Directorate Of Health Services - Madhya Pradesh

35141987 supply of medicines and consumables the year 2022 23 1.01 5 fluorouracil ( 5 fu ) ( 250mg ) , injection 1.02 acenocoumarol / nicoumalone ( 2 mg ) , tablet [ 120003 ] 1.03 adrenochrome monosemicarbazone ( 0.75mg / ml ( ml amp ) ) , injection 1.04 aggs ( anti gas gangrene serum ) 10, 000 iu / ml 40000 iu / ml / 30000 ou / ml inj. 1.05 alpha beta arteether ( 150mg / 2ml ) , injection 1.06 alprazolam ( 0.5mg ) , tablet 1.07 amikacin ( 250mg / 2ml ) , injection 1.08 amino acid glass bottle contain amino acid 6 gm, nitrogen 0.929, essential amino acid 51%, non essential amino acid 49%, bcca 22.6%, carbohydrate 5% inj ( 6 gm ) , injection solution for 1.09 aminoacid 10% ( essential ) ivf ( 10 % ) , injection solution 1.1 aminoacid 5% ivf ( 100ml bottle ) , infusion 1.11 amiodarone tab ( 200mg ) , tablet 1.12 amlodipin ( 10mg ) , tablet ] 1.13 amoxicillin 250mg + clavulanic acid 50mg inj vial 1.14 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin ( 250mg ) , tablet 1.15 amoxycilline and clavulanic acid inj 1.16 ampicillin ( 1 gm vial ) , injection 1.17 ampicillin inj ( 250 mg / vial ) , vial 1.18 antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp 1.19 anti rabies immunoglobulin inj 300 iu per 2ml ( 2ml vial ) ( 300 iu per 2ml ) , injection solution for 1.2 artemether inj 80mg / ml ( 1 ml amp ) , injection 1.21 artesunate + sulphadoxine + pyrimethamine ip ( 100 mg ( 3tab ) + 750mg + 37.5mg ( 1tab ) ( age group between 5 to 8 years ) ) , combi blister pack 1.22 artesunate tablets 150mg ( 3tab ) + sulphadoxine ( 500mg+500mg ) pyrimethamine 25mg +25mg tab ip ( 2tab ) ( age group 9 to 14 years ) , combi blister pack 1.23 artesunate tablets 25mg ( 3tab ) + sulphadoxine 125mg pyrimethamine 6.25mg tablets ip ( 1tab ) ( age group of less than 1year ) , combi blister pack 1.24 artesunate + sulphadoxine + pyrimethamine ( 50 mg + 500 mg + 25 mg tablet ) , combi blister pack 1.25 aspirin low dose tab 150mg 1.26 atorvastatin ip ( 20 mg ) , tablet 1.27 azathioprine 50mg tab 1.28 azithromycin inj 100mg / 5ml 1.29 basal insulin glargine injection 300iu disposable pen 300iu with 4 needles per pen 31g needle ( ) , pen 1.3 basal insulin glargine penfill 300iu with free permanent pens one pen for each five cartridge and 10 needles per pen 1.31 beclomethasone inhalation i.p 200 mcg per dose ( 200 metered dose container ) , inhaler 1.32 benedicts solution ( qualitative ) , bottle 1.33 benzyl benzoate emulsion ( ) , emulsion 1.34 benzyl penicillin 10lac / vial ( penicillin g ) , injection 1.35 betahistine ( 16 mg ) , tablet 1.36 betamethasone valerate cream 0.05% ( 15gm tube ) , ointment 1.37 betamethasone valerate oint 0.1% ( 15 gm tube ) , ointment 1.38 betamethasone valerate oint / cream ip ( 0.12% ) , tube 1.39 bevacizumab100 mg ( 4 ml vial ) , injection 1.4 black disinfectant fluid ( phenyl ) as per schedule o grade iii 1.41 black disinfectant fluid ( phenyl ) strength : specification as per schedule o grade i 1.42 bortezomib ( 2mg ) , injection 1.43 bortezomib ( 3.5mg vial ) , injection 1.44 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg / 5ml syp ( 100 ml bottle ) , syrup 1.45 budesonide nebulising suspension containing budesonide 0.25mg / ml ( 2ml amp ) , suspension 1.46 budesonide respules 0.25mg / 2ml inhalation ( 2ml amp / respule ) , inhaler 1.47 bupivacaine