoin sodium ( 100mg ) , tablet [ 34.71 pioglitazone ( 15 mg ) , tablet 34.72 piperacillin + tazobactum ( 4.5 g ) , injection 34.73 potassium chloride oral solution 100mg / ml ( 200ml bottle ) , bottle 34.74 povidone iodine ointment 5% ( 15gm tube ) , tube 34.75 povidone iodine ( 5% 100 ml ) , solution 34.76 povidone iodine vaginal ( 200 mg ) , pessary 34.77 pralidoxime ( pam ) inj ( 25 mg / ml ) , injection 34.78 primaquin ( 2.5mg ) , tablet 34.79 primaquine ( 15mg ) , tablet 34.8 primaquin ( 7.5mg ) , tablet 34.81 promethazine 5 mg / 5ml ( 60 ml bottle ) , syrup 34.82 pyridoxine tab 10mg 34.83 quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection 34.84 quinine sulphate ( 300mg ) , tablet 34.85 rabeprazole ( 20 mg ) , tablet 34.86 ramipril ( 2.5 mg ) , tablet 34.87 ranitidine ( 50mg / 2ml , 2ml amp ) , injection 34.88 ranitidine ( 150mg ) , tablet 34.89 recombiant fviia ( 1mg / vial ) , vial 34.9 ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , infusion 34.91 rituximab ( 500mg ) , injection 34.92 salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler 34.93 salbutamol sulphate ( 4mg ) , 34.94 silver sulphadiazine cream ( usp 1% w / w 25gm ) , tube 34.95 sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule 34.96 sodium thiopentone 0.5 gm powder / vial ( 20ml vial ) , injection 34.97 succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection 34.98 sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet 34.99 sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet 35 tamoxifen tab. ( 10 mg ) , tablet 35.01 telmisartan ( 40 mg ) , tablet 35.02 tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection 35.03 tramadol ( 50mg / ml ( 2ml amp ) ) , injection 35.04 tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection 35.05 tropicamide ( 1% 5ml vial ) , eye drop 35.06 vancomycin hydrochloride ( 1000mg vial ) , injection 35.07 vancomycin hydrochloride ( 500mg ) , injection 35.08 vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup or solution 35.09 xylometazoline nasal ( 0.1%w / v ( 10 ml vial ) ) , drop 35.1 iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection 35.11 acyclovir ( 800mg ) , tablet 35.12 tramadol ( 50mg ) , tablet 35.13 amoxicillin cap. 250 mg. 35.14 amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet 35.15 ciprofloxacin ( 250mg ) , tablet 35.16 ethamsylate tab ( 250 mg ) , tablet 35.17 permethrin lotion 5% w / v ( 60 ml bottle ) , lotion 35.18 streptokinase inj 15 lac iu ( vial / amp ) , injection 35.19 zoledronic acid ( 4mg vial ) , injection 35.2 benzathine penicillin ( 6 lakh iu / vial ) , vial 35.21 dextrose ( 10% inj 500 ml ffs btl ) , injection 35.22 trihexyphenidyl ( 2mg ) , tablet 35.23 dicyclomine hydrochloride ( 20 mg ) , tablet 35.24 levofloxacin ( 250mg ) , tablet 35.25 cephalexine ( 250mg ) , capsule 35.26 caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection 35.27 ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup 35.28 calcium carbonate ( 500 mg ) , tablet 35.29 diazepam ( 5 mg ) , tablet 35.3 glimepiride ( 2 mg ) , tablet 35.31 tranexamic acid ( 500 mg tab ) , tablet 35.32 miconazole cream i.p. 2% w / w ( 15 gm tube ) , cream or ointment ] 35.33 timolol maleate eye drop i.p. 0.5 %w / v ( 5 ml vial ) ( 5 ml ) , solution 35.34 clotrimazole ( vaginal tab ) 500 mg ( with applicator ) , tablet 35.35 cefotaxime sodium ( 500 mg / vial ) , injection [ 35.36 dextrose ( 25% 100 ml ffs bottle ) , injection 35.37 mannitol inj. 20% 350ml ffs bottle 35.38 sodium chloride n / 2 injection ip ( 0.45% ) ( 500ml ffs bottle ) , injection 35.39 sodium chloride normal saline ( 100ml ffs bottle ) , infusion 35.4 capecitabine ( 500mg ) , tablet 35.41 sorafenib ( 200mg ) , tablet 35.42 artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg + pyrimethamine 25 mg ( 1 tab ) ( age group between 1 4 year ) , combi blister pack 35.43 sitagliptin ( 50 mg ) , tablet 35.44 cloxacillin ( 500mg ) , capsule 35.45 vincristine sulphate ( 1mg / ml ( cytocristin inj ) 1 ml vial ) , injection 35.46 irinotecan hydrochloride ( 100 mg ) , injection 35.47 bicalutamide ( 50mg ) , tablet 35.48 gemcitabine ( 1.4 gm vial ) , injection 35.49 artesunate 150mg ( 3tab ) + sulphadoxine 500mg + pyrimethamine 25mg ( 2 tab ) ( age group 9 to 14 years combi ) , tablet combi red colour blister pack 35.5 letrozole ( 2.5 mg ) , tablet 35.51 mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment 35.52 normal saline ( 0.9% ( 500ml ffs bottle ) ) , infusion 35.53 ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet 35.54 betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream 35.55 dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syr 35.56 vecuronium bromide inj 2mg / ml ( 2ml amp ) 35.57 dobutamine hcl 50 mg / ml ( 5ml amp ) , injection 35.58 chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection 35.59 tinidazole ( 300 mg ) , tablet 35.6 betamethasone ( 0.5 mg ) , tablet 35.61 labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection 35.62 cefpodoxime ( 200 mg ( dispersible tab also accepted ) ) , tablet 35.63 rh erythropoetin ( 2000 i.u ) , injection 35.64 isoflurane ( ) , inhalation 35.65 prednisolone tab 20 mg ( dispersible tablet also acceptable ) , tablet 35.66 charcoal activated ( powder ) ( 100 gm box / pouch ) , oral powder 35.67 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 35.68 cefixime ( 50 mg dt ) , tablet 35.69 meropenem ( 500 mg / vial ) , injection 35.7 benzathine penicilline 12 lac iu / vial ( vial ) , injection 35.71 sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet 35.72 metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension 35.73 itraconazole cap ( 100 mg ) , capsule 35.74 imatinib ( 400 mg tab ) , tablet 35.75 warfarin sodium ( 5 mg ) , tablet 35.76 propranolol tab ( 10 mg ) , tablet 35.77 drotaverine ( 40 mg ) , tablet [ 35.78 lithium carbonate ( 300 mg ) , tablet 35.79 risperidone ( 2 mg ) , tablet 35.8 imipramine ( 25 mg ) , tablet 35.81 lorazepam 2 mg / ml 1 ml vial 35.82 cinnarizine ( 25 mg ) , tablet 35.83 water for injection ip ( 2 ml amp ) , injection 35.84 water for injection 5 ml amp 35.85 carbimazole ( 10 mg ) , tablet 35.86 fluphenazine 1 ml amp ( 25 mg / ml ) , injection 35.87 sodium valproate ( 500 mg ) , tablet [ 35.88 clozapine ( 25 mg ) , tablet 35.89 clozapine ( 50 mg ) , tablet [ 35.9 medroxy progesterone acetate ( 10 mg ) , tablet 35.91 olanzapine ( 5 mg ) , tab 35.92 vitamin b1 ( thiamine 100 mg ) , tablet 35.93 misoprostol ( 100 mcg 4 tables / pack ) , tablet 35.94 disulfiram ( 250 mg ) , tablet 35.95 donepezil ( 5 mg ) , tablet [ 35.96 levetiracetam ( 250 mg ) , tablet [ 35.97 lorazepam ( 1 mg ) , tablet [ 35.98 lorazepam ( 2 mg / ml 2 ml vial ) , injection 35.99 zolpidem 10 mg ( tablet ) , tablet 36 vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection 36.01 chlorpromazine ( 100 mg ) , tablet [ 36.02 rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection 36.03 ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet 36.04 noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection 36.05 salbutamol sulphate ( 2mg / 5ml 60ml ) ( 60ml bottle ) , syrup 36.06 promethazine 25 mg / ml ( 2 ml amp ) , injection 36.07 etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet 36.08 oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injectio 36.09 cetirizine syrup ( 5mg / 5ml 30 ml bottle ) ( 30ml bottle ) , syrup 36.1 verapamil ( 40 mg ip ) , tablet 36.11 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 36.12 metronidazole 500mg / 100 ml ( 100 ml ffs bottle ) , injection 36.13 isosorbide 5 mononitrate ( tab.20 mg ) , tablet 36.14 dexamethasone ( 0.5mg ) , tablet 36.15 iv human immunoglobin 5% iv ig ( 5gm / 100ml each ) , infusion 36.16 cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension 36.17 paracetamol tab ( 650 mg ) , tablet 36.18 linezolid tab ( 600 mg ) , tablet 36.19 albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup 36.2 electrolyte p ( multi electrolytes and dextrose injection type i ip ) i / v fluid ( each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gm, sodium acetate 0.32gm, dibasic potassium phosphate 0.026gm ) ( 500 ml ffs bottle ) , injection 36.21 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable antioxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals ( if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. ( as per attached specification ) ( 50ml bottle with auto dispenser ) ) , syrup 36.22 carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection 36.23 lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution 36.24 zinc sulphate dispersible ( 10mg ) , tab 36.25 atorvastatin ( 40mg ) , tablet 36.26 ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( ( additional composition of menthol also acceptable ) 100ml bottle ) , syrup 36.27 deferiprone ( 500 mg ) , capsule 36.28 spironolactone ( 25mg ) , tablet 36.29 budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension 36.3 ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection 36.31 paclitaxel 260mg ( 43.34ml vial ) , injection 36.32 mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet 36.33 morphine sulphate ( 10 mg ) , tablet 36.34 erlotinib ( 150 mg ) , tablet 36.35 diltiazem ( 30 mg ) , tablet [ 110217 ] 36.36 noradrenaline bitartrate 2 mg base / 2 ml amp injection ( 2 ml amp ) , inj 36.37 amlodipine ( 10 mg ) , tablet 36.38 pyridoxine ( 100 mg ) , tablet 36.39 sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 ml suspension ( 50 ml bottle ) , suspension 36.4 trastuzumab 440 mg injection ( vial ) , injection 36.41 glucose pouch ( 75 gm ) ( powder ( product copp exempted for this item ) ) , powder 36.42 multivitamin sugar coated tab nfi formula multivitamin sugar ( item with additional vitamin will also be considered ) , tablet 36.43 levocetirizine + monteleukast 2.5 mg + 4 mg / 5 ml ( 60 ml bottle, suspension ) , suspension 36.44 empagliflozin ( 25mg tab ) , tablet 36.45 amphotericin b inj ip 50 mg ( liposomal amphotericin b also acceptable ) , injection 36.46 lenalidomide ( 25mg ) , capsule 36.47 tiotropium 18mcg ( 30cap. x 6 pack with 1 dispensing device ) , rotacaps 36.48 tiotropium 9mcg 180 doses inhaler ( 180 or more doses acceptable ) , inhaler 36.49 ciprofloxacin inj 200 mg / 100 ml ( 100 ml ffs bottle ) , infusion 36.5 lantanoprost eye drop 0.005% ( 5ml ) , eye drop 36.51 dexamethasone eye drop ( 0.1%, 5ml ) , eye drop 36.52 urokinase ( 5 lac iu ) , vial 36.53 metoprolol ( 25mg, sustained release ) , tablet or capsule 36.54 metformin ( 1000mg ) , sr tablet 36.55 allopurinol ( 100mg ) , tablet 36.56 paracetamol ( 125 mg / ml ) , drop 36.57 vitamin. b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet 36.58 levothyroxine ( 100 mcg ) , tablet 36.59 levothyroxine ( 50 mcg ) , tablet 36.6 pilocarpine eye drops 2% ( 5ml ) , vial 36.61 cisplatin ( 50 mg ) , injection 36.62 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 36.63 xylometazoline 0.05% nasal 10ml ( 0.05% 10ml ) , drop 36.64 glycopyrolate ( inj 0.2 mg / ml 1 ml vial ) , injection 36.65 promethazine ( injection 10 mg / ml 2ml vial ) , injection 36.66 propofal ( injection 10 mg / ml 1 ml / vial ) , injection 36.67 acetylsalicylic acid ( tablet 150 mg ) , tablet 36.68 acetylsalicylic acid ( aspirin ) * ( tablet 25 mg ) , tablet 36.69 allopurinol ( tablet 300 mg ) , tablet 36.7 pregabalin ( tablet 150 mg ) , tab 36.71 tapentadol ( tablet 100 mg ) , tablet 36.72 chlorpheniramine ( oral liquid 2 mg / 5 ml 30 ml bottel ) , liquid 36.73 hydrocortisone ( ointment 0.5% 15 gm ) , ointment or cream 36.74 hydrocortisone ( ointment 1% 15 gm ) , ointment or cream 36.75 hydroxyzine ( tablet 25 mg ) , tablet 36.76 diphenylhydantoin ( tab 30 mg 10x10 ) , tablet 36.77 abacavir ( tablet 300 mg ) , tablet 36.78 artesunate ( powder for injection 120 mg vial of 1 powder injection with appropriate diluents ) , injection powder for 36.79 ceftazidime ( powder for injection 250 mg vial of 1 powder injection with appropriate diluents ) , injection 36.8 ceftriaxone ( inj 1 gm / vial vial of 1 inection ) , inj 36.81 clarithromycin ( tablet 250 mg ) , tablet 36.82 clindamycin ( capsule 150 mg ) , capsule 36.83 cloxacillin ( capsule 125 mg ) , capsule 36.84 cycloserine ( capsule 125 mg ) , capsule 36.85 clofazimine ( tablet 50 mg 4 ) , tablet 36.86 diethylcarbamazine ( oral liquid 120 mg / 5 ml 100 ml bottel ) , liquid 36.87 diloxanide furoate ( tablet 500 mg ) , tablet 36.88 doxycycline ( dry syrup 50 mg / 5 ml ) , syrup 36.89 ivermectin ( tab 12 mg ) , tablet 36.9 norfloxacin ( dispersible tablet 100 mg ) , tablet 36.91 sodium aminosalicylate granules ( 10 gm bottel of 100 gm ) , powder 36.92 fulvestrant ( inj 500 mg vial of 10 ml ) , injection 36.93 fulvestrant ( inj 500 mg vial of 10 ml ) , injection 36.94 pomalidomide ( cap 2 mg ) , capsule 36.95 topotecan ( inj 4 mg 4 ml vial ) , injection 36.96 levodopa ( a ) + carbidopa ( b ) ( tablet 100 mg ( a ) + 10 mg ( b ) cr ) , tablet 36.97 levodopa ( a ) + carbidopa ( b ) ( tablet 100 mg ( a ) + 25 mg ( b ) cr ) , tablet 36.98 levodopa ( a ) + carbidopa ( b ) ( tablet 250 mg ( a ) + 25 mg ( b ) ) , tablet 36.99 chlorthalidone ( 12.5mg ) , tablet 37 chlorthalidone ( 25mg ) , tablet 37.01 diltiazem ( sr tablet 90 mg 10x10 ) , tablet 37.02 enalapril maleate ( tab 10 mg ) , tablet 37.03 finofibrate ( tablet 160 mg ) , tablet 37.04 finofibrate ( tablet 40 mg ) , tablet 37.05 labetalol ( injection 5 mg / ml 4ml ampl ) , injection 37.06 protamine ( injection 50 mg / 5 ml 5 ml vial ) , injection 37.07 verapamil ( injection 5 mg / 2 ml 2 ml vial ) , injection 37.08 gum paint ( tannic acid ) ( 2% w / v 15 ml bottle ) , bottle 37.09 povidine iodine germicide ( gargle 20% w / v 100 ml bottel ) , bottle 37.1 benzoyl peroxide ( gel 5% 15 gm tube ) , tube 37.11 glycerin ( oral liquid 30 ml bottel ) , liquid 37.12 intraperitoneal dialysis solution ( 0.015 1.5% 500 ml ) , solution 37.13 intraperitoneal dialysis solution ( 0.025 2.5% 500 ml ) , solution 37.14 boro spirit ear drops ( 0.183 gm boric acid in 2.08 ml of alcohol 10 ml vial ) , drop 37.15 normal saline ( nasal drops: sodium chloride drops 0.05% w / v 10 ml vial ) , drop 37.16 wax solvent ear drops: benzocaine ( 2.7% w / v 10 ml bottel drop ) , drop 37.17 wax solvent ear drops:paradichlorobenzene ( 2 % w / v 10 ml bottel ) , drop 37.18 tab mebeverine ( tab 200 mg 10 x 15 ) , tablet 37.19 losartan ( 10 mg tablet ) , tablet 37.2 sucralfate ( 20 mg tablet 10 x 10 ) , tablet 37.21 ethinylestradiol ( tablet 0.05 mg 10x10 ) , tablet 37.22 ethinylestradiol ( tablet 0.01 mg ) , tablet 37.23 ethinylestradiol ( a ) + levonorgestrel ( b ) ( tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10x10 ) , tablet 37.24 human chorionic gonadotropin ( injection 10000 iu vial of 1 ml injection ) , injection 37.25 human chorionic gonadotropin ( injection 5000 iu vial of 2 ml injection ) , injection 37.26 medroxyprogesterone acetate ( injection 150 mg 1 ml / vial ) , injection 37.27 ormeloxifene ( tablet 30 mg 10x10 ) , tablet 37.28 premix insulin ( 30:70 injection ( regular: nph ) 2 vial of 100 ml ) , injection 37.29 iv human immunoglobin 5% iv ig ( ( 5mg / 100ml each ) , injection 100ml injection ) , injection 37.3 rabies vaccine human ( tissue culture ) id / im ( inj 2.5 iu / ml 1 vial with 1 ml diluents ) , injection 37.31 levosulbutamol ( 100 mcg 30 capsule in 6 pack with 1 dispecing device ) , capsule 37.32 levosalbutamol ( 50mcg / dose 30 capsule in 6 pack with 1 dispecing device ) , capsule 37.33 montelukast ( tablet 5 mg 10 x 10 ) , tablet 37.34 human albumin solution ( 0.05 bottel 250 ml ) , injection 37.35 dispersable tablet hydroxyurea ( 100 mg 10x10 ) , tablet 37.36 rh erythropoietin ( injection 2000 iu / ml prefilled syringe of 1 ml injection ) , injection 37.37 warfarin ( tablet 1 mg 10x10 ) , tablet 37.38 warfarin ( tablet 2 mg 10x10 ) , tablet 37.39 surfactant suspension ( inj 25 mg / ml ) , injection [ 37.4 fluconazole ( eye drop 3 mg / ml ( 10 ml vial ) , eye drop 5 ml eye drop ) , drop 37.41 prednisolone ( drops 1% eye 5 ml drop ) , drop 37.42 codeine ( oral solution 15 mg / 5 ml 60 ml bottle ) , solution 37.43 morphine ( injection 15 mg / ml 1 ml ampule ) , injection 37.44 risperidone ( 50 mg injection vial of 2 ml ) , injection 37.45 hydroxyethyl ( 6% saline solution for infusion ) ( starch 6%ip 500 ml bottel ) , infusion 37.46 nicotinamide ( tablet 50 mg ) , tablet 37.47 pyridoxine ( tablet 40 mg 10 x 10 ) , tab 37.48 riboflavin ( tablet 5 mg 10 x 10 ) , tablet 37.49 thiamine ( injection 100 mg / ml 1 ml / vial ) , injection ] 37.5 boot no 8, 9, 10. 37.51 sleeper no 6, 7, 8, 9, 10 37.52 weith machine mini ( 1gm to 5kg ) 37.53 heating mantle 37.54 inj multivitamine 37.55 onit eberconazlole cream 1% w / w 37.56 cassette ( 10 x 12 ) , consumable fujji 37.57 cassette ( 8 x 10 ) , consumable fujji 37.58 cassette ( 14 x17 ) , consumable fujji 37.59 centrifuse machine 37.6 blood presure machine digital 37.61 cassette ( 10 x 12 ) , consumable cr system 37.62 cassette ( 8 x 10 ) , consumable fujji cr sysyem 37.63 cassette ( 14 x17 ) , consumable cr system 37.64 lectolose 37.65 inj multivitamine 10ml 37.66 inj insulin 40 iu 37.67 inj capnea 37.68 inj fluorouracil 5 37.69 coden set...

Defence Research And Development Organisation - Madhya Pradesh

35013782 bids are invited for chemical ammonium persulfate , lysozyme , triton x 100 , urea , ammonium bicarbonate , bca protein assay kit , formic acid , tween 20 , 2 b mercaptoethanol , edta , acrylamide suitable for electrophoresis , bis acrylamide , trizma base , glycine , dithiothretol , iodoacetamide , glycerol , nacl , isopropanol , agarose for molecular biology , sodium dodecyl sulphate , 1x pbs powder , potassium chloride , sodium phosphate , sodium phosphate monobasic reagent plus , potassium phosphate, monobasic , bsa 10 gm , sodium bicarbonate , tween 80 , temed , etbr , bromophenol blue , coomassie blue dye r 250 , ponceau suitable for electrophoresis , imidazole , cyrstal violet , iptg , guanidine hydrochloride , nickel sulphate , peg 8000 1g , mgso4 , mncl2 , ca no3 2 , xylene cyanol , cacl2 molecular grade , pmsf , tmb total quantity : 324...