hydrochloride inj. 0.25mg ( 20 ml vial ) , injection solution for 1.48 bupivacaine hydrochloride inj. 0.5% 20ml vial ( not for spinal use ) ( ) , vial 1.49 bupivacaine hydrochloride ( not for spinal use ) ( 0.5% ) ( 4ml amp / vial ) , vial 1.5 calcium carbonate derived from oyester shell equivalent to elemental calcium 500mg and vitamin d3 250 iu ( ) , tablet 1.51 calcium chloride 0.1 ( 10 ml ) , injection 1.52 calcium citrate 1000mg ( elemental ca equivalent to 250 mg and vitamin d3 400 iu ) ( ) , tablet 1.53 calcium with vitamin d tablets calcium carbonate 650mg eq. to elemental calcium 250mg and cholecalciferol 125 iu 1.54 carbamazepine tab ( 400mg ) , tablet 1.55 carboplatin ( 150mg 15 ml vial ) , injection 1.56 carboprost trome thamine inj usp 0.25mg / ml vial ( ) , injection solution for 1.57 carboprost tromethamine injection i.p ( 15 methyl pgf2a ) inj 250mcg / 1ml ) , ampule 1.58 carboxymethylcellulose eye drop ip 1% w / v 10ml vial ( sodium cmc also accepted ) , eye drop 1.59 carvedilol ( 3.125 mg ) , tablet 1.6 carvedilol ( 6.25 mg ) , tablet 1.61 cefazolin ( 1gm ) , injection 1.62 cefazolin inj ( 500mg vial ) , injection 1.63 cefepime 1gm and tazobactam 125 mg inj ( vial ) , injection solution for 1.64 cefepime ( 500mg injection ) , injection 1.65 cefixime 50 mg dt tab ( ) , tablet 1.66 cefixime tab ip ( 100mg ) , tablet 1.67 cefoperazone 1000mg + sulbactam 1000mg inj ( vial ) , injection 1.68 cefoperazone 500mg + sulbactam 500mg ( vial ) , injection 1.69 ceftazidime ( 250mg / vial ) , injection 1.7 ceftriaxone+tazobactum ( 1gm+125mg, vial ) , injection 1.71 ceftriaxone+tazobactum 250mg+31.25mg ( vial ) , injection 1.72 ceftriaxone+tazobactum ( 500mg+62.5mg vial ) , injection 1.73 cephalexine ( 500mg ) , capsule 1.74 cetrimide + chlorhexidine ( conc. ) ( 15%+7.5% ) ( 1 liter bottle ) ( 15%+7.5% ) , liquid [ 1.75 cetrimide + choline salicylate gel for oral ulcer 15ml tube 1.76 cetrimide cream bp ( 0.1% w / w ) , tube 1.77 chloramphenicol ear drop 5% ( 5 ml vial ) , eye drop 1.78 chloramphenicol eye applicaps 1% ( 100 applicaps per bottle ) , eye drops / ointment 1.79 chloramphenicol ( 1% ( 5 ml vial ) ) , eye drop 1.8 chlorhexidine 0.2% mouth gargle ( 100 ml ) , solution 1.81 chlorhexidine gluconate solution [ 1.82 chlorhexidine gluconate solution 4% i.p. ( antiseptic ) ( 500 ml bottle ) , liquid 1.83 chlorine based compound ( sodium dicholoroiso cyanurate ) nadcc tablets 75 mg with available chloroine 45 mg bis ( 45 mg ) , tablet 1.84 chloroquine phosphate inj. 64.5mg / ml 30ml vial ( ) , injection solution for 1.85 chloroquine ( phosphate ) , syrup 1.86 chlorpheniramine maleate ( 4mg ) , tablet 1.87 chlorpromazine hydrochloride sugar coated tab ( 100 mg ) , tablet 1.88 chlorpromazine hydrochloride ( 25 mg ) , tablet 1.89 chlorpromazine hydrochloride ( 50 mg tab ) , tablet 1.9 chlorpromazine inj ip ( 25mg / ml ( 2ml amp ) ) , injection solution for 1.91 cholecalciferol concentrate ( powder form ) ph.eur. 60000iu / gm ( 60000iu / gm ) , powder 1.92 ciprofloxacin + dexamethosone ( 0.3%+0.1% ) ( 5ml ) , eye drop 1.93 ciprofloxacin + tinidazole ( 500mg+600mg ) , tablet 1.94 ciprofloxacin 0.3% ( 5ml vial ) , eye drop 1.95 ciprofloxacin inj 2 mg / ml inj 100ml glass bottle ( ) , injection solution for 1.96 ciprofloxacin inj 100 mg / 50ml ( 100ml ffs bfs bottle ) , injection solution for 1.97 cisplatin ( 10 mg vial ) , injection 1.98 cisplatin 50 mg inj ( 50 ml vial ) , injection solution for 1.99 clindamycin ( 150mg / ml ( 2 ml vial / amp ) ) , injection 2 clobetasol 0.05% + gentamicin 0.1% cream 10 gm ( 10 gm tube ) , cream 2.01 clomiphene citrate ( 25 mg tab ) , tablet 2.02 clonazepam ( 2mg ) , tablet 2.03 clopidogrel + aspirin ( 150mg ) , capsule 2.04 clopidogrel 75mg + aspirin 75mg tab ( 10x10 ) , tablet 2.05 clotrimazole 1%w / v +lignocaine 2%w / v ear drop 10ml vial bfs / ffs squeeze ( 10ml vial ) , vial 2.06 clotrimazole cream 1% ( 15 gm tube ) , cream 2.07 clotrimazole vaginal pessary tab 100mg 14 x 10 tab 2.08 clotrimazole vaginal tablet i.p. 100mg ( without applicator ) , tablet 2.09 cloxacillin sodium inj. ( 500mg ) , vial 2.1 compound benzoic acid ointment 2.11 compound tincture benzoin ip ( solution ) , bottle 2.12 cough syrup ( each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg ) ( 5 ml ) , syrup 2.13 cyclophosphamide ( 1000mg vial ) , injectio 2.14 cyclophosphamide inj 500mg / vial ( each ) , injection solution for 2.15 cyclophosphamide inj ( 200 mg / vial ) , injection 2.16 dacarbazine ( 200 mg per vial ) , injection 2.17 deferasirox dispersible ( 100mg ) , tablet 2.18 deferasirox dispersible tab. 400mg 2.19 desferioxamine inj ( 0.5g / vial ) , injection solution 2.2 dextromethorphan syrup ( each 5ml contains 30 mg dextromethorphan ) ( ) , syrup 2.21 dextromethorphan syrup ( ) , syrup 2.22 dextrose 10% 500ml bfs bottle ( ) , injection solution 2.23 dextrose 10% ( ffs / bfs 500ml bottle ) , infusion 2.24 dextrose 25% inj ( 100ml ffs / bfs bottle ) , injection solution 2.25 dextrose 25% inj 500ml bfs bottle ( ) , injection solution for 2.26 dextrose 25% inj 500ml ffs / bfs bottle ( ) , injection solution 2.27 dextrose 5% 500ml bfs bottle ( ) , injection 2.28 dextrose 50% inj 100ml ffs / bfs bottle ( dextrose 50% inj 100ml ffs / bfs bottle ) , injection solution 2.29 dextrose 50% inj. bottle ( 500ml ffs / bfs ) , injection solution 2.3 dextrose with saline 5% + 0.9% inj 500ml bfs bottle 2.31 dextrose with saline 5% + 0.9% inj 500ml ffs / bfs bottle 2.32 diclofenac sodium 50mg + paracetamol ( 325mg ) , tablet 2.33 dicyclomine 10mg / ml ( 10ml with dropper ) , drop 2.34 digoxin 250mcg / ml ( 2ml amp ) , injection 2.35 dilitiazem tab 60mg 2.36 dispersible zinc tab ( 10mg ) , tablet 2.37 dobutamine ( 50 mg / 5 ml ) , injection 2.38 docetaxel 20mg inj 2.39 docetaxel 80mg inj 2.4 domperidone suspension ( 5mg / 5ml ) , suspension 2.41 doxorubicin inj 10mg ( 10mg ) , injection solution 2.42 doxycycline tab. 100mg ( ) , tablet 2.43 doxylamine succinate + pyridoxine ( 10mg+10mg ) , tablet 2.44 electrolyte e inj 500ml ffs / bfs bottle ( electrolyte e inj 500ml ffs / bfs bottle ) , injection solution 2.45 electrolyte g inj 500ml bfs bottle ( ) , injection solution 2.46 electrolyte m inj 500ml bfs bottle ( ) , injection solution for 2.47 electrolyte m inj ( 500ml ffs bottle ) , injection solution for 2.48 electrolyte m inj 500ml ffs / bfs bottle ( ) , injection solution 2.49 electrolyte p inj 500ml bfs bottle ( 500ml bfs bottle ) , injection solution 2.5 electrolyte p inj ( 500ml ffs bottle ) , injection solution 2.51 electrolyte p inj 500ml ffs / bfs bottle ( ) , injection solution 2.52 enalapril maleate tab ( 2.5mg ) , tablet 2.53 enalapril maleate tab ( 5mg ) , tablet 2.54 enoxaparin ( 60mg equivalant to 