Indian Army - Madhya Pradesh

34879880 supply of expendable medical stores dopamine hcl40 mg / ml, 5ml inj 3 benzoyl peroxide 5% tube of 20 gms 4 framycetin sulphate cream bp 1% cream 15 gms 5 glycerin ( glycerol ) 6 hydroquinone 2% tube of 50 gm 7 ketoconazole lotion 2% bott of 75 ml 8 silver sulphadiazine 1% cream w / v jar of 500 gms 9 tretinoin 0.025% tube of 15gm 10 liquid antiseptic ( chlorhexidine solution ) with activator containing chlorhexidine gluconate bp 7.5% v / v cetrimide bp 15% w / v sufficient quantity of tab sodium nitrite 1g to make 0.4% soln with each 1 litre cont in air tight pack 11 dicyclomine hcl 20mg inj 12 insulin highly purified human neutral40iu / ml, 10 ml inj 13 insulin highly purified isophane ( human nph ) 40iu / ml, 10 ml inj 14 nourish renal ( 100 gm , providing 486 kcal , proteins 11.5g , carb 60.4g, fats 22.7g, ( min & vit ) 15 acyclovir ophth oint 3% w / v ( 175mg ) bott of 30 opticaps 16 ciprofloxacin hcl 0.3% + dexamethasone 0.1% bott of 17 gentamicin sulphate 0.3% w / v gentamicin base with hydrocortisone acetate ip 1% w / v eye & ear drops ott of 5 18 homatropine hydrochloride, sol 2% 19 ofloxacin 0.3% bott of 5 ml eye drop 20 sulphacetamide drops 20% ml ( sod ) in 10ml / 14ml amber 21 cetrizine syp 5mg / 5ml bott of 60 ml 22 vitamin e 200 mg cap 23 azelastine nasal spray 0.10% w / v 24 fluticasone propionate inhaler 50mcg / dose 25 ofloxacin 400 mg tab 26 fexofenadine hydrochloride tab 120 mg 27 inj gentamycin sulphate 40 mg 28 cream miconazole 29 glass, cover microscopic rectangular, 22 x 30mm made of usp no1 glass 30 micropipettes, tips for 500 1000 ul 31 alcohol methyl 32 sodium hypochlorite solution 10% 33 xylene ( xylol pure ) 34 arm sling strap 35 eye sodium chloride 36 eye drop systane 37 eye drop tear plus 38 capd fluid minicap 39 dettol hand wash 40 ear drop waxole 41 eye drop bepostatin 1.5 42 eye drop betaxolol 43 inj insulin humalog 50 / 50 prefilled syringe 44 inj leuprolide 22.5 mg 45 mometasone nasal spray 46 novo fine needle 47 cream melaglow 48 lactobacillus sachet 49 rotacaps levosalbutamol 50 syp aristozyme 51 tab atorvastatin 40 mg 52 tab bosentan 125mg 53 tab telmisartan + amlodipin 54 ointment heparin + benzylnicotine 55 ointment suncross 56 tab brivaricetam 25mg 57 inh buenocide 58 tab hydroxyzine 10mg 59 tab quitiapine 300mg 60 inj romiplastim 250mcg / 0.5ml 61 tab thyroxine 88mg 62 hydrocortisone acetate 25mg / ml, 5ml inj 63 adrenaline tartrate ( 1:1000 ) , 1ml inj 64 tramadol hc 50mg / ml inj 65 atropine sulphate 0.6mg, 1ml inj 66 lignocaine hci 2% ( without adrenaline ) 30ml in 67 ether solvent 68 tab vilazodone ( vilamide 20mg ) 69 eye drop sustane ultra 70 tab strocit 500mg 71 inj ree 10 72 tab olmetime amh 20mg 73 tab tinicar 74 tab platewell 75 tab macplate 76 tab serobid 50mg 77 tab triniclam forte 78 diclofenac sodium 50mg + paracetamol + serratopeptidase tab 79 lancet 80 tab glucosamine + diacerine 81 tab flupentixol + melitracen 82 tab nimodipine 30mg 83 tab perampenel 2mg 84 neomycin, beclomethasone, clotrimazole & lignbocaine ear drops ( 5ml ) 85 nasal spray mometasone furoate 50mcg 100mdi 86 inj omnipaque 350mg / 100ml 87 tab nifedipine retard 30mg 88 inj dexamethasone ( 2ml / 8 mg ) 89 tacrolimus ointment 0.03% tube of 10mg ( like hhmus ) 90 tacrolimus ointment 0.01% tube of 10mg ( like hhmus ) 91 oint fluticasone propionate 0.05% w / v 10gm 92 lotion mometasone furoate0.1% 10gm ( like hhsone ) 93 cream clobetasole 0.05% + salicylic acid 3.5%, 30gms ( like cream dipsalic ) 94 cream luliconazole 1, tube of 10gm 95 tab / cap zeaxanthing+ lutein + astaxanthin + zinc + beta carotene+ carotenoids 96 hydroxy propyl methyl cellulose ( hpmc ) eye drops 0.3%, 0.5%, 0.7% 97 syp disodium citrate 100ml 98 gargel povidone iodine 2% 100ml bott 99 rotacap tiova 100 syp polybion...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Directorate Of Medical Education - Madhya Pradesh

34145016 supply of medicine / surgical / iv fluid / surgical suture / surgical stapler / chemical kits aceborophylline 100 mg amantadine 100mg capsule apripitant capsule 125mg & 80mg calcitrol 0.25 mg cap calcitrol 0.5mg capsule calcitrol calcium carbonate and zinc capsule chloramphenicol 250mg capsule chloramphenicol 500mg capsule crizotinib 250mg capsule cyclosporine 100 mg cyclosporine 50 mg deferiprone 500 mg cap. imatinib mesylate 100 mg oseltamivir ( 45mg ) , capsule palbociclib 100 mg cap palbociclib 75 mg cap sildenafil 20mg tetracycline capsules 250 mg tetracycline capsules 500 mg ulipristal acetate capsules 5mg acyclovir 3% ear drop beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5% 5 ml ear drop fluromethanol eye drop gentamycin eye drop homatropine hydrobromide eye drop ip 5ml sterile lignocaine hcl 4% eye drop natamycin eye drop polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml polyvinyl alcohol 1.4% 5 ml prednisolone eye / drop. proparacaine hydrochloride 0.5% eye drops 5ml sodium chloride opthalmic solution 5% eye drop acyclovir 3% eye oint.5 gm tube atropine eye oint. 3gm tube chloramphenicol eye ointment 5 gm tube ciprofloxacin eye ointment 5 gm tube hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment tobramycin eye oint.3gm tube benzocain gel chlorhexadine gel choline salicyclic gel triamadone accetate gel sterile collogen granules nephro steril ( alanine 6.3 gm+l arginine 4.9 gm+l histidine 4.3 gm+l isoleucine 5.1 mg+l leucine 10.3 mg+l lysine 10.01 gm+l phenylalanine 3.8 gm+l threonine 4.8 gm+l valine 6.2 gm+methionine 2.8 gm+n acetylcarnosine 0.5 gm+proline 4.3 gm+serine 4.5 gm+tryptophan 1.9 gm ) 250ml infusion normal saline 1.6% 500 ml bottle parenteral nutrition two chamber bags without lipid ornidazole iv infusion 100ml bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle desflurane 240ml bottle solution usp inhalation anaesthetic adalimumab 20mg / 0.4ml inj adalimumab 40mg / 0.8ml inj adenosine 3 mg / ml 2 ml amp ado trastuzumab emtansine 100 mg inj alteplase 50mg inj amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle aminophylline 25 mg / ml 10 ml vial ampicillin+sulbactum 1.5 mg inj anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d anti human thymocyte immunoglobulin 25 mg anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj benzathine penicilline 12 lac iu / vial betamethasone sodium phosphate 4 mg / ml 1 ml amp biphasic insulin aspart ip penfill 100 iu inj 3 ml cartridge bortezomib 3 .5 mg / vial botalinin 100iu inj botalinin 200iu inj botulinum toxin type a injection buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj butorphanol 1mg / ml 1ml amp carboprost tromethamin 250 mcg / ml 1ml amp cefuroxime 1.5gm inj cefuroxime 500mg inj cetuximab 100mg 2mg / ml vial cetuximab 200mg 2mg / ml vial cetuximab 50mg 2mg / ml vial chloramphenicol 500mg inj chlorpromazine ip 25mg vial cholecalciferol 600000 iu / ml injection cis atracurium 2mg / ml vail cladribine 10 mg / 10ml inj clonidine hydrochloride 100 mcg / ml 10 ml vial contrast urograffin inj cytarabine 1000 mg iv cytarabine 100mg injection cytarabine 1gm inj daunorubicin 50 mg / vial dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) dextron 40 inj diatrizoate meglumine & diatrizoate sodium ( 37% ) vial diatrizoic acid 60% amp diatrizoic acid 65% amp diatrizoic acid 76% ( urographin dye ) injection diazepam 5 mg / ml 2 ml amp dicyclomine 10mg / ml 2 ml vial digoxin i.p. 0.5mg / 2 ml amp diltiazem 25mg / 5ml vial diphtheria antitoxin 1000 iu vial doxorubicin 500mg injection doxycyclin 100 mg injection edaravone 60 mg inj enalapril maleate inj 1.25 mg per ml 2ml vial ephedrine 30mg / ml 1ml inj esmolol / 40mg / ml 5 ml vial etanercept 25mg inj etanercept 50mg inj etomidate 2 mg / ml emulsion with mct 10ml vial fentanyl 100 microgran 2 ml amp fentanyl 50 microgran 2 ml amp fluorescein 20% 5 ml amp flupentixol 20 mg inj flupentixol 25 mg inj fluphenazine 25 mg / ml 1 ml amp ganciclovir 500 mg vial gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp gatifloxacin vial gentamycin 80mg / 2ml amp glutathion 600mg inj granulocyte colony stimulating factor ( gcsf ) inj haemocoagulase 1 iu inj haemophilus influenzae type b vaccine hepatitis b vaccine / 1ml hyaluronidase 1500 iu / 2ml amp ifosfamide + mesna 1gm inj infliximab 100mg inj insulin glargine injection iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle isobaric levobupivacaine 0.5% inj isoprenalin inj 1ml amp isoxsuprine hcl 5mg / ml 2ml amp ketamine hydrochloride 50 mg / ml 10 ml ketoprolac tromethamine 30 mg inj l aspiraginase 10000iu inj leuprolide 6.25mg inj levobupivacaine hyperbaric 0.5% lidocaine 4%, 5 ml vial lignocaine ( preservative free ) 2% 50 ml vial lignocaine 10% injection lignocaine 4% 30 ml vial lignocaine for spinal anaesthesia lignocaine 5% + destrose 7.5% 2 ml amp heavy lorazepam 2 mg / ml, 1 ml vial low molecular weight dextran 40000 vial mannicoccal acwy 0.5 ml inj meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial mephentermine 30 mg / ml 10 ml mesna 200mg injection methacarbamol 100 mg. / 10ml vial methotrexate 500mg injection metoprolol 5mg / ml 5ml vial micafungin 100 mg micronised progesterone 50mg / ml 2ml amp micronized progesterone 100mg / ml 2ml amp milrinone 1mg / ml solution for injection / infusion mitomycin c 40mg inj mitoxantrone 15 mg inj morphine sulphate 10mg / ml 1ml amp naloxone 0.4 mg / ml, 1 ml nikethamide amp nimodipine 10mg / 50ml injection nitrofurantoin injection olanzapine 10 mg inj olanzapine depot inj panitumumab 100mg / 5ml inj pembrolizumab 100mg / 4ml ( 25mg / ml ) penicillin v 125 mg inj pentoxiphylline 20 mg / ml pertuzumab 30mg / ml ( 420mg / 14ml ) phenobarbitone 100mg / ml 1ml amp. phenobarbitone 200mg / ml 1ml amp. pilocarpine 0.5 % / 1ml amp piperacillin 2 gm+tazobactam 250 mg placenta extract 2 ml injection pneumococcal vaccine 10 ml vial pregabalin inj progesterone b.p.100mg vial promethazine 2 ml / 2.5% vial protamine sulphate 1%, 10mg / 5ml amp quinine sulphate 300 mg / ml, 2 ml amp romiplostim 250 mg injection romiplostim 500 mg injection ropivacaine 0.5% 20 ml vial ropivacaine 0.75% 4ml amp ropivacaine 10mg / ml 2.5ml vial ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) sargramostim 500 mg inj soluble insulin penfill 3 ml injection surfactant ( porcine lung surfectant extract 80mg / ml ) terbutaline 0.5mg / ml aml amp teriparatide 600mcg 3 ml amp tetanus immunoglobulin usp 500 iu / vial thiamine 400mg inj thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) thiopentone sodium 0.5gm powder / vial, 20 ml vial tobramycine 80 mg vial tocilizumab 400 mg inj torsemide inj 2ml amp trypan blue opthalmic solution 0.06% pre filled syringe ulinastatin 100000iu injection urokinase 500000 iu vial vasopressine 40 iu / ml amp verapamil hydrochloride 2.5 mg / ml 2ml amp vinblastine 10 mg / 10 ml amp vinorolbine 50mg inj vit d3 injection vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj water for injection 10 ml amp zuclopenthixol acuphase 50 mg inj zuclopenthixol decanoate 200 mg inj acetic acid solution 3% 100ml acetone detection kit ada kit ae 1 / ae 3 aluminium ammonium sulphate powder 500gm amacr ana test kit anti a lactin 05ml anti ab sera 10ml anti d igg+ igm 10ml anti d igm 10ml anti h lactin 05ml anti her / erbb2 monoclonal anti human globulin ( ahg ) 05ml anti a sera 10 ml anti b sera 10 ml banded use in blood bank barium chloride 10 % 500 ml bcl 2 benedict reagent 5 lit cane bismark brown stain 100 gm blood culture media aerobic for adult ( bac t / alert pf plus blood culture media anaerobic for pediatric ( bac t / alert pf plus ) blotting paper 50 / pkt bovine albumin 22% 05ml buffer solution for hiv 50ml ca 125 calcium chloride 05ml / vail capillary tube cd34 combined spinal epidural ( cse ) kit couplin jar cover slips size 18x18mm cover slips size 22x22mm cox 2 csf protein kit cyclin d 1 cyto fix spray desmin disposable microtome blade ( 50 blades in one ) dpx mount 250ml ehlrich aldehyde reagent 125 ema estrogen receptor epi monoclonal filter paper 12.5 cm 0.1 micron ( 50 per pkt ) fouchet reagent 250ml glacial acetic acid 100 ml glial fibrillary acidic protein ( gfap ) h2so4 25 % 500 ml bottle haematoxylene 5gm haemoglobin strip hbv elisa test kit 4th generation 96 test hbv rapid test kit hpr polymerr kit with dab chromogen hydro chloride acid about 36.46% i.d. microtyping abd card i.d. microtyping gel card ahg immersion oil iso propyl alcohol ki67 / mib 1 06 ml antibody kit leishman stain 500 ml leucoreductionfilter ( bed side ) light green stain 100 gm liquid ammonia 500 ml liss diluent for gel card malaria parasite elisa test kit massons trichrome stain mercuri oxide 25gm methanol 2.5lit mgg 480ml multi parameter urine strips ( 100 in 1 box ) myogenin n / 10 hcl 500ml nfp nitric acid 500 ml nkx 3 1 p 53 pandys reagent 125ml pap pen papanicalou ea 125ml pea 030 papanicalou og 6 125ml pea 010 paraffin wax 58 60c pas stain pasture pipette poly l ltsin solution p8920 polythene gloves pricking lancet progestron receptor monoclonal retic stain 125ml s 100 sharp collection containers disposable 5 ltrs sharp collection containers disposable 1.5 ltrs single donor platelet kit make haemonotics / terumo penpol ( close system ) slide tray sma sodium chloride for analysis steel cassets for tissue processing sulpgar powder 500 gm sulpho salicylic acid 500ml synaptophysin tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) tissue paper roll titriplexiii pure ( edta ) tris buffer gr tween 20 for synthesis vdrl elisa test kit vimentin wafers cutting blade for tube welders xylene chlorhexidine mouthwash 0.2% 50 ml sterile haemocoagulase solution topical solution 0.2 cu nasal drop saline nasal gel 15 gm tube budesonide nasal spray 32mcg / spray methylcobalamin nasal spray 250 mcg saline nasal wash 3gm kit sodium chloride nasal wash betamethasone 0.5mg, gentamicin 1mg betamethasone valerate cream 0.05% 15gm betamethasone valerate ointment 0.1%, 15 gm tube centella asiatica extract based skin moisturization and antiscar gel 30gm clindamycin ointment 10gm fluconazole ointment 20 gm tube fusidic acid 2%, 15 gm heparin 20gm oint human placental extract ointment ketoconazole cream lidocaine zinc oxide ointment luliconazole cream la magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm papain urea and silk protein based debriding ointment and cream 100 gm papain urea and silk protein based debriding ointment and cream 25 gm papain urea and silk protein based debriding ointment and cream 50 gm papain urea 15 gm tube povidone iodine ointment 7.5%, 500 gm salicylic acid 2%, 30 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm silver sulphadiazine cream usp 1% w / w 250gm clotrimazole+beclomethasone oral paint triamcinolone oromucosal paste bp 0.1% ketocanazole oral paste triamcinolone acetonide dental paste usp 0.1% barium sulphate powder 250 gm clotrimazole powder neomycin sulphate+polymycin b powder polyethylene glycol + electrolyte powder protein powder silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial n acetylcysteine solution for inhalation respules tiotropium ( 18 mcg ) + formoterol ( 12 mcg ) fostomycin sachet 3gm orodispersible probiotic sachet acyclovir lotion beclomethasone lotion citric acid 500 ml bottle compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml feracrylum solution 1% 100 ml gention violet l / a glycerine 15% and sodium chloride 15% enema 20ml sodium hypochloride solution 5% 5 ltr topical heparin solution 5ml vial benzocaine +cetramide spray lignocaine spray 10% absorbable 2 0 endo suture cartridge 48 length advance rf energy hand instrument of 5 mm shaft diameter for laproscopic procedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm disposable circular stapler 31mm diameter disposable circular stapler – 32mm diameter disposable circular stapler 33mm diameter disposable circular stapler iii rows disposable circular stapler 25 / 26mm diameter disposable circular stapler 28 / 29mm diameter disposable clip applier medium 10mm with 20 clips disposable clip applier medium 5mm with 16 clips disposable curved cutter stapler disposable hemorrhoidal stapler iiirows disposable hemorrhoidal stapler with detachable anvil. disposable linear stapler with fixed staple height 75mm 90mm size disposable linear stapler with fixed staple height 55mm 60mm size disposable trocar 05mm disposable trocar 10mm disposable trocar 12mm disposable trocar 15mm distal tip closure titanium ligation clip large size distal tip closure titanium ligation clip medium size distal tip closure titanium ligation clip small size endoscopic cutter & stapler 60mm long length endoscopic cutter & stapler 60mm regular length endosuturing device 10mm with toggle lever handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh handpiece ( transducer ) compatible with ultrasonic vessel sealing dissector installed in myh hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc locking clip cartridge medium / large mesh fixation device with non absorbable titatinum tacks 20 multifire clip applier long size 15 clip multifire clip applier small size 20 clip non absorbable 2 0 endo suture cartridge 48 length open clip applicator 100 20cm length open clip applicator 200 20cm length open clip applicator 300 open clip applicator 400 open disposable clip applier for medium clip size 9.75 having 20 clips open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length plastic locking clip applicator medium / large polycearbonte bladeless trocar with reducer seal 10mm polycearbonte bladeless trocar with reducer seal 12mm polycearbonte bladeless trocar with reducer seal 5mm polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm reload 55 60mm for medium thick tissue blue compatible with linear cutter. reload 55 60mm for thin / vascular tissue white compatible with linear cutter. reload 75 80mm for medium thick tissue blue compatible with linear cutter. reload 75 80mm for thick tissue green compatible with linear cutter. reload compatible with curved cutter reload endoscopic cutter & stapler 45mm purple reload endoscopic cutter & stapler 60mm purple reload endoscopic cutter & staplter 45mm blue reload endoscopic cutter & staplter 45mm green reload endoscopic cutter & staplter 60mm / black reload endoscopic cutter & staplter 60mm blue reload endoscopic cutter & staplter 60mm gold reload endoscopic cutter & staplter 60mm green reload endoscopic cutter & staplter 60mm white reload for linear stapler with fixed staple height 35mm 45mm size blue reload for linear stapler with fixed staple height 35mm 45mm size green reload for linear stapler with fixed staple height 55mm 60mm size blue reload for linear stapler with fixed staple height 55mm 60mm size green reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly reusable laparoscopic clip applicator for large titanium clips. reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly reusable linear cutter 55 60mm with 200 firing reusable linear cutter 75 80mm with 200 firing single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip suture locking autolock titanium clip 100 titanium clip 400 universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. paracetamol suppository abdominal drain no 8 abdominal drain bag accessory spikes amorphous hydrogel with colloidal silver antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm antimicrobial incise drape 3 meter antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm arterial pressure bag 1000ml arterial pressure bag 500ml ash brace m size barium sulphate liquid 1 liter bionet connector biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered bipolar forceps cable bis monitor electrode black monofilament 2 / 0 rc loop black thread ( stitching ) big bleaching powder gr ii 25 kg bag blood bag double 350 ml cpd solu blood bag double 350 ml with sagam blood bag quadruple 350 ml top bottom with cpd sagam solu blood bag quadruple 450 ml top bottom with cpd sagam solu blood bag single 350 ml blood bag transfer 350 ml blood bag triple 350 ml blood bag triple 350 ml sagam blood culture bottles bone marrow aspiration needles ( 14 ) bone marrow aspiration needles ( 15 ) bone marrow aspiration needles ( 16 ) bone marrow aspiration needles 13 g bone marrow biopsy needle bp cuff adult & pediatric carbolic acid 500 ml cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) catheter single lumen 6.6 no catheter single lumen 7.7 no cautery patient plate disposable central venous line 4f cerebral catheter reservoir 12mm dia chamber cerebral catheter reservoir 18mm dia chamber cervical soft collar chlorhexidine gluconate dressing material chlorinated lime with boric acid solution 400ml cling drape 15x500cm closed suction trachostomy suction tube with pro s collegen patch collogen sheet 10x10 collogen sheet 15x15 colostomy kit condom catheter small, meadium, large conjugated drain craniotomy cutter blade cresol with soap solution 5ltr jar cvp manometer cylinder connection nut dermatome blade disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 dj stent 6 / 26 double monitoring pressure transducer dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. dura guide for neuro surgery ecg paper 80mmx20 mtr roll ecg paper computerized triple channel 20m elastomeric pump for post operative analgesia endo stich lap suturing device 10 mm endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm extra ventricular drain ( evd ) fibrin & tissue glue fluorescein strips pkt foam sclerotherapy fibre fogartis catheter 4 fr gasket for vaccume jar 1000 ml gasket for vaccume jar 600 ml gasket for humidifier bottel guide wire m 0.89mm, 150cm halogen bulb holder ( heavy duty ) hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) hip u drape humbys knife disposable blade hydrocephalus shunt medium pressur ( vp shunt ) hydrogen peroxide 21% w / w, paracetic acid 4% w / w, acetic acid 10% w / w ( cold st disinfectant for dialysis ) icd bag implantable pain port with epidural catheter for long term pain management impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml intraocular lens 14 30d dioptre intravenous drip set pediatric size introducer sheath 0.97mm 6fr, ( 2.0mm ) , 11 cm introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm j r c bag 1 ltr j r c bag 1.5 ltr j r c bag 1 / 2 ltr 500ml kehr t tube laser radial fibre 600 micron and 400 micron liga clip 200mm, 300mm, 400mm liver biopsy gun long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm mackintosh double colour water proof roll ( 20 meter per roll ) malecot rubber catheter no 12 malecot rubber catheter no 16 malecot rubber catheter no 20 malecot rubber catheter no 22 malecot rubber catheter no 24 medical dry imaging film 10x12 medical dry imaging film 14x17 medical dry imaging film 8x10 methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 microlaryngeal surgery tube no 5 monopolar cautry wire disposable neonatal urine collection and measurement bag 100 ml omaya reservoir large size oxygen adaptor 5 type oxygen catheter oxygen connection with flow meter for central line oxygen connection with flow meter for cylinder oxygen high pressure hose pipe oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) oxygen regulator for control penal board ( oxygen pipe line ) oxygen tailpipe ( flexible metalic ) pacing leads 6 fr paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, paraffin gauze dressing material 10x10cm pediatric diapers peritonial dialysis catheter 200mm pediatric peritonial dialysis catheter 280mm adult peritonial dialysis fluid 1ltr. pigtail catheter 6 fr ( 150 cm ) pigtail catheter with needle 6 fr ( 30 cm ) plaster of paris powder ip 1 kg pkt plastic nozel cap post exposure prophylaxis kits ( pep kits ) pressure regulated v p shunt for peadtric probe for oxygen radiopaque polyurethane catheter with fixation wings and integral extension tube 2f, 5f ( leader flex ) rectified sprit 4.5 ltr. scrotals support short pencil point spinal needle g 25 / 22, l 38mm. sics kit ( small incision cataract surgery ) silicon / double nasal prong with universal connector. all sizes silicon cautery plate silicon folyes catheter 14 fr silicon folyes catheter no 12 silicon tubing set for endoflaton silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm silk protein based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein based sterile surgical pu foam dressing 20cmx20cm silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilized sizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr soda lime for anesthesia workstation 5kg spatula for papsmear sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. sterile post‐operative surgical dressing surgical kit drape gown t.piece circuit with oxygen tubing set ( complete set ) tear test strip ( 100 strips in box ) terrimo guide wire thomas splint tmt graph paper tommy syringe tounge depresser wooden tracheostomy filter transducer set for invasive b.p. triway folyes catheter no 22 turp set ureteric catheter urine collecting bag with urometer 1 ltr. vaccum adaptor 5 type vaccum pump belt vaccum pump oil vaccum regulator ventilator circuit ( heated wire ) ventilator mask water bed wipes wound protector extra small incision size 2 4 cm wound protector large incision size 9 14 cm wound protector large incision size 9 14 cm with retraction ring wound protector medium incision size 5 9 cm wound protector small incision size 2.5 6 cm x ray casset 12x15 x ray casset 10x12 x ray casset 8x10 x ray developer 22.5 lit. x ray films size 10x12 50film per pkt blue sensitive x ray films size 12x15 50film per pkt blue sensitive x ray films size 8x10 50film per pkt blue sensitive x ray fixer 22.5 lit x ray hangers ( clip type ) 10x12 x ray hangers ( clip type ) 12x15 x ray hangers ( clip type ) 8x10 x ray screen high speed 12x15 x ray screen high speed 8x10 x rayscreen high speed 10x12 180 absorbable polyglyconate knotless wound closure device with unidirectional 0 30cm , green 37mm 1 / 2 circle taper point 180 absorbable polyglyconate knotless wound closure device with unidirectional 2 0 30cm , green 37mm 1 / 2 circle taper point 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved absorbable unidirectional barbed device polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm black braided silk 2 0 rb 5333 suture 17mm 1 / 2c taper black braided silk 3 0 rb suture 17mm 1 / 2c taper black braided silk 5 0 rb suture 17mm 1 / 2c taper black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. knotless wound closure device with unidirectional 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting knotless wound closure device with unidirectional 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm monofilament glycomer 0, 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 1 , 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 2 0 , 75cm , violet 27mm 1 / 2 circle taper point monofilament glycomer 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting monofilament glycomer 3 0 75cm , violet 22mm 1 / 2 circle taper point patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or and us fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. perforator 14mm pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system polydioxanone 122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. polydioxanone barbed suture 1 0 polydioxanone suture voilet monofilament 17mm 1 / 2c taper no 4 0 90cm polydioxanone suture voilet monofilament 40mm 1 / 2c blunt point 1 240cm polydioxanone suture voilet monofilament double armed trocar point 2 0 70cm polydioxanone suture clear monofilament 36mm 1 / 2c taper 3 0 70cm polydioxanone suture voilet monofilament 17mm 1 / 2c 5 0 70cm polyglactin 4 0suture undyed braided 1 / 2c reverse cutting polyglactin 910 with triclosan no. 0 x 90 36mm hc rb polyglactin 910 with triclosan no. 1 x 100 55mm hc rb polyglactin 910 with triclosan no. 1 x 90 36mm hc tc progrip self fixating mesh 12*08cm progrip self fixating mesh 14*9cm progrip self fixating mesh 15*15cm progrip self fixating mesh 20*15cm progrip self fixating mesh 30*15cm protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved sterilised surgical needled suture 8mm 1 / 4 spatulated micropoint double 5 0 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system v shape clip applicators large v shape clip applicators medium v shape clip applicators small v shape ligation clip large v shape ligation clip medium v shape ligation clip small aciclovir 200mg / 5ml oral suspension 100ml bottle albendazole suspension 200 mg / 5ml bottle baclofen oral solution ip 1mg / ml syp calcium phosphate, 2:1 ratio, 100 ml bottle carbamazepine oral suspension usp 100ml syp chloramphenicol palmitate oral suspension ip 125mg / ml 100ml syp chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle ciprofloxacin 125mg / 5ml syp 60 ml bottle co trimoxazole 30 ml cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml cyclosporine oral solution usp 100mg / ml 50ml syrup cyproheptadine + lycine and vitamins 200ml syp cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle domperidon suspension 1mg / ml 30 ml bottle etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle ibuprofen oral suspension bp 100mg / 5ml 100ml syp iron+zinc syp metronidazole 200mg / 5ml suspension 60ml bottle nitazoxanide 100mg / 5ml 30 ml bottle norfloxacine suspension ( 30 ml bottle ) oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle paracetamol oral solution 150mg / ml 15 ml bottle with dropper paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) phenobarbitone syp 30ml. 20mg / 5ml. phenytoin sodium suspension 30mg / 5ml 100 ml bottle prednisolone sodium phosphate solution 5mg / 5ml 60ml syp salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle sodium valporate oral solution 100ml syp sorbitol 7.15 gm+tricholine citrate 0.55 gm sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle trypsin bromelain & rutoside trihydrate tablets 6 mercaptopurine , 50mg acarbose 25 mg aceclofenac 100mg+paracetamol 500mg , tablet aceclofenac+thiocolchicoside 100mg+4mg tablet aceclofenace 100mg+serratiopeptidase 15mg tab acenocoumarol 2 mg tab acenocoumarol 1mg acyclovir 200mg tab ademetionine 100mg tab afatinib 40 mg agomelantine 025 mg tab alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg ambroxol hydrochloride 30mg tab amitriptyline 10 mg amlodipine ( 5 mg ) + metoprolol ( 50 mg ) artemether 80mg tab artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab aspirin 75 mg aspirin 150 mg aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg aspirin 75 mg+prasugrel 10 mg atorvastatin 10 mg+aspirin 75 mg. baclofen 5mg tab benfothiamin 150mg betahistine 4mg tab betamethasone 0.5 mg bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg bisoprolol 5 mg+amlodipine 5 mg bosentan 62.5 mg tab brivaracetam 50mg tab bromocriptine 2.5mg tab buprinorphine 4mg buprinorphine 8 mg bupropion 300 cabargolin 0.25 mg cefadroxil 500 mg chlorthalidon 50 mg tab cilostazole 50mg tab cilostazole100mg tab cinnarizine 20 mg and dimenhydrinate 40 mg citicoline 500mg tab clopidogrel 75 mg+aspirin 75 mg clopidogrel 75 mg+atorvastatin 20 mg clotrimazole 400mg tab co trimoxazole tab cyclophosphamide 50 mg tab cyclosporine 300mg tab cynocobalmin + folic acid tab dapagliflozin 5mg tab dapsone 100 mg tab deferasirox dispersible 500mg tab deflazacort 6mg tab desmopressin 0.5mg tab dexamethasone 4 mg tab diphenylhydramine 50 mg domperidone+ranitidine 150mg tab drotaverine 40 mg tab drotaverine 80mg duloxetine 40mg dydrogesterone 10mg eltrombopag olamine 150mg tab empagliflozin 25mg tablet entecavir 0.5mg tab entecavir 1mg tab eplerenone 25mg erlotinib tablets ip 100mg escitalopram 10 mg tab esomeprazole 40mg ethambutol hydrochloride 400mg tab ethambutol hydrochloride 800mg tab etizolam+propranolol 20mg tab etophylline 77 mg+ theophyllin 23 mg etoposide 50 mg etoricoxib 90mg farmalin 1gm tab ( 100 tab per box ) fenofibrate 160mg tab ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) fludrocortisone 0.1mg tab folic acid 800 mcg fungal diastase 100 mg+papain 60 mg gabapentin 400 mg+nortriptyline 10 mg ganciclovir 1000mg tab glibenclamide 2.5mg tab gliclazide 60mg glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg glimepiride 2 mg+metformin 500 glipizide 5 mg+metformin 500 mg glucagon 0.1mg tablet glyceryl trinitrate 0.5 mg sublingual tab hydrocortisone 10 mg hydrocortisone 20mg tab hydroxyzine 10 mg tab hyoscine butylbromide tab 10mg ibuprofen 400 mg indapamide hemihydrate 1.5mg isoniazid 200 mg tab isosorbide 5 mononitrate 20 mg isosorbide mononitrate 30 mg itopride 150mg itopride hydrochloride 25 mg tab itopride hydrochloride 50 mg tab l carnosine 200mg tablet lactobacillus 120 lamotrigine 25mg tab lansoprazole 15mg tab lapatinib 250 mg levetiracetam 750mg tab levodopa + carbidopa 100+25mg levofloxacin 750mg tab loperamide 8 mg tab lorcaserine 10 mg tab losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) lurasidone 20 magnesium oxide 200 mg magnesium valproate 400 mg mebendazole 100 mg tab meclizine hydrochloride 25 mg mefenamic acid 250mg+dicyclomine 10mg tab megestrol acetate 40mg melatonin 3mg melatonin 6mg mercaptopurine 50mg tab mesalamine ( 5 aminosalicylic acid ) 400 mg tab metaclopramide 10 mg tab metformin ( 1000 mg ) + vildagliptin ( 50 mg ) metformin 500 mg+voglibose 0.3 mg methimazole 10 mg tab methocarbamol 500 mg. methotrexate 10 mg methotrexate 5 mg tab methylcobalamin +folic acid tab methylcobalamin 1500mg tab methyldopa 250 mg tab methylphenidate 10 mg methylphenidate 20 mg methylphenidate 5 mg metoclopramide 05 mg metoprolol 12.5 mg metoprolol 50 mg+ramipril 5 mg misoprostol 200 mg modafinil 200mg tab morphine sulphate 10mg tablet moxonidine 0.3 mg multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) mycophenolate mofetil, 500 mg n acetylcysteine 300mg tab naproxen 250 mg tab naproxen 500mg + domperidone 10mg tab naproxen 500mg tab nebivolol 5mg nicorandil 5 mg tab nicotinamide 250mg tab nicoumalone 1 mg nimesulide 100 mg nimodipine 30mg tablet nitazoxanide 200 mg nitazoxanide 500mg tab nitrocontin 2.6 nitroglycerin 2.5 mg ofloxacin 200mg +tinidazole 600mg tab ofloxacin 400mg tab olmesartan 10 mg olmesartan 20mg olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg olmesartan medoxomil 40 mg+amlodipine 5 mg oxcarbazepine 150 mg tab oxcarbazepine 300 mg tab oxybutynin 2.5mg tab pancreatic enzyme 1000mg tab pancreatic enzyme 2000mg tab pancreatic enzyme 500mg tab pantoprazole 40 mg+domperidone 30 mg paracetamol, chlorpheniramine maleate, phenylephrine hydrochloride & caffeine tablets pazopanib 200mg / 400mg penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) pentoxifylline 400mg perampanel 4mg phenobarbitone 30 mg. pramipexol 0.26 sr pramipexol 0.50mg prazosin 10mg tab propranolol hydrochloride 40mg+flunarizine 10mg tab propylthiouracil 50mg prucalopride 2mg tab quetiapine 50mg tab racecadotril 100mg ranolazine sustained release 500mg tab rifaximin 550 mg tablet rivaroxaban 10mg tab rivaroxaban 15mg tab rivaroxaban 5mg tab rosuvastatin 20 mg sacubitril 24 mg+valsartan 26 mg secnidazole 500 mg tab sevelamer carbonate 400mg tab sevelamer carbonate 800mg tab sildenafil 25 mg silodosin 8mg tab sitagliptin 50 mg+metformin 500 mg sodamint tab solifenacin 5mg tab sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab sulfasalazine 500mg tab sunitinib 50 mg tapentadol 50mg tab telmisartan 40 mg+amlodipine 5 mg telmisartan 80 mg+amlodipine 5 mg telmisartan 80 mg+hydrochlorothiazide 12.5 mg teneligliptin 20 mg tenofovir disoproxil 300mg tab terbutaline sulphate 2.5mg tab tetrabenazine 12.5mg tab tetrabenazine 20 mg tab tetrabenazine 25mg tab thiamine 200mg tab thiamine 75mg thyroxine sodium 137 mcg thyroxine sodium 62.5 mcg thyroxine sodium 12.5 mcg thyroxine sodium 150 mcg thyroxine sodium 125 mcg thyroxine sodium 88mcg tablet tianeptine 12.5 mg tolperisone hydrochloride 150 mg tab tolvaptan 15 mg topotecan 1 mg torsemide 10 mg+spironolactone 50 mg tramadol 37.5mg and acetaminophen 325mg tablet valganciclovir 450mg tab valganciclovir 500mg tab valganciclovir 900mg tab valsartan 40 mg venlafaxine 75 verapamil 120mg tab vidagliptin 100mg tab vidagliptin 80mg vilazodon 20mg vilazodon 40mg voriconazole 100mg tab voriconazole 150mg tab voriconazole 200 mg voriconazole 50mg tab vortioxetine 20mg vortioxetine 10mg vortioxetine 5 mg warfarin sodium 5 mg tab zonisamide 100 mg tab zonisamide 50 mg tab...