6000 iu vial / pfs ) , injection 2.55 enoxaparin ( 20mg / 0.2ml ) ( 0.2 ml prefilled syringe ) , injection 2.56 epinephrine hydrochloride inj. 1 mg / ml ( ) , injection solution for 2.57 epirubicin ( 10mg vial ) , injection 2.58 epirubicin ( 50mg vial ) , injection 2.59 equine anti rabies immunoglobulin, ( not less than 300iu / ml ) , injection 2.6 erythromycin stearate tab 250 mg 2.61 erythromycin stearate ( 500 mg ) , tablet 2.62 erythropoietin ( 4000 iu inj vial ) , injection 2.63 ethinyl estriadiol+norethisterone tab ( 35 mcg +1mg ) , tablet 2.64 etiophylline and theophylline ( paediatric ) , syrup 2.65 etiophylline theophylline sr tab. 300mg ( ) , tablet 2.66 etoposide ( 100mg vial ) , injection 2.67 filgrastim 300mcg inj 2.68 formaldehyde ( formalin ) ( 37% acq ) , bottle 2.69 formoterol + budesonide ( 6 mcg + 100 mcg / puff ( 120 mdi ) ) , inhaler 2.7 furazolidone ( 25mg / 5ml ( 60 ml bottle ) ) , suspension 2.71 gatifloxacin ( 0.3% ) , eye drop 2.72 gemcitabine ( 1000mg vial ) , injection 2.73 gemcitabine ( 200mg / vial ) , injection 2.74 gentian violet crys sol 1% 2.75 glibenclamide tab 2.5 mg 2.76 gluteraldehyde solution b.p. ( b.p. ) , solution 2.77 glycerine ip solution ( who gmp certification exempted for this item ) ( 100 ml ) , bottle 2.78 glyceryl trinitrate 5mg / ml inj 10ml vial ( nitroglycerine ) ( 5mg / ml ) , injection solution for 2.79 griseofulvin tab. ip 125 mg 2.8 haloperidol inj ( 50mg / ml ) , injection [ 2.81 haloperidol ( 10mg ) , tablet 2.82 heparin inj ( 5000iu / ml 5ml vial ) , injection 2.83 hepatitis b immunoglobulin im inj 200 iu / vial 2.84 human albumin 20% ( 50 ml vial ) 2.85 human albumin solution i.p. 20%w / v ( 100 ml vial ) ( ) , injection solution 2.86 human anti d. immunoglobulin ( polyclonal ) bp / ep / usp / ip ( 300mcg / vial ( vial / pfs ) ) , injection 2.87 human chorionic gonadotropin inj ( 5000 iu 1ml ) , ampule 2.88 hydroethylstarch 6% solution with sodium chloride 0.9% iv infusion ( hydroxy ethylstarch solution ffs / bfs ) ( 0.9% iv ) , bottle 2.89 hydroxyprogesterone caproate inj i.p. 250mg / ml 2.9 hyoscine butylbromide ( 10mg ) , tablet 2.91 ibuprofen 400mg+ paracetamol 325mg tablet ( ) , tablet 2.92 ifosphamide 1gm lyophilised each vial + 3amp of mesna 100mg / 2ml inj ( 100mg / 2ml inj ) , injection solution for 2.93 insulin aspart in disposable pen 300iu with minimum 4 needles per pen 31g needle 2.94 insulin aspart penfill 300 iu with free permanent pen ( one pen per five cartridges and ten needles per pen ) 2.95 insulin human mixtard inj. 30:70 ( ) , injection solution for 2.96 insulin lispro in disposable pen 300iu with minimum 4 needles per pen 31g needle 300iu ( prefilled syringe ) , pens 2.97 ipratropium bromide + levosalbutamol ( 20mcg+50mcg, 200 mdi ) , inhaler 2.98 ipratropium bromide powder for inhalation 250mcg / ml [ 4330004 ] 2.99 irinotecan ( 40mg / vial ) , injection 3 iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ( iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip ( pink color ) wifs junior ) , tablet 3.01 iron and folic acid entric coated tab dessicated ip 67mg equivalent to 20mg of elmental iron 3.02 iron and folic acid entric coated tab. ferrous suplhate ip 333.335mg equivalent to 100mg of elemental ( red tablet ) , tablet 3.03 isoflurane solution ( liquid for inhalation ) 100ml ( amber color bottle ) , bottle 3.04 isosorbide