Directorate Of Health Services - Madhya Pradesh

33747699 supply of medicine and material medicine and material , medicine name , atropine inj 0.6 mg / ml 2 ml amp , bupivacaine hcl inj 0.5% 20 ml vial , glycopyrolate inj 0.2 mg / ml 1 ml amp , halothane inhalation 250 ml bottle , isoflurane inhalation 250 ml bottle , ketamine inj 10 mg / ml 10 ml vial , lignocaine inj 2% 30 ml vial , lignocaine gel 2% 30 gram tube , lignocaine +adrenaline inj 2% + 0.005 mg / ml30 ml vial , midazolam inj 1 mg / ml 5 ml amp / 10 ml vial , pentazocine injection 30mg / ml 1 ml ampule , thiopentone inj 0.5gm powder / vial 20 ml vial , nitrous ( store under pressure in metal cylinders of the type conforming to the appropriate safety regulations and at temperature not exceeding 37°c ) , oxygeninhalation , promethazine injection 10 mg / mlone injection 1 vial , propofal injection 10 mg / ml 1 ml / vial , aceclofenec tab 100mg 10 x10 , acetylsalicylic acidtablet 150 mg 10 x 10 , acetylsalicylic acid ( aspirin ) *tablet 25 mg 10 x 10 , allopurinol tablet300 mg 10 x 10 , allopurinol tablet 100 mg 10 x 10 , aspirin tab 75 mg 10 x 10 , atracurium inj 10 mg / ml 2.5 ml amp , diclofenac tab 50 mg 10 x 10 , diclofenac inj 25 mg / ml 3 ml amp , diclofenac 1% gel , fentanyl 50 microgram / ml 2 ml amp , hydroxychloroquine tablet 200 mg 10 x 10 , ibuprofen tab 400mg 10 x 10 , ibuprofen oral suspension 100mg / 5ml 60 ml bottle , morphine inj 10 mg / ml1 ml amp , paracetamol tab 500mg 10 x 10 , paracetamol drops 125mg / ml drops 125mg / ml , paracetamol inj150 mg / ml 2 ml amp , paracetamol syp 125mg / 5 ml 60 ml bottle , paracetamol tab 650mg 10 x 10 , pregabalin tablet 150 mg 10 x 10 , succinyl choline inj 50 mg / ml10 ml vial , sulfasalazine tablet 500 mg 10 x 10 , tapentadol tablet 100 mg 10 x 10 , tramadol inj 50 mg / ml 2 ml amp , tramadol tab 50mg 10 x 10 , betahistine tab 8 mg 10 x 10 , cinnarizine tab 25 mg 10 x 10 , adrenaline inj 1 mg / ml 1 ml amp , betamethasone tab 0.5 mg 10 x 10 , betamethasone sodium phosphate inj 4 mg / ml 1 ml amp , cetirizine tab 10 mg 10 x 10 , cetirizine syp 5mg / 5ml 30 ml bottle , chlorpheniramine inj 10 mg / ml10 ml vial , chlorpheniramine oral liquid 2 mg / 5 ml , dexamethasone inj 8 mg / 2 ml 2 ml vial , dexamethasone tab 0.5 mg 10 x 10 , hydrocortisone inj 100 mg / vial dry powder 100mg / vial , hydrocortisone ointment 0.5% , hydrocortisone ointment1% , hydroxyzine syrup 10 mg / 5 ml , hydroxyzinetablet25 mg 10 x 10 , pheniramine injection 22.75 mg / ml 2 ml vial , prednisolone tab 20 mg 10 x 10 , promethazine syp 5mg / 5ml 60 ml bottle , ferrous ascorbate ( 100mg. elemental iron+ folic acid 1.5 mg ) 10 x 10 , phytomenadione injection 10 mg / ml 10 mg ampule , carbamazepine tab 200 mg 10 x 10 , carbamazepine tablet 200 mg 10 x 10 , carbamazepineoral liquid 100 mg / 5 ml , diphenylhydantoin tab 30 mg 10x10 , levetiracetam tablet 250 mg 10 x 10 , magnesium sulphateinjection 500 mg / ml , phenobarbitone inj 200 mg 1 ml amp , phenobarbitone tab 30 mg 10 x 10 , phenytoin inj 50 mg / ml 2 ml amp , phenytoin / diphenylhydantoin tab 100mg 10 x 10 , sodium valproate tab 500 mg 10 x 10 , sodium valproate syrup each 5ml contains 200mg 200 ml bottle , valproate oral solution 200mg / 5ml 100 ml bottle , desferrioxamine injection 500 mg vial , naloxone inj 0.4 mg / ml 1 ml amp , pralidoxime ( pam ) inj 25 mg / ml 20 ml amp , abacavir tablet 300 mg 10 x 10 , acyclovir inj 250 mg / vial vial , acyclovir tab 200 mg 10 x 10 , acyclovir tab 800 mg 10 x 10 , albendazole 200mg / 5 ml 10 ml bottle , albendazole tab 400 mg 10 x 10 , amikacin inj 100 mg / 2 ml 2 ml vial , amikacin inj 500 mg / 2 ml vial2 ml vial , amoxycillin cap 250 mg 10 x 10 , amoxycillin cap 500 mg 10 x 10 , amoxycillin oral suspension 125 mg / 5 ml30 ml bottle , amoxycillin +clavulanic acid inj ( amoxycillin 500 + clavulanic acid 100 mg ) / vial , amoxycillin +clavulanic acid syp ( amoxicillin 200mg + clavulanic acid 28.5mg ) / 5ml 30 ml bottle , amoxycillin +clavulanic acid tab ( amoxycillin 500 + clavulanic acid 125mg ) 10 x 10 , amphotericin b injection 50 mg vial / ampoules , ampicillin cap 500 mg 10 x 10 , ampicillin inj 500 mg / vial , artesunate inj 60 mg / vial , artesunate powder for injection 120 mg , artesunate + sulphadoxine + pyrimethamine ( age group 15 or above ) ab artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg ( 2tablets ) + pyrimethamine 37.5 mg ( 2 tab ) tablets ip1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ab artesunate 150mg ( 3tab ) + sulphadoxine 500mg ( 2 tab ) +pyrimethamine 25mg tab ip ( 2tab ) 1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 years ) tab artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg ( 1 tab ) + pyrimethamine 25 mg ( 1 tab ) tablets ip 1 combi pack , azithromycin tab 250 mg 10 x 10 , azithromycin tab 500 mg 10 x 10 , azithromycin syp 200mg / 5ml 15 ml bottle , benzathine penicilline 6 lakh iu / vial , benzathine penicilline 12 lakh iu / vial , cefixime tab 50 mg 10 x 10 , cefixime tab 200 mg 10 x 10 , cefixime oral suspension 100mg / 5ml 10 ml bottle , cefotaxime inj 250 mg / vial , cefotaxime inj 500 mg / vial , cefotaxime inj 1gm / vial , cefpodoxime tab 200 mg 10 x 10 , ceftazidime powder for injection 250 mg , ceftazidime powder for injection 1gm , ceftriaxone inj 250 mg / vial , ceftriaxone inj 500 mg / vial , ceftriaxone inj 1 gm / vial , cephalexin cap 250 mg 10 x 10 , cephalexin syp 125mg / 5ml 30 ml bottle , chloroquine inj 40 mg / ml 5 ml amp , chloroquine syp 160mg / 10ml ( 50mg / 5ml base ) 60 ml bottle , chloroquine tab 250 mg 10 x 10 , ciprofloxacin tab 250 mg 10 x 10 , ciprofloxacintab 500 mg 10 x 10 , ciprofloxacin inj 200 mg / 100 ml 100 ml ffs bottle , clarithromycintablet 250 mg 10 x 10 , clindamycin capsule 150 mg 10 x 10 , clofazimine tablet 50 mg 4 10 x 10 , clofazimine capsule 100 mg 10 x 10 , clotrimazole ( vaginal tab ) pessary 500 mg ( with applicator ) single tab , clotrimazole cream 2%w / w 15 gram tube , cloxacillin capsule 125 mg 10 x 10 , cloxacillin capsule 500 mg 10 x 10 , cycloserine capsule 125 mg 10 x 10 , dapsone tablet 100 mg 10 x 10 , diethylcarbamazine tab 100 mg 10 x 10 , diethylcarbamazineoral liquid 120 mg / 5 ml , diloxanide furoate tablet 500 mg 10 x 10 , doxycycline cap 100mg 10 x 10 , doxycycline dry syrup 50 mg / 5 ml , fluconazole tab 150 mg 10 x 10 , furazolidone tab 100 mg 10 x 10 , gentamicin inj 40 mg / ml 2 ml amp , itraconazole tablet / capsule 100 mg 10 x 10 , ivermectin tab 12 mg 10 x 10 , levofloxacin tab 250 mg 10 x 10 , levofloxacin tab 500 mg 10 x 10 , linezolid tablet 600 mg 10 x 10 , meropenem 500 mg vial , metronidazole inj 500 mg / 100 ml100 ml ffs bottle , metronidazole tab 400 mg 10 x 10 , metronidazole oral suspension 200 mg / 5ml 60 ml bottle , norfloxacin tab 400 mg 10 x 10 , norfloxacin dispersible tablet 100 mg 10 x 10 , ofloxacin 200 mg 10 x 10 , ofloxacin 400mg 10 x 10 , piperacillin +tazobactam inj 4.5 gm / vial vial , primaquine tab 2.5 mg 10 x 10 , primaquine tab 15 mg 10 x 10 , primaquine tab 7.5 mg 10 x 10 , quinine inj 300 mg / ml 2 ml amp , quinine tab 300 mg 10 x 10 , sodium aminosalicylate granules 10 gm , sulfamethoxazole and trimethoprim tab800mg + 160mg 10 x 10 , sulfamethoxazole +trimethoprim tab200mg +40 mg 10 x 10 , sulfamethoxazole +trimethoprim oral liquid ( 200mg +40 mg ) / 5 ml 50 ml bottle , sulfamethoxazole+trimethoprim ( pediatric tablets ) tab 400 mg+80 mg 10 x 10 , tablet artemether ( a ) + lumefantrine ( b ) tablet 20 mg ( a ) + 120 mg ( b ) 1x6 tab , tablet artemether ( a ) + lumefantrine ( b ) oral liquid 80 mg ( a ) + 480 mg ( b ) / 5 ml , tablet artemether ( a ) + lumefantrine ( b ) tablet 80 mg ( a ) + 480 mg ( b ) , tablet penicillin v ( phenoxymethyl penicillin ) 250 mg , tinidazole tab 300 mg 10 x 10 , vancomycin powder for injection 1 g , vancomycin powder for injection 250 mg , vancomycin powder for injection 500 mg , flunarizine tablet 5 mg 10 x 10 , sumatriptan tablet 25 mg 10 x 10 , 5 fluro uracil 500 mg , bendamustine inj 100 mg , calcium leucovorin 50mg , capecitabine 500 mg , carboplatin 450 mg , cisplatin 50 mg , cyclophosphamide 500 mg , bleomycin inj 15 mg , docetaxel 120 mg , doxorubicin 50 mg , epirubicin 100 mg , bortezomib inj 2 mg , etoposide 100 mg , decarbazine inj 200 mg 10 mg / ml , erlotinib tab 150 mg , exemestine tab 25 mg , gemcitabine1.4 mg , fulvestrant inj 500 mg , imatinib mesylate 400 mg , gefitnib tab 250 mg , methotraxate 50 mg , oxaliplatin 100 mg , paclitaxel 260 mg , hydroxyurea cap 500 mg , ifosfamide inj 1 gm , tamoxifen 20 mg , irinotecan inj 100 mg , vincristin 1 mg , lenalidomide tab 25 mg , zoledronic acid 4 mg , letrozole tab 2.5mg , doxorubicin , pemetrexed inj 50 mg , pomalidomide cap 2 mg , rituximab inj 500 mg , sorafenib tab 200mg , sunitinib tab / capsule50 mg , temozolamide tab 250 mg , topotecan inj 4 mg , trastuzumab inj 440 mg , vinblastin inj 10 mg , vinorelbine inj 10 mg , trihexyphenidyl tab 2 mg 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 10 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 25 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 250 mg ( a ) + 25 mg ( b ) 10 x 10 , diltiazem injection 5 mg / ml , adenosine inj 3 mg / ml 2 ml amp , amiodarone inj 50 mg / ml 3 ml amp , amiodarone tab 100 mg 10 x 10 , amlodipine tab 5 mg 10 x 10 , amlodipine tab 10 mg 10 x 10 , atenolol 100 mg 10 x 10 , atenolol tab 50 mg 10 x 10 , atorvastatin tab 10 mg 10 x 10 , atorvastatin tablet 40 mg 10 x 10 , chlorthalidone 12.5mg , chlorthalidone 25mg , clopidogrel tab 75 mg 10 x 10 , digoxin tab 0.25 mg 10 x 10 , digoxintab 250 mg 10 x 10 , diltiazem sr tablet 90 mg 10 x 10 , diltiazem tablet 60 mgl tablet 60 mgl 10 x 10 , diltizem tab 30 mg 10 x 10 , dobutamine inj 50 mg / ml 5 ml amp , dopamine inj 40 mg / ml5 ml amp , enalapril maleate tab 10 mg 10 x 10 , esmololinjection 10 mg / ml , finofibratetablet160 mg 10 x 10 , finofibrate tablet 40 mg 10 x 10 , hydrochlorothiazid tablet 12.5 mg 10 x 10 , hydrochlorothiazid tablet 50 mg 10 x 10 , isosorbide 5 mononitrate tab 20 mg 10 x 10 , isosorbide dinitrate tab 5 mg 10 x 10 , labetalol tab 100 mg 10 x 10 , labetalol inj 20 mg / 4 ml 4 ml amp , labetalol injection 5 mg / ml , methyldopa tab 250 mg 10 x 10 , metoprolol sr tab 25 mg 10 x 10 , metoprolol sr / plain tab 50 mg 10 x 10 , nifedipine cap 5 mg 10 x 10 , nifedipine tab 10 mg 10 x 10 , nitroglycerine ( glyceryl tri nitrate ) sub lingual tab 0.5 mg 10 tab , nitroglycerine ( glyceryl tri nitrate ) inj 25 mg / 5 ml 5 ml amp , noradrenaline inj 2 mg base / 2 ml amp. 2 ml amp , propranololtab 10 mg 10 x 10 , protamineinjection 50 mg / 5 ml , ramipril tab 2.5 mg 10 x 10 , streptokinaseinjection 15 lac / vialvial , telmisartan tab 40 mg 10 x 10 , verapamil tab 40 mg 10 x 10 , verapamilinjection 5 mg / 2 ml , urokinase ( 5 laciu ) vial , gum paint ( tannic acid ) 2% w / v 15 ml bottle , gutta percha ( gp ) 30tab / bottel , light cure composite , ketorolac10 mg tablet 10 x 10 , povidine iodine germicide gargle 20% w / v , gamma benzene hexachloride , benzoyl peroxide gel 5% , betamethasoneinjection 4 mg / ml 1 ml amp , betamethasone dipropionate ointment 0.05% 15 gram tube , calamine lotion 50 ml bottle , framycetin sulphate 1% cream 30 gram tube , fusidic acid cream / ointment 2% 5 gram tube , glycerin oral liquid , miconazole cream 2% w / w 15 gram tube , mupirocin cream / ointment 2% 5 gram tube , permethrin permethrin lotion 5% w / v ( 60 gm bottle , salicylic acid , silver sulphadiazine cream usp 1% 25 gram tube , haemodialysis fluid , intraperitoneal dialysis solution , bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) containing not less than 30% w / w of available chlorine ( as per i.p ) 25 kg bag , cetrimide solution 20% ( concentrate for dilution ) , hydrogen peroxidesolution 6% , povidone iodine solution 5%, 100 ml bottle , povidone iodinevaginal pessary 200mg 10 x 10 , povidone iodine 5% ointment 15 gram tube , acetazolamide tab 250 mg 10 x 10 , furusemide tab 40 mg 10 x 10 , furusemide inj 10 mg / ml2 ml amp , hydrochlorothiazide tab 25 mg 10 x 10 , mannitol inj 20% 100 ml ffs bottle / 350 ml ffs bottle , mephentermine injection 30 ml vial mg / ml 10 ml vial , spironolactone tablet 25 mg 10 x 10 , xylometazoline nasal drops: adult ( 0.1% ) , boro spirit ear drops 0.183 gm boric acid in 2.08 ml of alcohol , normal saline nasal drops: sodium chloride drops 0.05% w / v , xylometazoline nasal drops 0.05 %, , turpentine oil 15% w / v 50ml bottel , wax solvent ear drops: benzocaine 2.7% w / v 10 ml bottel drop , wax solvent ear drops:paradichlorobenzene 2 % w / v 10 ml bottel , activated charcoal , hyoscine butylbromide 20mg / ml 1 ml vial / amp , tab mebeverine tab 200 mg 10 x 15 , bisacodyl tab 5mg10 x 10 , bisacodyl suppositories 5 mg 10 x 10 , dicyclomine hydrochloride inj 10 mg / ml 2 ml amp , dicyclomine hydrochloride tab 20 mg 10 x 10 , domperidone tab 10 mg 10 x 10 , domperidone 1mg per 1ml suspension , lactulose solution 10 gm / 15 ml , metoclopramide inj 5 mg / ml , metoclopramide tab 10 mg 10 x 10 , ondansetron tab 4 mg 10 x 10 , ondansetron inj 2 mg / ml 2 ml am , ondansetron syp 2mg / 5 ml 30 ml bottle , pantoprazole inj 40 mg / vial vial , rabeprazole tab 20 mg 10 x 10 , ranitidine tab 150 mg 10 x 10 , ranitidine inj 50 mg / 2 ml 2 ml amp , dicyclomine tablet 500 mg 10 x 10 , loperamide tablet 2 mg 10 x 10 , losartan 10 mg 10 x 10 , drotaverine inj 40 mg / 2 ml 2 ml amp , drotaverine tab 40 mg 10 x 10 , sucralfate syrup 1gm / 5ml 100ml bottle , sucralfatetablet 20 mg 10 x 10 , bicalutamidetablet 50 mg 10 x 10 , tamoxifen tablet 10 mg3 10 x 10 , ethinylestradioltablet 0.05 mg 10 x 10 , ethinylestradioltablet 0.01 mg 10 x 10 , empagliflozin 25 mg 10 x 10 , ethinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10 x 10 , glibenclamidetablet 5 mg 10 x 10 , human chorionic gonadotropininjection 10000 iu vial of 1 ml injection , human chorionic gonadotropin injection 5000 iu vial of 2 ml injection , levonorgestreltablet 0.75 mg 10 x 10 , medroxyprogesteronetablet 10 mg 10 x 10 , medroxyprogesterone acetate injection 150 mg 1 ml / vial , methylprednisoloneinjection 1000 mg / ml vial , methylprednisolone tablet 16 mg 10 x 10 , methylprednisolonetablet 16 mg 10 x 10 , methylprednisolonetablet 4 mg 10 x 10 , ormeloxifenetablet 30 mg 10 x 10 , premix insulin 30:70 injection ( regular: nph ) 2 , premix insulin30:70 injection 40 iu / ml , sitagliptin tab 50 mg 10 x 10 , thinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) with ferrous fumarate10 x 10 , metformin sr 1000mg 10x15 , pioglitazone 15mg , biphasic isophane insulin insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges , carbimazole , carboprost ( 15 methyl pgf2a ) inj 250mcg 1 ml amp , clomiphene citrate 50 mg tab 10 x 10 , gliclazide tab 80 mg 10 x 10 , glimeperide tab 1 mg 10 x 10 , glimeperide tab 2 mg 10 x 10 , glucose packet 75 mg for ogtt test glucose packet 75 mg for ogtt test packet , insulin soluble inj 40 iu / ml 10 ml vial , levothyroxine tab 50 mcg 100 tab per bottle , levothyroxine tab 100 mcg 100 tab per bottle , metformin tab 500 mg 10 x 10 , iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection , anti d immunoglobulin for iv / im use ( monoclonal ) inj 150mcg 1 ml vial , anti d immunoglobulin for iv / im use ( monoclonal ) inj polyvalent 10 ml ( lyophilized ) inj 300mcg pfs / vial , anti snake venom , antitetanus immunoglobulins inj 250 iu / vial vial , hepatitis b immunoglobulin 100 iu / vial vial , rabies immunoglobulin 300 iu / 2 ml2 ml vial , rabies vaccine ( cell culture ) id / im inj 2.5 iu / ml 1 ml vial , formoterol inhaled bronchodilator , levosulbutamol 100 mcg , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 15mg+1.25mg+50mg / 5m 100ml bottle , aminophylline inj 25 mg / ml 10 ml vial , bromhexine syp 4mg / 5ml 50 ml bottle , budesonide nebulising suspension containing budesonide 0.5 mg / 2 ml 2 ml amp , caffeine citrate inj 20 mg / ml 3 ml vial , deriphylline tablet sr 300 mg 10 x 10 , etophylline +theophylline tab 100 mg ( etophylline 77 + theophylline 23 ) mg 10 x 10 , etophylline +theophylline inj 220 mg / 2 ml ( 169.4+50.6 mg ) 2 ml amp , ipratropium inhalation ( mdi / dpi ) 20 mcg / dose ipratropium respirator solution for use in nebuliszer 250 mcg / ml , levosalbutamol 50mcg / dose , montelukastsyrup 60 ml bottle , montelukasttablet 5 mg 10 x 10 , salbutamol tab 4 mg 10 x 10 , salbutamol inhaler 100mcg / dose metered dose container , salbutamol syp 2mg / 5ml 60 ml bottle , syrup dextromethorphan syrup 10 mg / 5 ml 100 ml pack bottle , tiotropium inhalation ( dpi ) 18 mcg / dose , tiotropium inhalation ( dpi ) 9 mcg / dose , human albumin solution 5% bottel 250 ml , deferasirox tab 250mg 10 x 10 , dispersable tablet hydroxyurea 100 mg 10 x 10 , enoxaparin inj 40 mg equivalent to 4000 iu vial / pfs , erythropoietin injection 2000 iu / ml , erythropoietin injection 10000 iu / ml , ethamsylate tablet tab 250 mg 10 x 10 , heparin inj 1000 iu 5 ml vial , hydroxyureacapsule 500 mg 10 x 10 , inj. deferoxamine 500mg / vial vial , recombinant factor eight inhibitor bypassing activility ( feiba ) 500 units , recombinant factor ix 500iu , recombinant factor vii a 1 mg , recombinant factor viii 250iu , 500iu , tab. deferasirox tab 500 mg 30 tab , tab. deferiprone 500mg 10x10 , tranexamic acid inj 500 mg / 5 ml. , tranexamic acid tab 500mg 10x10 , warfarin tab 5 mg 10x10 , warfarin tablet 1 mg 10x10 , warfarin tablet 2 mg 10x10 , caffeine oral liquid 20 mg / ml , surfactant suspension inj 25 mg / ml 100 ml vial , donepezil tablet 5 mg 10 x 10 , water for injection , water for injection 5 ml amp 2 ml amp , disulfiram tablet 250 mg 10 x 10 , baclofen baclofen 40 mg tablet10 x 10 , duvadilan 10 mg10x50 , duvadilan inj 5mgvial , neostigmine inj 0.5 mg / ml 1 ml amp , vecuronium inj 2 mg / ml 2 ml amp , pilocarpine drops 4% 5 ml bottel , acyclovir ointment3% 5gm tube , atropine sulphate 1%, tube , 3 gm , carboxymethylcellulosedrops 0.5% 10 ml / vial , dexamethasone drop ( 0.1%, 5ml ) , eye drop 5ml eye drop , fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye drop10 ml eye drop , homatropinedrops 2% , lantanoprost 0.005% ( 5ml ) , eye drop 5ml eye drop , moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 5ml eye drop , pilocarpinedrops 2% 5 ml bottel , pilocarpine drops 1% 5 ml bottel , prednisolone drops 1% 10 ml bottel , tropicamide drops 1% 5 ml drop , atropine 1% eye ointment 3 gram tube , atropine 1% eye drops 5 ml vial , chloramphenicol eye ointment 0.5% 4g / 5g tube , ciprofloxacin eye / ear drop 0.3% 5 ml vial , ciprofloxacin eye ointment 0.3% 3 / 3.5 gram tube , combo ear drop chloramphenicol 5% w / v +clotrimazole 1% +lignocaine hydrochloride 2% 5 ml drop , gentamicin ear / ear drop ( 0.3% ) 5 ml vial , timolol 0.5% eye drops 5 ml vial , codeine oral solution 15 mg / 5 ml 60 ml bottle , morphineinjection 15 mg / ml vial , morphine tablet 10 mg 10 x 10 , morphine tablet sr / 30 mg 10 x 10 , oxytocin injection 5 iu / ml injection 5 iu / ml1 ml ampule , drotaverine inj 40 mg / 2 ml 2 ml amp , methyl ergometrine maleate inj 0.2 mg / ml 1 ml amp , misoprostal tab 200 mcg 4 tab in 1 pack , combi pack with mifepristone + misoprostol ( 1 tablet of mifepristone 200 mg and 4 tablets of misoprostol 200mcg ) combi pack , methyl ergometrine maleate tab 0.125 mg 10 x 10 , mifepristone tab 200 mg 1 tab per pack , misoprostal tablet 100mcg 4 tab pack , misoprostoltablet 200mcg ( oral / vaginal ) 4 tab pack , risperidone 50 mg , alprazolam tab 0.25 mg 10 x 10 , chlorpromazine tab 100 mg 10 x 10 , clonazepam tablet 0.5 mg 10 x 10 , clozapine tablet 50 mg 10 x 10 , clozapine tablet 25 mg 10 x 10 , diazepam inj 5 mg / ml 2 ml amp , diazepam tab 5 mg 10 x 10 , escitalopram tablet 10 mg 10 x 10 , fluoxetine capsule 20mg 10 x 10 , fluphenazineinjection 25mg 1ml vial / ampoules , haloperidol inj 5 mg / ml 1 ml amp , haloperidol tab 5 mg 10 x 10 , imipramine tablet 25 mg 10 x 10 , lithium carbonatetablet 300 mg 10 x 10 , lorazepam tab 1 mg 10 x 10 , lorazepam inj 2 mg / ml , olanzapinetablet 5 mg 10 x 10 , olanzapine 10 mg 10 x 10 , phenobarbitonetablet 60mg 10 x 10 , promethazine injection 50 mg ( 25mg / ml ) 2ml vial / ampoules , risperidone tab 2 mg 10 x 10 , zolpidem 10 mg 10 x 10 , calcium gluconate inj 10% 10 ml vial , d 10 ( dextrose 10% ) iv fluid ( dextrose 10% ) 500 ml ffs bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 100 ml bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 500 ml bottle , dextrose 5% iv fluid ( dextrose 5% ) 500 ml ffs bottle , dextrose with saline i / v fluid ( dextrose 5% + saline 0.9% ) 500 ml ffs bottle , glucose ( a ) + sodium chloride ( b ) injection 5% ( a ) + 0.9% ( b ) 500ml ffs bottle , hydroxyethyl ( 6% saline solution for infusion ) starch 6%ip , pediatric solution like isolyte p, n / 2 & n / 5 pediatric solution like isolyte p, n / 2 & n / 5 100 ml bottle , potassium chloride oral solution 100mg / ml 200 ml bottle , reduced osmolarity ors pkt. who formula o.r.s. glucose 75meq, sodium 75m eq or m mol / l, chloride 65meq or m mol / l, potassium 20meq or m mol / l , citrate 10m mol / l osmolarity 245m osm / l, dextrose 13.5g / l sodium chloride 2.6g / l potassium chloride 1.5g / l, trisodium citrate dihydrate 2.9g / l+trisodium citrate dihydrate may be replaced by sodium hydrogen carbonate ( sodium bi carbonate ) 2.5g / l. sachet of 21.8gm , ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , sodium bicarbonate inj 7.5% w / v 10 ml amp , sodium chloride hypotonic inj n / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 100 ml ffs bottle , nicotinamide tablet 50 mg7 10 x 10 , ascorbic acid ( vitamin c ) tablet 100 mg tablet 100 mg 10 x 10 , calcium carbonate .tab 500 mg 10 x 10 , calcium with vitamin d3 calcium equivalent to 500 mg & vit. d3 250 iu 10 x 10 , ferric carboxymaltose 250mg 10 x 10 , ferric carboxymaltose 50mg / ml 20 ml vial , folic acid tab 5mg 10 x 10 , iron & folic acid syp iron each 1 ml contains 20mg elemental iron+folic acid 100 ?g 50 ml bottle with dropper , iron & folic acid sugar coated iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets 10 x 10 , iron sucrose inj 100 mg / 5 ml 5 ml amp , multivitamin sugar coated tab nfi formula sugar coated vit a 2500 iu , vit c 50mg, calcium pantothenate 1mg, vit b1 2 mg vit b6 0.5 mg vit d3 200 iu vit b2 2mg niacinamide 25mg folic acid 0.2mg. 10 x 10 , pyridoxine tab 10 mg 10 x 10 , pyridoxine tablet 40 mg 10 x 10 , pyridoxine tablet 100 mg 10 x 10 , riboflavin tablet 5 mg7 10 x 10 , thiamine injection 100 mg / ml , thiamine tablet 100 mg7 10 x 10 , vitamin a syp 100000 iu / ml with marked spoon for 1ml &2ml 100 ml bottle , vitamin k1 inj 1 mg / 0.5 ml 0.5 ml amp , vitamin. b complex tab nfi ( prophylactic ) b1 2 mg, b2 2mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg 10 x 10 , zinc sulphate tab dispersible 10mg 10 x 10 , zinc sulphate tab dispersible 20mg 10 x 10 , vitamin b12 inj, injection 500 mcg / ml ( 30 ml amp / vial ) , glacial acetic acid 99.99% 500 ml , visco pfs 3 ml prefilled syringe opthalmic , disposable gown , diclofenac+menthol 30 gm tube , cap antioxident 10x10 , tab. paracetamole 325 mg+ chlorpheniramine 4 mg + phenylepherine 10 mg 10x10 , syp diphynhydramine 100 ml , multivitamin drops 22 drops approx , material name , alkaline phosphatase 10x 22ml erba comfitable make , anti h span / tulip comfitable make , anti a1 lactin , anti d ( 1gg+2gm ) tulip / span / j.mitra comfitable make , anti ab anti sera span / tulip 10 ml comfitable make , ahg span / tulip vial comfitable make , abg cartiadge , albumine kit erba comfitable make , acitic acid 5% , acetone kit , bloting paper , bacilol , baby msks size 0, 1 , blood administration set , barium sulphate powder, susp. 95%w / v, powder ( hd ) 95% w / v 400 gram. , benedicts soluton ( qualitative ) 500 ml bottle , blood groupingseara antia, b&d ( 10 ml ) j.mitra / span / tulip comfitable make , blood lancet , blood bag 100 ml j.mitra / haemopack, hll life care comfitable make , blood bag 350 ml j.mitra / haemopack, hll life care comfitable make , blood bag 150ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood bag 200ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood cell counter key based gem , barium chloriad powder , barium chloriad ( 500 ml ) , brain tromoblastin for , b.t.c & c.t tube , basik fucksion powder , bruck sitrick , cidex , csf protien kit , csf suger kit , calcim reagent , crp kit ( agapee ) j.mitra / span qualicative 50 test kit comfitable make , crp kit 50 test kit erba comfitable make , cpk mb kit erba comfitable make rapid kit , capillaries ( serumbilirubinometer ) , capillaries ( wax ) , capillary tube for bt&ct , cover shlip ( 40gm ) , calorie meter , cyanemeth solution for hb ( drabkins solution , carbol fuchsin , culture media with nutrient agar high media company comfitable make , culture media with maconkey agar high media company comfitable make , culture media with blood agar high media company comfitable make , culture media with peptone water high media copany comfitable make , culture media with nutrient broth high media company comfitable make , culture plate , chikunguniya , counting numbers ( chekers ) , detaction for protien in urine ( uristixs ) 100strip , disposable cups for urine collection with screw cap , distilled water 5 letter , digital anyalytical balane 0.1gm to 160 gm , dengue card test span / j.mitra comfitable make , dropper rubber , drop mct oil , d.p.x. wax qualigence , esr tube , elisa plate reader with washer and printer , edta250 gm powder , e.d.t.a powder 500 gm , edta vial with screw cap , edta solution , electrolyte analyser reagents pack na+, k+ accurex enlite 2 para , electrolyte analyser reagents deproteinize , electrolyte analyser reagents riffil solution forna+, k+ and reffrence electrode , thermal paper roll for cell counter machine , electronic chemical weings scale , emmersion oil30ml , formaldehyde ( formalin ) 37% acq. 450 ml bottle , fliltter paper , field stain a qualigens , field stain b qualigens , forchest reagents 125 ml bottel , flask , flask , falckon tubecultre sterlized , glucose kit ( godpod ) , glutaraldehyde lotion 2% w / v stabilized 5 ltr. cans , glass droper , glass test tubes borosil glass 18 x 150 mm , glass piaptte , glass beaker 100 ml , glass beaker 200 ml , glass marking pencil ( white ) , glucometer sd company comfitable make , haemoglobin colour scale , heamocyto meter , glucometer stripsmorphan` comfitable make , glucometer strips acuchaklcomfitable make , glucometer stripssd company code free ivd , hydrogen peroxide sol. 20% w / v 1 ltr. bottle , h2so4 acid 20% , hb pipate , hb tube , hbsag card test rapiedj.mitra / span comfitable make , hdl chloleslestrol kit , h.c.v card rapid span / ing comfitable make , hdl kit erba comfitable make , hiv kit , hiv test card tridot flow through paste 3 dot span / j.mitra comfitable make , hematolgy cell counter reagents erma company pce 210 autodil er comfitable make , hematolgy cell counter reagents erma company pce 210 autolyse er comfitable make , hematolgy cell counter reagents erma company pce 210 autoclean er comfitable make , haemoglobin meter isi marked superior quality , hand sanitizer sterilium , incubator superior quality isi marked microbiology , listaman stain ( 500ml ) qualicative , laugles ioden , led bulb , lance paper , liquid hand wash , micropore , micro glass slide packet 50 slide packet , mp antigen test card for view for falciferum ozon / span / j.mitra comfitable make , malaria card test antibody j.mitra / span comfitable make , methylene blue , mithylated sprit100% , micropippate tips large , micropippate tips small , micropippate for analyzer erba company variable 5 50 comfitable make , micropippate for analyzer erba company variable 10 100 comfitable make , micropippate for analyzer erba company varialbe100 1000 comfitable make , micropippate for analyzer erba company varialbe 2micrlit. 1000 microlit comfitable make , multichanel pippate , n / 10 hcl , nitric acid 500 ml , new warce chamber , platilate diluting fluid , pt reagents span comfitable make , aptt reagents spancomfitable make , pandys reagent for csf , preganacy test strip 100strip , pasture piaptte ( borosil ) comfitable make , piaptte glass , phenol crystol , peatidisc large disposable , peatidisc small disposable , plain vial 12 x 75 with screw cap , permanentmarkers , pollythin 30 lit capacity , rapid pap kit span , rapid test kit for torch tes ( 1gm+1gg ) , r.b.c dilluting fluid ( 500 ml ) , r.a.factor 50 test kit qualicative j.mitra / span comfitable make , serum bluribine 4 x60 ml erbacomfitable make , serum bovine albumine 22% bsb span / tulip comfitable make , sodium citrate 3.8 % , sodium hypochlorid 5 lit jar , sulphuric acid ( 450 ml ) , serum tringlyieride ( 5x20ml ) , serum creatinine kit erba company 4 x60 ml comfitable make , serum protien kit erba comfitable make , staning rack , slide markers , slide stand , slide box 50 soidde , spirit lamp , sulpher powder , sulfuric acid 100% , semun diluting fluid , stop watch digtal , sypllis test card jaimitra / spam / biolab comfitable make , sputam cuntnar disposable , stickers ( blank ) 2x1 cm , twinket balt , taste tubeglass ( borosil ) 7.5x 12mm15 ml comfitable make , taste tubeglass ( borosil ) 7.5x 12mm5 ml comfitable make , tissue puper , teat rubber 1 ml , teat rubber 2 ml , teat rubber 5 ml , typhoid card test kitj.mitra / span comfitable make , torch test kit j.mitra / span comfitable make , t3, t4 tsh kit , test tube stand 10 holl , test tube stand 20 holl , thermocol box with packd , thermometer for water wath , triglyceride kit erba comfitable make , vdrl kit for sypllis comfitable make , vdrl kit j / mitra / span 50 test kit qualicative comfitable make , water wath , w.b.c dilluting fluid ( 500 ml ) , wbc diluting fluid 100ml , wintrob tube stand , xylene qualigens , zentition viloet 0.25% , zentition viloet 0.5% , zn stain , feeding tube for infant no. 6 , oxygen mask child , oxygen mask adult , cord clamp dispossable , plastic tubs , reagents for semi auto anyalyzer erba company , blood glucose kit erba company 50 test kit comfitable make , blood urea kit erba company 50 test kit comfitable make , sgpt test kit erba company 50 test kit comfitable make , sgot test kit erba company 50 test kit comfitable make , g6pd test kit erba company 50 test kit comfitable make , blood grouping sera 5 ml anti ab&d set j.mitra / span / tulip comfitable make , widal test kit erba company 50 test kit comfitable make , vdrl test kit erba company 50 test kit comfitable make , cholestrol kit erba company 50 test kit comfitable make , austrailia antigen card test , rpr kit for syplis 50 kit , lead protection partion , lead letters , lead protective barrir , lead goggle , lead protectvie apprean , lead rubber glove , lead gonad shield , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , xray castetes kiran, kr8 , xray castetes , xray castetes , xray castetes , xray hangers , xray hangers , xray hangers , xray hangers , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray dental film 50 sheet packet , x ray developerpowder , x ray developerpowder , x ray fixerpowder , x ray fixerpowder , x ray view box , xray safe light , absorbent cotton wool ip 500 gm paket , absorbable gelatine sponge ip 66 80mm x 50mm x 10 mm , adhesive plaster usp 7.5 cm x10mts / roll , adhesive plaster usp 7.5 cm x5 mts roll , bismith lodoform paraffin paste , boric acid with sprit drop , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 / 0 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 2 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no1 / 0 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 2 , b.b silk with 3 / 8 cir rb reverse 2 / 0 cutting needle 45 mm length 76cm , b.b silk6 reels x 25 mts length 25 mts , cotton roll100 gm , cresol with soap sol. 5 ltr. cans , chromie with cd. rb needle 40 mm length 75cm , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 0 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 0 , crap bandageall sizes , poly propylene with 1 / 2 cir rb needle 30 mm length 70 cm , poly propylene with 1 / 2 cir rb needle 40 mm length 70 cm , poly propylene with 1 / 2 cir rb heavy needle 30 mm length 70 cm , poly propylene with cutting needle 45 mm lengyh 100 cm , poly propylene with curved 8 / 0 rb bv double needle 7.6 mm length 60 cm , disposable syringe with needle cgs 1cc with mark 0 1ml , disposable syringe with needle cgs 2cc , disposable syringe with needle cgs 5cc , disposable syringe with needle cgs 10cc , disposable syringe with needle cgs 20cc , disposable syringe with needle cgs 50cc , disposable suction cather size: 12, 14 , disposable scale vein set size 20g , disposable scale vein set size 22g , disposable needle 18 g ( single use ) , disposable needle 20 g ( single use ) , disposable needle 22 g ( single use ) , disposable needle 23g ( single use ) , ecg gel 250 ml bottle , ecg paper80mm x 20mts for manual ecg machine bpl company 6208 view / view plus chemical red comfitable make , ecg paper 50mm x 20 mts computerzed for computer bpl company 6108tchemical blue comfitable make , endotracheal tube no 2.5 , endotracheal tube no 3 , endotracheal tube no 3.5 , endotracheal tube no 5 , endotracheal tube no 7 , endotracheal tube no 8 , foleys urinaty catheter size 8 ( 2way ) , foleys urinaty catheter size 10 ( 2way ) , foleys urinaty catheter size 14 ( 2way ) , foleys urinaty catheter size 16 ( 2way ) , foleys urinaty catheter size 18 ( 2way ) , foley balloon cather three way ( a ) fg 24 , glycerinc ip 30 ml plasric bottle , gention violet paint 0.5% 100ml bottle , hmf sachet , iv cannula ( two way ) size 18 , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula ( two way ) size 26 , i.v. cannula sizes 23 two way , intravenous set ( adult ) with airway and needle , intravenous set ( children ) with airway and needle , infant mucus extractor , infant feeding tube ( catheter ) 8 g , infant feeding tube ( catheter ) 10 g , infant feeding tube no. 3.5 , infant feeding tube no. 7 , liquid paraffin ip 500 ml bottle , liqued stesimox , lysol , mackintosh double colour water proof , micro drip set , metrasses 3×6 with raxine cover 4 density , metrasses 2 5×4 with raxine cover 4 density for child bed , needle hypodermic insulin needle ( metallic non sterile ) size 26 gx1 / 2 , nasal prom for neonatiol , n 95 mask for swine flue , disposable mask , l.p. needle no. 22 , l.p. needle no. 23 , oxygen catheter , oxyzen flowmeter regulator , oxygen tube , plaster of paries 1kg pkt.isi qulity , paper adhesive plaster 1x9.0 mts , p.o.p. bandag 6 inch , p.o.p. bandag 4 inch , peadiartic chamber set 110 ml , pressure monitoring line , pvc apron , ryles tube ( p.v.s ) childrn size 10, 12 , ryles tube ( p.v.s ) adult size 16, 18, 14 , sanitary pads , slippers all sizes , sterile gloves size 6 isi marked , sterile gloves size 6 1 / 2 isi marked , sterile gloves size 7 isi marked , sterile gloves size 7 1 / 2 isi marked , surgical blade size 11, 100 blade per packet , surgical blade size 15, 100 blade per packet , surgical blade size 21, 100 blade per packet , surgical blade size 22, 100 blade per packet , surgical blade size 23, 100 blade per packet , suture needles curved &1 / 2 circle cutting assorted sizes 1 5 , suture needles curved &1 / 2 circle cutting assorted sizes 6 10 , suture needles curved &1 / 2 circle cutting assorted sizes 11 15 , suture 10 0 nylone , suture 8 0 silk , suture 5 0 mono phalment , suction catheter no.7 green , suction catheter no.8 green , suction catheter no.16 green , suction catheter no.14 green , scalp vein set ( single use diposable ) size 23 gauge , scalp vein set ( single use diposable ) size 24 gauge , spoon marked 1 ml / 2 ml plastic , surgical spirit 100 ml bottle , sterlium hand wash , three way connector , tincture benzoin co. 500 ml bottle , ultra sonogram gel 250 ml bottle , urinary drainage bag , volium drip set , vicryl no.1 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.1 0 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.2 polyglyoviont 1 / 2 cir needle 95 cm , wax dissoluent , pamper for children , oxygen key , tab. chlorine 500 mg isi marked , tab. water purifying 4 gm , montex test 2 tu , montex test 5 tu , 1 twv csx ¼ftlessa vanj dh vksj ls , e vks , p , qq mcy;w@, q ih ds yksxks yxk, tk, xsaa½ 2 iseiysv nis gq, ¼lwpuk i= uofookfgr naifr ds fy, tkudkjh ½ 3 lksan;z lkexzh@ lopnrk csx ¼ deiyhv csx fueu lkexzh dk uke& rksfy;k lsv nksvk ] da?khfcanhirrk ] usy dvj ] nks lsv :eky ] lsusvjh usifdu isdsv vksj khkk nksvk ½ lfgr 4 tkudkjh dkmz nik gqvk ftlesa { ks=h; vkkk rfkk , , u , e dh laidz dh tkudkjh 5 lwpuk i= ¼xhkz izjh { k.k fdv ds mi;ksx laca / kh funszk ij iw.kz lwpuk i=½ , d.mkse ckwdl ¼fvu½ , d.mkse ckwdl ¼qkbzcj½ , d.mkse ckwdl ¼ydm+h½ , osusvh ckwdl ¼fvu ½ , lsusvªjh usifdu isdsv 10 ihl , lsusvªjh usifdu isdsv 12 ihl , vkbzmsauvh fqdsku vsx qkwj u;w cksuz , vkbzmsauvh fqdsku vsx qkwj enj , digital wrist watch , digital thermometer , neonatal / infant weighing scale with sling , warm sleepig bag for neonates , blankets for neonates , mucus extractr , baby feeding spoon , torch with cells , bag for carrying kit / material during home visit , heamocheck book with strip complete , hemax cell cleaner 1 litre , hemax diluent 20 litre , hemax lyse 500ml , amber colored bottle 2 lit. , amber colored bottle 3 li. , ethanol absolute alcohol 500 ml , hcl 500 ml , diamond marker , tissue paper , auramine powder 25 gm , lense paper , thermacol box , sputum container , micro glass slide , forcep steel , weighing machine digital , water bath , paraffin role , spirit rectified 1 lit. , slide box 100 slide per box , glass beaker 200 ml , glass beaker 100 ml , permanent marker , slide rack , n / 95 mask , long stool lab , vinelands social maturity scale ( indian adaptalaion ) with manual , 16 pf questionnaire of age 16 and older with sheets with manual , binef kamath test of intelligence with manual , thematic apperception test ( indian adaption ) with manual , rorhchacs ink blot test cauds with location charts , nimhans neuro psychological battery for adult with manuals , nimhans index of sld with manuals , crescent blade , keraton ( 3.2 ) , disposable gown , vergin silk 8.0 black ( 1x12 ) , vergin silk 10.0 black ( 1x12 ) , vicryl 8.0 ( 1x12 ) , dark glass , cornear scissor , capsulereris forceps , scissor plain 4 inch , surgical blade 11 no. , side port , air cannula 27 g , fine port irrigaling vetis wire , banass scissor , trypan blue solution , propaciane hcl opthalmic solution , tropicaciyl plus eye drop , inj hyaluronidase ip 1500 iv , inj senscerocaine 0.5 1% , weight machine adult , scissor plain , artery forcep , tooth forcep , needle holder , oxygen flowmeter , cheatle forcep , sponge holdig forcep , bleaching powder 1 kg , stethoscope , labour ot fogging machine , ambu bag , cervical collar high neck , head mobilizer , fire extinguisherco2 2 kg , yoga mate , airotor hand piece , ultrasonic scaler , forcep ( set of 10 pieces ) , periosteal elevator , mouth mirror , sickle porpe , alginate , k file no. 10, 20 , 15, 25 , h file no. 15, 20, 25, 10 , formalin chamber , uv chamber , compressor , fracture plate , putty impression , zoe impression paste , upper & lower impression paste , abx diluent 20 lit can { horiba } , abx diluent 1 lit can { horiba } , white diff 1 lit { horiba } , abx minocleaner 100 ml { horiba } , printer ink modal h.p. tank4 bottel 3019 , t3 icromax , t4 icromax , tsh iromax , blood sugar erba , serum billirbin erba , blood uria erba , sgpt erba , sgot erba , uric acid erba , alkaline phosphate erba , total protin erba , hdl erba , total cholestrol erba , albumin erba , triglistride erba , diluent 20 lit hemax , :yse 500 ml hemax , cell cleaner e.z. 1 lit hemax , cleaner 100 ml hemax , printer |roll size 55 mm , printer roll size 50 mm , vtm kit 50 test / kit , standard q covid test card 25 test card / kit , face shield , ice gel pack 8x10 cm , brown tape 6 inch , zipper polythene 8x10 cm , polythene 1 kg red / black , sanitizer 100 ml , sanitizer 500 ml , shoe cover , disposable bed sheet , dead body suit , thermal scanner , pulse oxymeter , ppe kit , surgeon cap , disposable kelleys pad , latex examination gloves large 100 gloves / pkt , goggles , microglass slide blue star 50 slide / pkt , sanitiry napkin 8 pad / pkt , cough syrup sugar free 100 ml , tab vitamin c 500 mg sugar free , ct scan film 8x10 konica minolita , ct scan film 14x17 konica minolita , ct scan film 11x14konica minolita , shaving blade , ct scan film 10x12konica minolita...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Indian Army - Madhya Pradesh

33210710 bids are invited for haemocult test occult blood test kit of 50 tests , abst octa disc ready made gnb and gpc , acetone commercial , alcohol amyl , alcohol dehydrated ethanol , biomerieux reflectance standards bact alert complete set , blood agar base , cled agar , d p x mounting med , diamond glass writing 240 per 240 , formalin 05 ltr can , kit for pas ready to use , mgg stain kit may grunwald giemsa , paraffin liquid 500ml , parrafin tissue block moulds metal steel , perls iron stain kit , cover slip microscopic rectangular 22x50 mm , uti agar , xylene xylol pure , zn stain kit readymade , eightcheck 3wp set of three controls low normal high compatible with sysmex xp 100 , leishmans stain ready to use with buffer for bone marrow study 500ml , mpo stain kit , pt prothrombin time reagent vial of 25 tests , water culture agar double strengh , reticulocyte stain kit readymade j k diagnostics , anti h lactin ,ependorf tubes 1000ul , ependorf tubes 500ul , erba normand erba path internal qc combipack , erba wash kit 4 x50 ml , glucose powder 500gm , kit for estimation ofamylase 6 x 6 ml , kit for estimation of ck mb 2x8 ml 2x2 ml, kit for estimation of cpk 2x8 ml 2x2 ml , kit for estimationof ldh 4x8 ml 1x8 ml , kit for estimation of lipase 1x20 ml ,kit for ldl cholesterol by direct estimation 2 x 50 ml ,protein csf kit 1 x 50 ml micro protein , tube test 125 mm x16 mm rimless , tube test 75 mm x 12 mm rimless , himedia biochemical test kit kb002 20 kit per pack , ehrlichhaematoxylin stain , e check calibrator for sysmex xp 100 ,lypholized assayed control biorad l 1 , lypholizedassayed control biorad l 2 , blood agar base infusion agar, garber glass tube with cork , d dimmer estimation test kitpack size 1 x 7 ml 1 x 4 ml total quantity : 4417...

Indian Army - Madhya Pradesh

32792469 bids are invited for haemocult test occult blood test kit of 50 tests , abst octa disc ready made gnb and gpc , acetone commercial , alcohol amyl , alcohol dehydrated ethanol , biomerieux reflectance standards bact alert complete set , blood agar base , cled agar , d p x mounting med , diamond glass writing 240 per 240 , formalin 05 ltr can , kit for pas ready to use , mgg stain kit may grunwald giemsa , paraffin liquid 500ml , parrafin tissue block moulds metal steel , perls iron stain kit , cover slip microscopic rectangular 22x50 mm , uti agar , xylene xylol pure , zn stain kit readymade , eightcheck 3wp set of three controls low normal high compatible with sysmex xp 100 , leishmans stain ready to use with buffer for bone marrow study 500ml , mpo stain kit , pt prothrombin time reagent vial of 25 tests , water culture agar double strengh , reticulocyte stain kit readymade j k diagnostics , anti h lactin ,ependorf tubes 1000ul , ependorf tubes 500ul , erba normand erba path internal qc combipack , erba wash kit 4 x50 ml , glucose powder 500gm , kit for estimation ofamylase 6 x 6 ml , kit for estimation of ck mb 2x8 ml 2x2 ml, kit for estimation of cpk 2x8 ml 2x2 ml , kit for estimationof ldh 4x8 ml 1x8 ml , kit for estimation of lipase 1x20 ml ,kit for ldl cholesterol by direct estimation 2 x 50 ml ,protein csf kit 1 x 50 ml micro protein , tube test 125 mm x16 mm rimless , tube test 75 mm x 12 mm rimless , himedia biochemical test kit kb002 20 kit per pack , ehrlichhaematoxylin stain , e check calibrator for sysmex xp 100 ,lypholized assayed control biorad l 1 , lypholizedassayed control biorad l 2 , blood agar base infusion agar, garber glass tube with cork , d dimmer estimation test kitpack size 1 x 7 ml 1 x 4 ml total quantity : 4417...

Central Council For Research In Ayurvedic Sciences - Madhya Pradesh

32670762 bids are invited for alanine amino transferase , aspartate amino transferase , alkaline phosphatase , albumin , blood urea nitrogen , calcium , chloride , creatinine , glucose , gamma glutamyl transferase , phosphorus , potassium , sodium , total plasma protein , total cholesterol , triglycerides , total bilirubin , rodent thyroid stimulating hormone , rodent thyroxin , rodent triiodothyronine , dekaphan laura urine strips , prothrombin time , activated partial thromboplastin time , micro pipette tips , glass slides , cover slips , btct capillary tubes , nitrile gloves small , nitrile gloves medium , nitrile gloves large , micro centrifuge tubes 0.5 , microcentrifuge tubes 1.5 , micro centrifuge tubes 2 , oralgavage set , magnetic stirrer beads small , magnetic stirrerbeads medium , microtome blades slee , blotting papers ,bottle corks , diethyl ether , potassium iodide , isoflurane ,propanol , ethanol , xylene , hematoxylin stain solution ,eosin stain solution , paraffin wax , formaldehyde ,propylene glycol , sodium chloride , sodium dihydrogenphosphate , dihydrogen sodium phosphate , gum acacia ,giemsa stain solution , cell clean cl 50 , disodium edta total quantity : 53051...

Indian Army - Madhya Pradesh

32400812 price agreement for art disposable items price agreement for art disposable items , marker pens for labling ivf plates (non xylene) (human ivf grade) dual point set of 8 pens ( each pens separate colour) red, blue, black, green, purple, yellow, orange, brown (8 pen set) , powder free gloves surgical (sterile), (pair of ) size 7.5 (conforming to bis standards is 13422;1992) , powder free gloves surgical (sterile), (pair of ) size 6.5 (conforming to bis standards is 13422;1992) , powder free gloves surgical (sterile), (pair of ) size 8.0 (conforming to bis standards is 13422;1992) , powder free gloves surgical (sterile), (pair of ) size 6.0 (conforming to bis standards is 13422;1992) , vitrifit embrio loading device pack of 20 , 5 ml tube poly round bottom tubes individually sterile packed (human ivf grade) pack of 500 , denudation pipette (plastic) 300 microns (human ivf grade) individually sterile packed vial of 10/20 pippette , denuding pipette(170 175)microns (ivf grade) vial of 10 , 3 ml pipette sterile individually packed (human ivf grade) pack of 500 , 10 ml serological pipette sterile individually packed (ivf grade) pack of 500 , embryo transfer catheter soft with outer guide catheter having bulbous atraumatic tip inner soft catheter with steel reinforced proximal shaft (individually packed), length of inner catheter 190 mm , 1 ml rubber free tuberculin syringes for ivf embryo transfer (human ivf grade) , disposable tips (10 to 100 ul) individually sterile packed (human ivf grade) , disposable tips (1 to 10 ul) individually sterile packed (human ivf grade) , sperm preparation media for iui htf mea tested ce/usfda certificate approved , iui media double density (80%+40% ) usfda approved , 9x9disinfection wipes for cleaning bench top (mea tested) box of 70 , disinfectant spray (non embryo toxic) of 1 litre (human ivf grade) , 1.8 ml cryo tube vial ( pack of 500 ) , ivf multidish 4/5 well plate(human ivf grade) pack of 120 , semen collection jar sterile individually packed (110 ml) (human ivf grade) pack of 100 , icsi dish for ivf (human ivf grade) ( pack of 500) , 14 ml tube poly round bottom tubes individually packed sterile packed for ivf (human ivf grade) pack of 500 , iui catheter individually sterile packed with syringe pack of 100 , single well organ culture dish (human ivf grade) individualy packed pack of 500 , 15 ml conical tubes plsterene (ivf grade;mea tested pack of 500 , transducer probe cover individually sterile packed mea tested ce/usfda certificate approved (70 mm) , shepard intrauterine insemination set 5.4 fr/20 cm , ovum aspiration needle single lumen (k iops) 20 g,35 cm , disposable lithotomy drape (conforming to bis certificate) , denuding pipette(134 145)microns plastic (human ivf grade) individually sterile pack of 10 , ultra pure gas in line filters for co2 incubators (human ivf grade) , 35mmx10 mm ivf plates (human ivf grade) pack of 500 , aluminium cryo canes , embryo grade water for co2 incubator (human ivf grade) 2000 ml bottle , 60mm x 15 mm ivf plates (human ivf grade) individually sterile packed pack of 500 , fully metallic embryo transfer catheter for difficult transfer (human ivf grade ) with 10 compatible et catheter , 100% ethanol , kim wipes disposables wipes ( l x w 4.5 inch x 8.5 inch) , disposable tips (100 to 1000 micron) individually sterile packed (human ivf grade) , 7 x detergent (ivf lab cleaning solution 5 litres) , opu needle 17g needle lengh 35cm tubing length 90 100cm , sticky mats for lab (human ivf grade) (pack of 30 sheet/mat) , icsi injecting for ivf and icsi holding needle for ivf 35 degree angle pack of 10 , powder free gloves latex, gamma irridiated, size 7 , ivf grade disinfectant and laminar flow hoods , picsi dish pack of 20 , disposable tips (ivf grade ) individually packed , humidification flask for trigas incubatore , vitrifit embrio loading device pack of 20...

Rani Durgavati Vishwavidyalaya Jabalpur - Madhya Pradesh

32176703 bids are invited for nitroaniline , oxalic acid , p aminoacetanilide , pepsin ,peptone , petroleum ether 40 60 , phenol , phenolphthalein ,phthalic acid , picric acid , polyvinyl alcohol , polyethyleneglycol , polymethyl methacrylate , polypropylene glycol ,polystrene , potassium thiocyanate , pyridine , resorcinol ,saccharin sodium , salicylic acid , serine , starch , succinicacid , sucrose , sulphuric acid , tannic acid , tetrabutylperchlorate , thiosemicarbazide , thio urea ,triphenylphosphine , xylene , ammonium sulphate ,ammonium ferric sulphate , beef extract powder , benedictreagent , benzil , citric acid , cetyl alcohol , calamine ,gum tragacanth , hydrazine sulphate , indigo carmine , ironsulphate , lead acetate , lactose , magnesium sulphate ,magnesium sulphate monohydrate , magnesium carbonate ,potassium phosphate , potassium chloride , potassiumhydroxide , sodium sulphate , sodium oxalate , sodiumcarbonate , silica gel , sodium hydrogen orthophosphate ,sodium thioglyconate , tin chloride , tetra methylthioureadisulphide , zinc oxide , 4 amino phenol , acacia , anthrone total quantity : 130...

Directorate Of Medical Education - Madhya Pradesh

32061822 tender for purchase of chemical and reagent for mdru dep tender for purchase of chemical and reagent for mdru dep , supply of chemicals and reagents for mdru , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 5 od , r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 5 od , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , tips i. 0.2 20 ?l tips pack size of 1000 each , tips ii. 20 200 ?l tips pack size of 1000 each , tips iii. 200 1000 ?l tips pack size of 1000 each , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tips , filter tips pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tips , filter tips pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tips , mct variable tubes , i. 20 200?l tubes pack size of 1000 psc. , ii. 200 600 ?l tubes each , iii. 500 2000 ?l tubes , nitrile autodextorous gloves pack size of 1000 psc. , mctstands for variable tubes sizes pack size of 1000 psc. each , i. 20 200?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , ii. 200 600 ?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , iii. 500 2000 ?l tubes stand , filter tip boxes pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000ml 05each , graduated beakers50, 100, 500, 1000ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , total rna mini kit ( human skin tissue ) pack size for 100 reaction , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , chloroform 500 ml , phenol 500 ml , isoamyl alcohol 500 ml , hno3 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , cholin cleaner 500 ml , sterilium 500 ml , hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , brown paper for autoclaving 10 rolls , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side 1 psc. each , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen 5ltrpkt. , liquid nitrogen sample handling gloves 5 sets of gloves , phosphate buffer saline 500 ml , formalin 500 ml , slide tray / rack pack of 2 psc. , paraffin wax ( 58 60c ) 250 gm , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 2 psc. , whatman filter paper grade 1 & 2 pack size of 50 psc. , harri’s hematoxylin powder 50 gm , yellow eosin powder 50 gm , coverslip 18x18 ( microscopic ) 100 psc. , dpx mount 50 ml , xylene 250 ml , glycerol 100 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , ammonia 250 ml , hot plate 1 psc. , methanol 250 ml. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , acrylamide / bis ar 500 gm , 10x tbe buffer 100 ml , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100ug , human pai 1 elisa kit pack size of 96 reactions , diethyl pyrocorbonate 5 ml , pbs 500ml , mortar and pestle homogenizers...

Government Medical College - Madhya Pradesh

31823117 supply of chemical, reagents and consumables 2 2, 4 dnph 3 2, 6 dichloro phenol 4 4, amino antipyrine 5 acetic anhydriye 6 acetone 7 agar 8 agarose 9 alpha keto glutaric acid 10 alpha naphthol 11 amino acids 12 ammonia 13 ammonium molybdate 14 ammonium oxalate 15 ammonium persulphate 16 ammonium sulphate powder 17 amonical silver nitrate 18 anitmonic trichloride 19 arabinose 20 arsenic acid 21 barium chloride 22 benzidine powder 23 beta mercepto ethanol 24 bile pigments 25 bis acrylamide 26 blue litmus paper 27 bromophenol blue 28 butanol 29 calcium chloride 30 casein 31 ccl4 32 charcoal 33 cholesterol crystals 34 citric acid 35 concentrated h2so4 36 concentrated hno3 37 concentrated hcl 38 coomassie brilliant blue r 250 stain 39 copper sulphate 40 creatinine pure 41 cupric acetate 42 dextrin powder 43 di sodium phenyl phosphate 44 diacetyl monoaxime 45 diethyl pyrocarbonate 46 disodium monohydrogen ortho phosphate 47 dithiothreitol 48 dl alanine 49 dl aspartic acid 50 edta 51 eosin 52 ether 53 ethyl alcohol 54 ferric chloride 55 filter papers 56 filter papers whatmans no. 1 sheets 57 fluroglucinol powder 58 formaldehyde 59 formic acid 60 fructose powder 61 galactose powder 62 gelatin 63 glacial acetic acid 64 globulin 65 glucose powder 66 glycerol 67 hydrogen peroxide 68 hydroxy quinoline 69 iodine crystals 70 isopropanol 71 k2hpo4 72 keratin 73 kh2po4 74 lactic acid 75 lactose powder 76 lead acetate 77 lead oxide 78 liquid bromine 79 lithium chloride 80 low retention auto pipette tips 81 magnesium chloride 82 magnesium oxide 83 magnesium sulphate 84 maltose powder 85 mercuric chloride 86 mercuric sulphate 87 methanol absolute 88 methyl red 89 methylene blue 90 molybdic acid 91 monosodium dihydrogen phosphate 92 ninhydrin 93 nitrocellulose membranes 94 orcinol 95 orthophosphoric acid 96 paradimethylamino benzaldehyde 97 pasture pipettes 98 peptone powder 99 perchloric acid 100 ph papers range 2 14 101 phenol 102 phenolphthelin indicator 103 phenyl hydrazine hydrochloride 104 phenyl mercuric acetate 105 phenyl phosphate 106 phloroglucinol 107 phosphomolybdic acid 108 picric acid 109 potassium chloride 110 potassium ferricyanide 111 potassium ferrocyanide 112 potassium hydroxide 113 potassium iodide 114 potassium oxalate 115 potassium permanganate 116 potassium sodium tartarate 117 protein molecular weight markers 118 pvdf membranes 119 red litmus paper 120 resorcinol 121 silver nitrate 122 sodium acetate powder 123 sodium benzoate 124 sodium bicarbonate 125 sodium carbonate 126 sodium chloride 127 sodium citrate 128 sodium dithionite 129 sodium dodisyl sulphate ( sds ) 130 sodium hydroxide 131 sodium hypobromide 132 sodium hypochromate 133 sodium nitrite 134 sodium nitropruside crystals 135 sodium pyruvate 136 sodium sulphite 137 sodium tungstate 138 sprit lamps stainless steel 139 starch powder 140 sucrose powder 141 sudan black 142 sulphanilic acid 143 sulphosalysilic acid 144 sulphur powder 145 tannic acid 146 temed 147 thiosemicarbazide 148 thymol blue indicator 149 toffers indicator 150 trichloro acetic acid 151 tricine 152 tris base 153 urea 154 urease powder 155 uric acid crystals 156 vaniline 157 vitamin a 158 vitamin c 159 zinc chloride 160 zinc sulphate 161 bovine serum albumin 162 di sodium edta 163 ethidium bromide 164 xylene cyanol 165 potassium dichromate 166 twin 20 167 coomassie brilliant blue g 250 168 sodium deoxy cholate 169 glycine 170 amido black 171 6 amino hexanoic acid 172 ponceau s 173 fast green fcf 174 guanidine chlorid 175 ethidium bromide 176 bromophenol blue 177 methylene blue 178 bromocresol green s 179 lithium carbonate 180 bacteriological peptone 181 beef extract 182 yeast extract 183 malt extract 184 nutrient agar 185 blood agar base 186 cystine lactose electrolyte deficient agar 187 macconkey agar 188 agar agar 189 robertson cooked meat broth 190 bile salt agar 191 thiosulphate citrate bile salt sucrose 192 2.92 bile aesculin agar 193 brain heart infusion broth 194 2.94 mueller hinton agar 195 pikes media ( h. inf. ) 196 plet media ( b. anthracis ) 197 pnf medium ( s. pyogenes ) 198 lj medium 199 sda 200 bile salt agar 201 ss agar 202 sorbotolmacconkey agar ( ehec ) 203 tetrathionate broth 204 selenite f broth 205 stuart transport medium 206 thayer martin medium 207 triple sugar iron agar 208 sim medium 209 simmon’s citrate agar 210 christensen urea agar 211 dca 212 pre reduced anaerobically sterilized media 213 mannitol salt agar 214 xld agar 215 wilson blair brilliant green bismuth sulphite agar 216 hoyle’s tellurite lysed blood agar 217 mrvp broth 218 glucose 219 sucrose 220 lactose 221 maltose 222 mannitol 223 inulin 224 amikacin 30μg 225 amoxicillin 25 μg 226 ampicillin / cloxacillin 10 μg 227 amoxicillin + clavulanic acid 20+10 μg 20+10 μg 228 ampicillin +salbactam 10+10 μg 10 vial each 229 azithromycin 15 μg 230 aztreonam 30 μg 231 bacitracin 130 μg / μl 232 carbenicillin 100 μg 233 cefaclor 30 μg 30 μg 234 cefalexin 30 μg 30 μg 235 cefazolin 30 μg 30 μg 236 cefepime 30 μg 237 cefixime 5 μg 238 cefoperazone 75 μg 239 cefoparazone+ salbactam 75+30 μg 240 cefotaxime 30 μg 241 cefotetan 30 μg 242 cefoxitin 30 μg 243 cefpirome 30 μg 244 cefpodoxime 10 μg 245 ceftazidime 30 μg 246 ceftriaxone 30 μg 247 cefuroxime 30 μg 248 cephalotin 30 μg 249 chloramphenicol 30 μg 250 ciprofloxacin 5 μg 251 clarithromycin 15 μg 252 clindamycin 2 μg 253 colistin 10 μg 254 doripenem 10 μg 255 doxycycline 30 μg 256 ertapenem 10 μg 257 erythromycine 15 μg 258 fosfomycin 200 μg 259 gentamicin 10 μg 260 gentamicin ( high load ) 120 μg 261 imipenem 10 μg 262 kanamycin 30 μg 263 levofloxacin 5 μg 264 lincomycin 15 μg 265 linezolid 30 μg 266 meropenem 10 μg 267 moxifloxacin 5 μg 268 nalidixic acid 30 μg 269 netilmicin 30 μg 270 nitrofurantoin 300 μg 271 norfloxacin 10 μg 272 ofloxacin 5 μg 273 oxacillin 1 μg 274 penicillin 6 μg / 10iu 275 piperacillin 100 μg 276 piperacillin+tazobactam 100+10 μg 277 polymixin 50 μg / 300 ui 278 quinupristin dalfopristin 15 μg 279 rifampicin 5 μg 280 spectinomycin 100 μg 281 streptomycin 10 μg 282 streptomycin ( high load ) 300 μg 283 teicoplanin 30 μg 284 tetracycline 30 μg 285 ticarcillin 75 μg 286 ticarcillin+clavulanic acid 75+10 μg 287 tigecycline 15 μg 288 tobramycin 10 μg 289 trimethoprim+sulfamethoxazole 1.25+23.75 μg 290 trimethoprim 5 μg 291 vancomycin 30 μg 292 polymyxin b 30 μg 293 elisa kit for hbsag 294 elisa kit for dengue ns 1 295 elisa kit for dengue igm 296 rapid card test dengue ns1 297 elisa kit for chikungunya igm 298 torch nanoplex igg / igm ( nano elisa kit ) 299 aso latex agglutination test 300 crp latex agglutination test 301 ra latex agglutination test 302 widal slide agglutination test 303 rpr test kit 304 vdrl test 305 hbsag card test 306 malaria card test 307 hav igm card test 308 hcvigm card test 309 gram stain 310 acid fast bacilli staining 311 india ink 312 albert stain 313 potassium hydrochloride 314 lectophenol cotton blue 315 lugols iodine 316 nacl crystal 317 stain a and stain b 318 methanol 319 surgical spirit 320 melachite green 321 nigrosine 322 h2so4 323 kmno4 crystal 324 iodine 325 hydrogen peroxide 326 oxidase reagent ( tetramethyl p phenylenediaminedihydochloride ) 327 rabbit plasma 328 kovac’s reagent or ehrlich reagent 329 potassium nitrate ( kno3 ) 330 optochin disc 331 sodium deoxycholate 332 bacitracin disk 333 potassium iodide 334 potassium hydroxide 335 formaldehyde 40% 336 glycerine 337 potassium acetate 338 pyridine 339 sodium hydrosulphite 340 thymol crystal 341 2 propanol 342 xylene 343 paraffin wax 344 pap stain 345 giemsa stain 346 hematoxylene stain 347 eosin stain 348 sodium metabisulphite 349 brilliant cresyl blue 350 leishman stain 351 ethyl alcohol 352 methanol 353 glacial acetic acid 354 dpx 355 cdi tissue marking dyes 356 sodium iodate 357 potassium alum 358 citric acid 359 chloral hydrate 360 1% aq potassiumferrocyanide 361 2% aq. hydrochloric acid 362 turk diluting fluid 363 pandy’s reagent 364 trichloroacetic acid 365 ehrlich’s reagent 366 lugol’s iodine 367 n / 10 hcl 368 semen diluting fluid 369 sulfur powder 370 bovine albumin 371 g6pd reagent 372 cedar wood oil 373 drabkin solution for hb 374 edta powder 375 filter paper sheet 376 fouchets reagent 377 liquid ammonia 378 methylene blue 379 rbc dilution fluid 380 rectified spirit 381 3% acetic acid 382 chlorhexidine 0.5% hand rub 383 fluorescein 384 rhodamine 385 acridine orange 386 salmonella diagnostic antiserum 2ml – 0:2 387 salmonella diagnostic antiserum 2ml – 0:4 388 salmonella diagnostic antiserum 2ml – o:9 389 salmonella diagnostic antiserum 2ml – h d 390 salmonella diagnostic antiserum poly o’ a g 2ml 391 vibrio cholera diagnostic antiserum ogawa 2ml 392 vibrio cholera diagnostic antiserum inaba 2ml 393 vibrio cholera diagnostic antiserum 2ml – poly’o’ 394 shigella boydii antiserum polyvalent 2ml 395 shigella dysenteriae antiserum polyvalent 2ml 396 shigella flexneri antiserum polyvalent 2ml 397 shigella sonnei antiserum polyvalent 2ml 398 desorb u 399 owner koller buffer 400 cacl2 0.025 m 401 cephascreen 402 neoplastine solvent 2 403 listest d di plus ( layex ) 404 listest d di ( buffer ) 405 liquid fib 406 liatest control n 407 neoplastine c1 plus r 2 408 lh lyse m52 409 diff lyse m52 410 diluent m52 411 prob cleaner 412 aspen m 68 diluent 413 aspen m 68 lb lyse 414 aspen m 68 lh lyse 415 aspen m 68 ld lyse 416 aspen m 68 fd dye 417 aspen probe cleaner 418 alfa lyse 419 alfa dilutents...

Government Dental College - Madhya Pradesh

31532122 supply of dental materials dental material, orthodontic material , 1.5 mmx miniplate s.s. , 1.5 mmy miniplate s.s. , 1.5 mm l miniplate with gap left s.s. , 1.5 mm l miniplate with gap right s.s. , 1.5 mm l miniplate without gap left s.s. , 1.5 mm l miniplate without gap right s.s. , 1.5 mm 4 hole miniplate with gap ( straight ) s.s. , 1.5 mm 4 hole miniplate without gap ( straight ) s.s. , 10 mm screw for2.5 mm plate , 10 mm screw for2mm mini plate ss , 2.5 mandibularreconstruction ( 20 hole ) plate with angle , 2.5 mandibular plate left angle s.s. , 2.5 mandibular reconstruction ( 20 hole ) straight plate s.s. , 2.5 mm mini plate 6 hole with gap , 2.5mm 4 hole miniplate with gap ( straight ) s.s. , 2mm 10 hole miniplate s.s. , 2mm 20 hole miniplate without gap ( straight ) s.s. , 2mm 4 hole miniplate without gap ( straight ) s.s. , 3.0 round body silk suture , 5% taper hand endodontic files , 6 mm screw for2mm mini plate ss , 6 mm screw for 2.5 mm. mini plate , 6 mm screw x 1.5 mm for 1.5 mm mini plate , 8 mm screw for2.5 mm plate , 8 mm screw for2mm mini plate ss , 8 mm screw x1.5 mm for 1.5 mm mini plate , abrasive & polishing burs , abrasive finishing stone for ni cr &cr co. assorted , abressive sand for sand blaster 1 kg , absorbable gelatine sponge ( abgel ) , absorbent paper ( plain ) , absorbent points ( 15 40 ) ( 45 80 ) , accuchek strips , acrylic cold cure 400 gms.& 400 ml.both in single pack , acrylic cold cure shade for jc different shades a ( 1 ) b ( 1 ) c ( 1 ) d ( 1 ) e ( 5 ) f ( 1 ) 450 gm.450 gm.powder. , acrylic heat cure 450 gm. powder, 256 ml, liquid, 112 ml. cold mold seal pink / clear , acrylic heat cure shade for jc different shades a ( 1 ) b ( 1 ) c ( 1 ) d ( 1 ) e ( 3 ) 450 gm.powder , acrylic trimmer stonet2 , acrylic trimmer stone t1 , acrylic trimmer stone t3 , acrylic trimmer stone t4 , adhesive plasterroll , air rotor cartridges ( std. and high torque ) , airotor burs ( diamond ) differentshapes , airotor diamond burstapering, with ce mark , airotor diamond burs flat fissure with ce mark , airotor diamond burs inverted cone with ce mark , airotor diamond burs round with ce mark , airotor spray for quick lubrication of handpiece ( approx. 500 ml ) , alcohol 100% ( ethanol ) , alginate impression material1125 gms. jar , alpine green wheels assorted for contra angle hand piece , amalgam finishing kit , apf gel with fluoride application trays 200 gm. pack , arsenic fiber for dental use , articulating paper for prosthodontic purpose to check occlusion , austins retractors , automix gic type ii capsules , b.p. blade ( 15 no. ) , band material .125x.003 , band material .150x.003 , band material .150x.004 , band material .180x.005 molar , barbed broches 21 mm ( pkt 6 piece ) , base former moulds adult , base former moulds pediatric , base paste for ceramic , base plate shellac u / l , biodentine , bite registration paste. , bleaching kit in office gel form , bleaching powder , bod gardner pattern mallet , bondable & weldable beggs oval buccal tubes , bondable beggs round buccal tubes double weldable beggs round buccal tubes double , bondable brackets beggs high flauge ( flat & curved ) , bonding material light cure ( trans bond xt ) , bonding material self cure ( rely – a – bond ) , bone graft material synthetic tricalcium phosphate , hydroxiapatite and / or combination dfdba, fdba, glass reinforced , bone graft material – containing glass particle, particle size above then 90 micron , bone graft material bmp’s and growth factors , bone graft material dfdb , bone graft material fdba , bone graft material hydroxyappatite crystal, , bone graft material synthetic alloplastic material , bone graft material tricalcium phosphate , bone graft material xenografts , bone wax , bow friction stop – 100 092 ( ortho org ) , brackets ( beggs ) weldable ) , brass pin stage 1, 2, 3 lock pins , brass wire ( 0.7mm ) , brush for denture cleaning , buccal tube bondable .022x.028 mbt – single double & u / l & u / triple , buccal tube weldable .022x.028 mbt – single double & u / l & u / triple , bur straight hand pie ( flat fissure ) , bypass clamps pack of 10 , calcium hydroxide ( two paste system ) ( for pulp capping ) , calcium hydroxide powder 8 gms. , capillary tube ( bt ct ) , carbide trimmer , carbide trimmers for based metal ( different shape ) , carbolic acid minimum pack of 250 ml. , carborandum disc large , carborandum disc small , carborandum lathe wheel , carborundem disc wheel , caries detecting dye , carving wax , carving wax block for individual tooth carving , casting investment material a. casting investment for porcelain b. phosphate bonded , casting material a. nickel chrome b. chrome cobalt c. metal for porcelain , cavit temporary restoration , cavity varnish pakc of 30 ml. , celluloid matrixstrips , ceramic bracket kit mbt 022 x 028 , ceramic finishing kit , ceramic kit containing opaquer, dentine shade, glaze, modeling liquid 16 shades , ceramic metal for pfm work pellets for crown & bridge pkt. of 1 kg. , ceramic polishing kit , cheek retractor adult , cheek retractor child , chemo mechanical carries removal system with instruments , chip syringe , chisel 5 mm ss with ce mark , chisel 3 mm, ss with ce mark , chlorhexidiene for endodontic irrigation , cintered diamond point , cintered diamond trimmer different shape and size , clot activator , clove oil 110 ml. , coated glass slide for immunohistochemistry , cold mould seal ( 5 litres jar ) , combination pull head gear , compo nomer 20 comp pack , composite filling material universal opaquer , composite finishing & polishing kit , composite restorative kits ( having dentin and enamel shades along with bonding agent and applicator tips ) , compressor tube for air , cord for units , cover slip ( 22x22, 22x50, 22x70 ) , crimpable hooks straight , crown & bridge waxes a. occlusal b. cervical c. body wax d. mockup wax , crucible for centrifuge casting machine , crucible for induction casting machine , crystal for ceramic ( light + medium + dark ) , cusaliers ( assorted ) , cytofix , debubblizer 100ml. spray bottle , dental ceramic dentin porcelain 1 oz ( 28.3 gms. ) a1, a2, a3, a3.5, b2, b3, c1, c2, d2 , dental ceramic enamel porcelain powder50g bottle ( i1, i2 ) , dental ceramic opaque porcelain 4x28.3 gms. ( 4 oz ) a1, a2, a3, a3.5, b2, b3, c1, c2, d2 , dental floss , dental floss with handle , dental investment material , dental mercury 225 gm. , dentulas mould to prepare models – adult , dentulas mould to prepare models – pedo , diamond disc set ( different size, & safe sides ) , diamond disc set different sizes , diamond points ( airotor h.p ) a.tf no. 11 & 12 b. tr no. 11 , 12 & 13 c.wr no.13 d.tc no.21 e.bud shaped , diamond polish kit a. for composite b. for porcelain , diamond stripes pack of 10 , diamond stripsanterior , diamond stripsposterior , diamond strips 106 200 ( anterior & posterior ) , die hardner 15ml. bottle , die pin double , die pin single , die sealear 15 ml. bottle , die spacer silver &gold 15 ml. bottle , die stone pack of 3 kg. , digital carestream xray films8x10 , disposable surgical sterilizedgloves 6 ½ , 7, 7 ½ , disposable syringe 24 gauge x 1 ½” , disposable syringe 26 gauge x 1 ½” , dowel pins , drill bit 1.0 mm ss for micromotor straight hand piece , drill bit 1.5 mm ss for micromotor straight hand piece , drill bit 2 mm ss for micromotor straight hand piece , duplicating material , dynaplast 2” , edtatube , edta for root canal irrigation and chelation , edta powder pack of 500 gm. , elastic chain ( long ) spool form 15 feet , elastic chain ( long, short & continuous ) , elastic separators pack of 100 , elastic thread pack of 100 , elastics pink and red , electrolytic liquid 1 lt. , enamel boding agent 20 gms , endo ice in spray form minimum 100 ml. pack , endo ice or equivalent , endodontic sealer ( ah plus or equivalent ) , endodontic side vented irrigation syringe ( 27 and 30 gauge ) , endodontics pluggers iso assorted , engine driven rotary endodonticfiles , eosin ( 125ml ) , ericharch bar with ce mark , esr needle , etching agent , etching agent liquid type , eugenol free periodontal dressing pack , examination gloves small, medium, large , expansion screw conventionalu / l , expansion screw hyrax , explorer with ce mark , face mask ( delairs face mask ) , felte cone , felte wheel , feracrylum gel , feracrylum sulphate solution , files .04 taper used in reduction hand piece , filter paper , finger spreader ( 15 40 ) , flate fissure bur for straight hp , flexifile15 40 k file , flexifile45 80 k file , fluoride gel , fluoride varnish , flux pack of 10 gms. , formaldehyde 100% , formaline , formocresol ( cresol 35%, formaldehyde 19% ) 15 ml bottle , french chalk , gates glidden drills assorted , gentian violet crystel , gingifast used for gingival substitute implent model fabrication , glass innomer cement for cementation ( type 1 luting ) minimum pack of powder 35gm. , glass ionomer restorative material ( type 9 ) ( capsules ) , glass ionomer restorative material ( type 9 ) ( powder approx. 15 gm and liquid approx. 8 ml ) , glass ionomer restorative material ( type ii ) ( powder approx. 15 gm and liquid approx. 8 ml ) , glass slide ( 7.5cmx2.5cmx1.25mm ) and ( 7.5cmx2.5cmx1.1mm ) , grams staining kit , green stick compound ( tracing stick ) , gtr membrane eptfe , ptfe, resorbable, collagen , gutta percha point ( 4% 20, 25, 30; 6% 20, 25 ) , gutta percha point protaper , gutta percha points ( i.s.o. size 2% taper ) ( 15 40 ) , gutta percha points ( i.s.o. size 2% taper ) ( 45 80 ) , gutta percha solvent , hand operated set of files for rct ( single cone technique ) , harris hematoxylin ( 125ml ) , hbs ag cards , head gear high pull , head gear medium pull , histocassettes ( plastic ) , howarths periosteal elevators with ce markc make , implant & abutments3.3x13 , implant & abutments 3.3x10 , implant & abutments 3.3x11.5 , implant & abutments 3.3x16 , implant & abutments 3.5x10 , implant & abutments 3.5x11.5 , implant & abutments 3.5x13 , implant & abutments 3.5x16 , implant & abutments 3.75x10 , implant & abutments 3.75x11.5 , implant & abutments 3.75x13 , implant & abutments 3.75x16 , implant & abutments 3.75x8 , implant & abutments 4.2x10 , implant & abutments 4.2x11.5 , implant & abutments 4.2x13 , implant & abutments 4.2x16 , implant & abutments 4.2x8 , implant & abutments 5x10 , implant & abutments 5x11.5 , implant & abutments 5x13 , implant & abutments 5x16 , implant & abutments 5x8 , implant kit ( surgical drills / physiodespenser / endosteal implants ) , implant kit complete surgical kit & implant with tiunite surgical prosthetic components , implant prosthetic kita.impression coping, b. healing abutment d. implant analogue , implant screw driver 1.5mm, 2 mm, 2.5mm , implant surgical kitdental implants 25 no with easy abutment, dental implants 20 no with ball and socket attachments, implant physiodispenser with fiber optic reduction hand piece , 05 set of implant analog, gingival former, impression post , implant with tiunite surface ( dental ) & abutment , impression compound with ce mark pack of 200 gm. , impression paste zinc oxide eugenol , inlay wax , interlig splinting material 8.5 cm length pack of 3 , intra oral distractor rt & lt side , intra oral distractor rt & lt side 10” , investment material for ceramic work powder with liquid , iodoform powder 50 gm , irm filling material 38 gm power and 14 ml liquid , kobaysi hooks , lancet , lentulo spiral 15 40 hand operated , leukart pieces l blocks for histopathology of brass with plate , light cure composite resin ( 3 syringes each of a1, a2, b1, b2 shades ) , light cure pack for periodontal dressing , lingual button bondable , local drug delivary system for periondontal therapy , low fusing porcelain ( all ceramic & veneer work ) compelete kit , low fusing porcelain ( all ceramic and veneer work ) complete kit , lubricant spray for hand pieces , m 30 diluent ( 20 lit ) , m 30 probe cleanser ( 17ml ) , m 30 rinse ( 20 lit ) , m 30 lyse ( 500ml ) , madrill for disk for straight hand piece , madrill for sand paper for straight hand piece , mandrills for sand paper , matrix band retainer ivory no.1 , matrix band retainer ivory no.8 , matrix bands no 1 and no 8 , matrix system sectional ( palodent or like ) , maxilofacial prosthetic medical grade silicon material complete kit , meta pex pressure syringe , metal saw with handle 6 inch and 12 inch , miracle mix , mixing gun for gic , mixing gun for rubber base , modelling wax with ce mark , modules ( transparent ) , modules ( transparent ) strips pack of 100 , mounted dental x ray viewer , mouth mirror top ( front surface ) , mta delivery syringe , mushroom loop arch u / l – 32, 33, 34mm. , mylar strips , nasal hood for nois , niti coil spring close and open , niti palatal expander – diff. sizes , nylon suture 3 0 ( r.c ) non absorbable surgical suture u.s.p. ce0197 , nylon suture 4 0 ( r.c ) non absorbable surgical suture u.s.p. ce0197 , nylon suture 5 0 ( r.c ) non absorbable surgical suture u.s.p. ce0197 , occlusal films , opaque liquid 250 ml. , orthodonticelastics green 5000 per packets , orthodonticelastics yellow 5000 per packets , orthodontic bondable begs round buccal tubes with hook pack ofn 50 , orthodontic elastics blue 5000 per packets , orthodontics arch wire edgewise straight length ss022”x.028” pkt. of 10 , orthodontics arch wire edgewise straight length ss .016”x.022, pkt. of 10 , orthodontics arch wire edgewise straight length ss .017”x.025, pkt. of 10 , orthodontics arch wire edgewise straight length ss .019”x.027” , pkt. of 10 , orthodontics arch wire preformed blue elgiloy.016”x.016” u / l pkt. of 10 , orthodontics arch wire preformed niti wire .012 lower ( mandibular ) pkt. of 10 , orthodontics arch wire preformed niti wire .012 upper ( maxillary ) pkt. of 10 , orthodontics arch wire preformed niti wire .014 lower ( mandibular ) , orthodontics arch wire preformed niti wire .014 upper ( maxillary ) pkt. of 10 , orthodontics arch wire preformed niti wire .016lower ( mandibular ) , orthodontics arch wire preformed niti wire .016 upper ( maxillary ) pkt. of 10 , orthodontics arch wire preformed reverse curve niti .016” u / l, 16x22” , orthodontics arch wire preformed s / s , 021x.027 lower pack of 10 , orthodontics arch wire preformed s / s . 019x.025” lower pack of 10 , orthodontics arch wire preformed s / s .017”x.025” lower pack of 10 , orthodontics arch wire preformed s / s .017”x.025” upper , orthodontics arch wire preformed s / s .019x.025” upper pack of 10 , orthodontics arch wire preformed s / s .021x.027 upper pack of 10 , orthodontics arch wire preformed tma .019”x.027 upper , orthodontics arch wire preformed tma .019”x.027” lower pack of 10 , orthodontics arch wire preformed tma .022x.028 lower pack of 10 , orthodontics arch wire preformed tma .022x.028 upper pack of 10 , orthodontics australian premium plus .010 spool form , orthodontics australian premium plus .012 spool form , orthodontics australian regular wire .016 spool form , orthodontics band material .125x.003 pack of 10 feet , orthodontics band material .150x.003 pack of 10 feet , orthodontics band material .180x.005 pack of 10 feet , orthodontics base former u / l , orthodontics bondable brackets beggs high flange ( curved ) pack of 50 , orthodontics bondable brackets beggs high flange ( flat ) pack of 50 , orthodontics bonding material light cure for orthodontic purpose kit with atchent bonding agent & composite , orthodontics bonding material self cure kit with atchent bonding agent & composite , orthodontics brass wire ( 0.7mm ) spool form , orthodontics buccal tube bondable .022x.028 mbt – lower single , orthodontics buccal tube weldable .022x.028 mbt –lower single , orthodontics buccal tube weldable .022x.028 mbt – upper double , orthodontics buccal tube weldable convertible .022x.028 ( mbt ) lower , orthodontics buccal tube weldable convertible .022x.028 ( mbt ) upper , orthodontics ceramic bracket kit mbt .022 x .028 , orthodontics cheek retractor adult , orthodontics cheek retractor child , orthodontics cheek retractor medium , orthodontics combination pull head gear , orthodontics elastic chain ( continuous ) spool form 15 feet , orthodontics elastic chain ( short ) spool form 15 feet , orthodontics expansion screw conventionallower , orthodontics indirect bonding kit , orthodontics kobaysi hooks pack of 100 , orthodontics ligature wire .009” spool form 500 gms. by waight , orthodontics lingual button bondable pack of 10 , orthodontics lingual button weldable pack of 10 , orthodontics lingual cleat pack of 10 , orthodontics lingual orthodontic kit .018 size , orthodontics lingual sheaths 971 032 , orthodontics lip bumper pack of 10 , orthodontics micro implant kit , orthodontics ni ti closed coil spring spool form , orthodontics ni ti open coil spring spool form , orthodontics niti palatal expander , orthodontics niti preformed wire round heat acticated upper & lower .014, .016, .018 ( pkt. of 10 ) with , orthodontics niti rectangular wire hear activated 16x 22 ( pkt of 10 ) with ce mark , orthodontics niti rectangular wire hear activated 17x 25 ( pkt of 10 ) with ce mark , orthodontics power module mbt , orthodontics pre adjusted edgwise kit 0.022 mbt with buccal tubes ( single buccal ) , orthodontics pre formed connecticut intrusive arch u / l ( medium size – .016 x .022 ) , orthodontics prefabricated s.s. post 25 posts , orthodontics preformed bands without buccal tube , orthodontics s / s wire all gauge 22 gauge spool of 1 kg. , orthodontics s / s wire all gauge 23 gauge spool of 1 kg. , orthodontics s / s wire all gauge 25 gauge spool of 1 kg. , orthodontics self ligating bracket kit ( 022 x 028 ) mbt , orthodontics thermal niti – 016x022 pack of 10 , orthodontics tma wires 0.016 x 0.022 upper & lower pack of 10 , orthodontics tma wires 0.017x0.025 upper & lower pack of 10 , orthodontics wire s.s. 19 guage pack of 1 kg. , orthodontics wire s.s. 21 guage pack of 1 kg. , paper points no. 15 40, 45 80 assoted pack180 sticks , paraffin wax ( 58 60 degree ) 500gm , pas stain & pap stain kit , patient drape , pediatric endodontic rotary files , pediatric readymade bands , pediatric x ray film 0 size , periodontal dressing coe pak 2 tube system 90 gm. activator 90 gm. catalyst , periodontal dressing material i. eugenol free – coe pac ii. light cure periodontal dressing material , pex pressure syringe , photographic mirrors , piezeo reamers , pink porcelain , pit and fissure sealants tube form minimum 3 gm , plaque disclosing solution 50 ml , plaster of paris indian , plaster stone 25 kg. pack , plastic dropping bottle ( 100ml, 250ml and 500ml ) , polishing cotton buff 4 diameter , polishing luster material for ceramic / porcelain work , poly carboxylate , poly vinyl siloxane impression material light body 180 ml ( base 90 ml+catalyst 90ml ) , poly vinyl siloxane impression material medium body conistency 180 ml ( base 90 ml , poly vinyl siloxane impression material putty consistency 900 ml ( base 450ml + catalyst 450 ml ) , pontic formers anterior u.& l. modules , pontic formers posterior u.& l. modules , porcelain glaze liquid powder both , porcelain opaque paste a1, a2, a3, a3.5, b1, b2, b3, c1, c2, d2 , porcelain powderdifferent shades dentine and opaquea1, a2, a3, a3.5, b1, b2, b3, c1, c2, d2 , porcelain separating liquid 100 ml. , post core system ( drills & compatible post ) , power module mbt , pre adjusted edgwire kit 0.022 mbt with buccal tubes ( single buccal ) , pre formed connecticut intrusive arch u / l ( medium size – .016 x .022 ) , prefabricated post , prefabricated zirconia crown , preformed waxes for cast partial denture frame work a. bicuspid clasp ( 4 pkt ) b. molar clasp ( 4pkt ) c. ligual bar ( 4pkt ) d.anatomic palate ( small &large ) e. relife waxes f. palatel bar , printer paper roll ( 30 mtr ) , proline suture ( 6.0 ) 823 , prosthetic adhesive , pumic powder 1 kg pack , quick setting mineral trioxide aggregate ( mta ) , r.c ( k files ) ( 21mm ) ( 06, 08, 10, 15, 20, 25, 30, 35, 40 and 45 80 ) , rapid vicryl5 0 , reconstruction s.s plate plain , reconstruction s.s plate with condyle , reconstruction ti plate plain , reconstruction ti plate with condyle , refrectary material for all ceramic & veneer work , regenerative membranes : non resorbable membrane eptfe, ptfe , regenerative membranes : resorbable membrane collagen membrane vicryl synthetic skin freeze dried durameter , resinbonded cement ( dual cure ) , resin modified glass ionomer restorative material ( capsules ) , resin modified glass ionomer restorative material ( powder approx. 15 gm and liquid approx. 8 ml ) , resin reinforced glass ionomer cement powder 12wmg, liquied 6mg1 powder scoop 1 mixingpad , retention bead ( small size ) , retractionpaste system , retraction cord ( 0, 00, 000, 1, 2 ) , right upper molar dental extracion forcep ( imported ) with ce mark , ring liner , root canal calcium hydroxide containing paste , root canal edta gel 3 ml. , root canal h files 15 40 iso , root canal h files 45 80 iso , root canal obturating material for primary teeth , root canal reamers 15 40 iso assorted , root canal remers 45 80 iso assorted , root canal sealer resin based , rotary endodontic files ( 4% 20, 25, 30; 6% 20, 25 ) , rotary hand piece file for root canal , rotary protaper endodontic files ( assorted ) , rubber base material ( addition silicon type ) ( putty+ light body ) medium body , rubber dam kit , rubber dam sheets , s d f , sand for sand blaster , sand paper ( 120 no. ) , sand paper mandrill , sealing wax , separating media , sheet acrylic for pressure molding machine 1 & 2 mm , sheet silicon for pressure molding machine , silicon rubber points / wheel / disc, , silicone tooth model dies – all teeth & edentulous silicone dies. , silk suture 3 0 ( 5070 ) braided silk non absorbable suture ce0086 , silver alloy non gamma 30 gm. , slide box ( 2 slide container ) , slide coating chemical , smoothcastingwax pack of 15 sheets 0.3 mm , sodium hypochloride ( approx. 5.25% ) , soft liner cold cure , soft liner heat cure , solder material silver spool 15 feet , splinting material light cure fiber reinforced, strip form , sprue wax 3mm 1 kg. spool , stainless steel crowns – permanent molar , stainless steel crowns – primary molar , stellon c / b polydent ( shade acrylic heat cure ) , stellon c / b polydent ( shade acryliccoldcure ) , steri strip , stone assorted , strip crown , suction tips , sunction appartantus with disp tips , surgical blade no.11 ( 100 blade packet ) , surgical head cap , surgical skinstepller , suture needle, ss, round and / or cutting body ½ and / or3 / 4 circle needle , suture thread, resorbable vicryl, nonresorbable silk3 0, 4 0, 5 0 , t. c.bur / t.c. trimmer , t.c tappering fissure oral surgery burs 701 for straight, hand piece , t.c. tappeing fissure oral surgery burs 703 for stright hand piece , t.c. tappering fissure oral surgey burs 702 for stright hand piece , tc round oral surgery bur for straight hand piece , tc tapering fissure orialbur for straight handpiece , teeth full set cross linked , teeth posterior ( teeth set ) teeth set of 8 / 16 card , teeth set acrylic anterior upper and lower teeth set of6 , teeth set of4 , temporary filling material15 gm , test tube holder , thermoplaticsheets ( 2mm hard and soft ) , three layer surgical mask disposable , tiscrew ( 2.5 x 6 mm ) , ti plate ( 1.5 mm ) , ti plate ( 2.0 mm ) , ti plate ( 2.5mm 4 hole with gap ) , ti screw ( 1.5 x 6 mm ) , ti screw ( 1.5 x 7 mm ) , ti screw ( 1.5 x 8 mm ) , ti screw ( 2.0 x 10mm ) , ti screw ( 2.0 x 6mm ) , ti screw ( 2.0 x 8mm ) , ti screw ( 2.5 x 8 mm ) , ti screw ( 2.5 x10 mm ) , tooth polishing paste, , tracing stick compound , transparent crowns kit , tray adhesive ( coltene ) , tube for water supply in dental chair , tungston carbide bur for micromotor straight hand piece, flat fissure 558 , 560 no. , turbine handpiece oil 500 ml , typodonts with full set of all teeth with ce mark ( adult ) , typodonts with full set of all teeth with ce mark ( pedo ) , vaseline , vicryl suture 3 0 ( 2401 ) absorbable surgical suture u.s.p. , vicryl suture 3 0 ( 2437 ) absorbable surgical suture u.s.p. , vicryl suture 4 0 ( 2465 ) absorbable surgical suture u.s.p. , viscogel relining material , vita pex , wax bees , wax blue inlay , wax carding , wax carving cast all shades , wax castingsheet , wax craving , wax pattern for bondyhardr claps, pack of 10 sheet / 200 clarps , wax pattern for molar claps. pack of 100 sheets / 200 clasps , wax pattern for pre molar claps, pack of 10 sheet / 200 claps , wax sprue ( ) 14, 16&18 guage , wax sticky , wedges ( wooden or plastic ) , weldable round buccal tubes , wheel stone , wide mouth glass bottle with stopper lid ( 125ml, 250ml ) , wide mouth glass bottle with stopper lid ( 500ml ) , wire ss 19 and 21 guage ( 2 kg each ) smith , xylene , zelgan ( alginate imp mat ) , zinc oxide ( approx 100 gm pkt ) , zinc oxide eugenol cement ( filling ) powder & liquid , zinc oxide powder , zinc phosphate cement 90 gms and 30 ml liquid. , tab. ibu profen 200 mg. , tab. ibu profen 400 mg. , cap. amoxicillin 125 mg. , cap. amoxicillin 250 mg. , cap. amoxicillin 500mg. , tab. ranitidine 100 mg. , tab. vitamin b complexwith zinc , tab. carbamezapin 100 mg. , tab. diclofenac sodium 50 mg. , lignocane ointment , lignocane spray , antiseptic lotion , povidon iodine solution5% , normal saline , sodium hypochloride 3% , 5% , povidon iodine ointment , inj. adernaline , inj. decadron , inj. hemolok , inj. avil , formaline tablets , distill water , tab. diclofanac + paracetamol , tab. pantoprazole 40 mg. , tab. fluconozole , tab. metronidazole 200 mg. , tab. metronidazole 400 mg. , tab. amoxicillin + clavaulanic acid 375 mg. , tab. amoxicillin + clavaulanic acid 625 mg. , inj. lignocane 2%with adernaline 1:80000 , tab. ofloxacin + ornidazole , triple antibiotic paste for endodontic treatment...

National Thermal Power Corporation Limited - Madhya Pradesh

31484531 procurement of fine chemicals and standards for ntpc rihand, vindhyachal and singrauli procurement of fine chemicals and standards for ntpc rihand, vindhyachal and singrauli , benzoic acid blisters:thermochemical , acids:nitric acid ar : ( gr ) , oxalic acid ( ar ) , xylene;rectified. , hexane , hydrochloric acid conc. ar / gr , methanol analytical ( ar ) , memrane filter, cellulose nitrate, 47 mm , chmcl:ferrous ammonium sulphate , manganous sulphate gr grade , potassium hydroxide ar / gr / excelar , sodium hydroxide standard:1n in ampoule , reagent: kf appln water standard , hydrochloric acid n / 1 cvs pack 6 ampules , acid:oxalic acid:ar / er / emparta grade , ion chromatograph:7 anion standard , universal indicator solution ph 4 to 11 , chmcl:ortho toludine , sodium molybdate , chmcl; sodium metabisulphite , chmcl:sodium iodide :gr , chemical lab ar sodium chloride , n ( 1 napthyl ) ethylene diamine neda , hexane , sulphuric acid: ( ar / gr / excelr ) , petroleum ether 60 80 deg. c , eriochrome black t, ar , patton and readers reagent; indicator , phenolphthalein indicator powder , phosphate std soln1000mg / l ar / gr / excelar , chloride standard solution 100 ppm , std soln. copper 1000ppm:nist , silica standard : ( ar ) , ammonium molybdate ar / gr / excellar , chmcl:nh3 solution gr:gr , ammonium acetate gr , chmcl:ammonium chloride , ammonium ferric sulphate , chmcl:ammonium oxalate , barium perchlorate ar / gr / excelar , chmcl:dithiazone , ferroin solution, redox indicator , ferrous ammonium sulphate , cm: glycerin lr :r lab ( lr ) , mercury ( ii ) chloride gr , potassium chloride :argrade , potassium hydrogen phthalate gpr grade , potassium hydroxide pellets ar , potassium nitrate gr / ar / excelar , chmcl:silver nitrate ar:gr , sodium molybdate , chmcl:sodium hydroxide pellets ar:gr , chmcl:sodium sulphite , sodium thiosulphate ar / gr / excellar , stannous chloride , chmcl:thorine indicator: ( lr ) , chmcl:tolune ar:gr , formic acid; ar / gr / excelar grade , acid :oxalic , sulphuric acid ar / gr / excelar analy ( ar ) , methanol analytical ( ar ) , alchohol : ethanol : ( gr ) , chmcl:sodium meta bi sulphate lr:gr , soln:hydrogen peroxide:tr , ammonium molybdate ar / gr / excellar => limited...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

31448072 supply of laboratory chemicals and glasswares 1st call supply of laboratory chemicals and glasswares 1st call ref no. 12 , requirment of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) , iso amyl alcohol for milk testing l.r. , acetonel.r. , acetic acid glaciall.r. , ammonium ferrous sulphatel.r. , ammonia solution about 25% l.r. , ammonium molybdate ( extra pure ) , calcium chloride ( fused ) l.r. , chloroforml.r. , citric acidl.r. , cupric sulphate , cupric acetate ( monohydrate ) , diphenylamine , p dimethylaminobenzaldehyde l.r. , erichrome black t metal ( pm ) indicator , ethylenediaminetetra acetic acid l.r. , ferroin indicator solution , formaldehyde solution ( 39% 41% ) l.r. , glycerol l.r. , hydrochloric acid ( about 40% ) l.r. , iodine crystal , lactic acid min. 88% , manganese sulphate ( monohydrate ) , butylated hydroxy anisole ( b.h.a. ) , mercuric sulphate , mercuric chloride , methylene blue tablet for milk testing , nesslers reagent , oxalic acid l.r. , petroleum ether 400c 600cl.r. , phenolphthalein indicator powder , phenolphthaleinsolution indicator , potassium carbonate , potassium dihydrogen orthophasphate , potassium dichromate l.r. , potassium permagnete ( kmno4 ) , potassium oxalate monohydratel.r. , potassium iodidel.r. , potassium hydrogen phthalate , resorcinol crystal l.r. , sodium azide l.r. , sodium carbonate l.r. , sodium hydrogen carbonate l.r. , sodium hydroxide pellets l.r. , sodium hydroxide n / 10 ampule , silver nitrate l.r. , silver sulphate l.r. , starch soluble , sodium sulphate anhydrous , sodium thiosulphate pentahydrate , tartaric acid l.r. , tri sodium citrate l.r. , tri sodium citrate , zinc acetate ( dihydrate ) , citric acid ( food grade commercial ) , p nitrophenyl disodium orthophosphate , p nitrophenyl disodium orthophosphate , rosalic acid , xylene , furfuraldehyde , whats man filter paper ( 4 ) no. , whats man filter paper ( 42 ) no. , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sorbate , sulphuric acid about 98% l.r. , voilet red bileagar , potato dextrose agar , plate count agar , ringer salt solution powder , m7hr fc agar , buffer tablets ph 4.0 , buffer tablets ph 7.0 , buffer tablets ph 10.0 , buffer stripsph 2.0 – 10.5 wide range , requirment of laboratory glasswares ( for plant & mccs ) , test tube with rim 15 x 150 mm. , tube culture 16 x 125 mm. , tube culture 16 x 160 mm. , beaker low form graduated with spout 50 ml , beaker low form graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low form graduated with spout 500 ml , beaker low form graduated with spout 1000 ml , bottle, plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petridish 100 x 15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchamgeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , seperating funnel 500 ml , r.m. valve appratus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 100c to 1100c ) in 10c graduation , thermometer alcohol ( 100c to 500c ) in 0.50c graduation , sprit lamp ( alluminium ) , cotton bundle , culture tube ( with rim 10 ml ) ...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

31224548 laboratory chemicals and similary hygiene items tender iiird call, at bundelkhand sahakari dugdh sangh maryadit, sagar laboratory chemicals and similary hygiene items tender iiird call, at bundelkhand sahakari dugdh sangh maryadit, sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

31041665 supply of laboratory chemicals and similary hygiene items tender iind call, at bundelkhand sahakari dugdh sangh maryadit sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Government Auto Ayurved College Gwalior - Madhya Pradesh

30976353 etender for purchase of instruments equipments and other items required in gac and dtl gwalior etender for purchase of instruments equipments and other items required in gac and dtl gwalior , a.instruments / equipments/items required for ayurved college gwalior , half size with steel top or marble top stainless , x ray viewing box or panels , microscopes with oil immersion , westergen’s pipette for esr , haematocrit tube , sahli’s haemoglobinometer , haemocytometer , stop watches as per specification , centrifuge with speed control , colorimeter (photoelectric) , ph comparator with disc , b.p. apparatus , stethoscopes , clinical thermometer , knee hammer , tuning forks , electrocardiograph , netipatra (pital & tamra) , phototherapy unit as per specification , sterilizer 1 , sterilizer 2 , sterilizer3 , radiant warmer , foetoscope , blunt and sharp curettes , dilators set (hegar’s, hawkins) , uterine sound , mtp suction currate , retractors abdominal (doyne’s etc.) , shirodkar uterus holding forceps , green armytage forceps , uterus holding forceps , forceps obstetrics , endotrachial tubes , cord cutting appliances , i.u.c.d. removing hook , nebuliser , binocular microscope , microscope with oil immersion as per specification , monocular microscope with oil emersion lens20(e) , sahli’s square tube , hb pipette , wbc pipette , dropper , red cell pipette , improved neubauer chamber , incubator , wintrobe’s tube , pasteur’s pipette , westregrens pipette , westergrens’s stand , urinometer , cell counter (haemoautoanalyser) , bp apparatus , tongue depressor standard , stop watch , hot air oven , bunsen burner , refrigerator , laryngoscope , probes , syringe needle destroyer , cover slip , litmus paper , ph indicator paper strips , rubber sheat , water bath , multi stix , steriledisposable launer/needle , glass rode , rubber tap , dental chair with unit and all accessories , grand seiko auto referctometer , dissecting microscope , compound microscope ( trinocular microscope) , electronic balance , slides box with cover slips, , filter papers , dissection box , chloroform , alcohol. , hcl , sulphuric acid , sodium hydroxide , potassium hydroxide , benedict solution , sodium nitrate , potassium nitrate , citric acid , iodine , potassium iodide , xylol/pure xylene (slide preparation) , auroscope , bp apparatus standing , oil field radiators , ophthalmoscope , sims’s speculum , tongue depressor 1 , tongue depressor 2 , weight and height measuring stand , electric coutery , radiant warmer as per specification , phototherapy unit , biomeneque unit , sigmoscope flexible , nebuliser as per specification , knee hammer as per specification , khalvayantrasmall , khalvayantrasmall different size , khalvayantrasmall size different , khalvayantramedium , khalvayantra porcelain different size , khalvayantra porcelain , taptakhalva yantra , pounding apparatus (ulukhalayantra) 1 , pounding apparatus (ulukhalayantra) 2 , moosha (crucibles) graphite , moosha (crucibles) g crucible , moosha (crucibles) gracrucible , moosha (crucibles) graphite cru , moosha (crucibles) graphite c , moosha (crucibles) graphite cruci , moosha (crucibles) grap crucible , moosha (crucibles) graphite crucible , koshti with blower as per specification , koshti with blower , distillation apparatus and arkayantra , kupipakva bhatti , physical balance , chemical balance , hot plate , enamel tray different size , enamel tray , pyrometer , steel container different size , steel container , sieves (different size, 125, 250, 180, 300) , sprite lamp , b.instruments / equipments/items required for dtl gwalior , semi micro balance: , digital rotary flash shaker: , muffle furnace: , melting point apparatus: , digital ph meter...

Department Of Heavy Industry - Madhya Pradesh

30969999 bids are invited for boqauto extension if any seller submits price in last 15 minutes, the rawill be auto extended by 15 minutes. ( for anunlimited time ) total quantity : 1 1 hcl, 32% hydrochloric acid ( hcl ) , minimum 32% by mass 2 hno3, 69% nitric acid ( hno3 ) , minimum 69 % by mass 3 nacl, 99.5% sodium chloride, minimum 99.5% by mass 4 chloro benzene chloro benzene, minimum 99% by mass 5 n heptane n heptane, minimum 99% by mass 6 methanol methanol specially dried ( water 0.02% ) , minimum 99.8% by mass 7 acitic acid acetic acid glacial, minimum 99.7% by mass 8 petrolium ether petroleum ether, distillation range 60 80° c, 0.68 gm / ml at 20° c 9 glycerol glycerol, minimum 85% by mass 10 diethyla mine diethylamine, 99% by mass 11 universal indicator universal ph indicatior ( ph range 4 to 11 ) 12 acetone acetone, minimum 99% by mass 13 h2so4 sulphuric acid ( h2so4 ) , minimum 98% by mass 14 toluene toluene, ar grade 15 acetonitrile acetonitrile, ar grade 16 iso propyl alcohol iso propyl alcohol, ar grade 17 xylene xylene, ar grade 18 hcl, 0.1 n hcl ( 0.1 n ) , ampules 19 hcl, 1.0 n hcl ( 1 n ) , ampules 20 naoh, 0.1 n naoh solution ( 0.1 n ) , ampules 21 naoh, 1.0 n naoh solution ( 1 n ) , ampules...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

30858813 supply of laboratory chemicals and similary hygiene items tender, short terms, at bundelkhand sahakari dugdh sangh maryadit, sagar laboratory chemicals and similary hygiene items tender, short terms, at bundelkhand sahakari dugdh sangh maryadit, sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Department Of Defence Research And Development - Madhya Pradesh

30832398 chemicals chemicals ( as per appendix a of rfp ) , chemicals , sodium hypochlorite 6 14% active chlorine 2.5l , hydrochloric acid 37% 500 ml , sulfuric acid greater equal 97% 500ml , xylene anhydrous 1 l , potassium iodide greater equal 99% 100g , sodium dichloroisocyanurate greater equal 99% 500 g , taurine greater equal 99% 100 g , kaolinite neutral 1 kg , bentonite 500g , montmorillonite k 10 1 kg , eriochrome black t 100 g , sodium chloride greater equal 99% 500g , ethylene diamine tetraacetic acid ( edta ) greater equal 99% 500g , buffer reference standard ph 10 ( 20 degree c ) 500ml , buffer reference standard ph 7 ( 20 degree c ) 500ml , buffer reference standard ph 4 ( 20 degree c ) 500ml , zinc standard solution 1 mg / ml 500ml , ammonium chloride greater equal 99.5% 1 kg , ammonia solution 25% 1l => limited...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

30593124 supply of laboratory chemicals and similary hygiene items tender, at bundelkhand sahakari dugdh sangh maryadit, sagar laboratory chemicals and similary hygiene items tender, at bundelkhand sahakari dugdh sangh maryadit, sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...