mononitrate ( 20mg ) , tablet 3.05 isoxsuprine hydrochloride inj. 5mg / ml ( 2 ml amp ) ( 2 ml ) , injection solution for 3.06 ivermectin usp ( 6mg ) , tablet 3.07 ketoconazole ointment 2% 15gm tube ( 15 gm ) , ointment 3.08 ketoconazole tab 3.09 lactobacillus ( ( lactobacillus 60 million spores ) ) , tablet [ 3.1 lactulose solution ( 3.35gm / 5 ml ) , solution 3.11 l asparaginase 5000 iu lyophilized ( vial ) , injection 3.12 levocetirizine tab 5mg ( ) , tablet 3.13 levodopa +carbidopa tab 250mg + 25m 3.14 levofloxacin 500mg inj 100ml ffs / bfs bottle ( ) , injection solution 3.15 levonorgestrel emergency contraceptive ( 0.75mg ) , tablet 3.16 lidocaine 2% inj. 30 ml vial ( 30 ml ) , injection solution 3.17 lignocaine hydrochloride ( 4% ( 5 ml vial ) ) , eye drops / ointment 3.18 lignocaine hydrochloride topical solution usp ( 2% ) , vial 3.19 linezolid 200mg / 100ml ( 100ml ffs bottle ) , injection 3.2 liquid paraffin ( 500 ml, bottle ) , solution 3.21 lmwh low molecular weight heparin inj 4000iu / ml. ( ) , injection solution for 3.22 lmwh low molecular weight heparin inj. 6000_x000d_iu / ml ( ) , injection solution for 3.23 lorazepam ( 2 mg ) , tablet 3.24 losartan ( 50 mg ) , tablet 3.25 lysol ( 5ltr jar ) , solution 3.26 magnesium hydroxide and aluminium hydroxide simethecon ( 500mg + 250 mg ) , tablet 3.27 magnesium suplhate ( 50 % w / v ( 2ml amp ) ) , injection 3.28 magnesium suplhate injection i.p.50 % w / v ( 1 ml amp ) ( 1 ml amp ) , ampule 3.29 mannitol inj, 10% 100 ml bottle ( ) , injection solution 3.3 mannitol inj, 20% 350ml bfs / ffs bottle ( ) , injection solution 3.31 mannitol inj. 10% 350ml bottle ( ) , injection solution for 3.32 mannitol injection i.p. 20% 100ml bottle ( ) , injection solution 3.33 mebendazole ( 100 mg tab ) , tablet 3.34 mefloquine tab ( 250mg ) , tablet 3.35 menadione usp ( vitamin k3 ) ( 10 mg / ml ( 1 ml amp ) ) , injection 3.36 mephentermine inj 15mg / ml 10ml vial 3.37 methotrexate ( 10 mg ) , tablet 3.38 methotrexate 2.5 mg tab 3.39 methotrexate inj 15mg / ml ( vial ) 3.4 methotrexate inj 500mg vial 3.41 methotrexate inj ( 2ml ) ( 50mg ) , injection solution for 3.42 methyl prednisolone sodium succinate inj. usp 125mg ( 10ml ) , vail 3.43 methyl prednisolone sodium succinate inj.usp ( 40mg / ml vial ) , injection 3.44 methyl prednisolone sodium succinate inj. usp 500mg 3.45 methyl prednisolone sodium succinate tablet 8 mg 3.46 metoprolol inj 1 mg / ml ( 5ml vial ) , injection 3.47 metronidazole benzoate oral suspension ( 100mg of base / 5 ml ( 60ml bottle ) ) , suspension 3.48 metronidazole 500mg ( 100 ml ffs bfs bottle ) , injection 3.49 metronidazole tab ( 200 mg ) , tablet 3.5 micronised progestron inj. 200mg / m 3.51 milk of magnesia 11.25 ml, liquid paraffin 3.75ml phenolphthalein 50mg / 15ml ( cremaffin pink formula ) 170ml syr 3.52 milk of magnesia 11.25ml+liquid paraffin 1.25ml / 5ml 170ml bottle 3.53 morphine sulphate inj. ip 15mg / ml ( 15mg / ml ) , injection solution 3.54 moxifloxacine eye drop 0.5%w / v 3.55 multivitamin drops ( approx 22 drops ) ( ) , drop 3.56 multivitamin sugar coated tab. ( nfi formula ) , tablet 3.57 n acetyl cysteine inj ( 200mg / ml in 1ml amp ) , injection 3.58 nitrofruantoin tablet ip 100m 3.59 noraderanaline inj. ( 2 mg base / 2 ml amp ) , injection solution 3.6 norethisterone ( 5mg ) , tablet 3.61 ofloxacin + ornidazole ( 200mg and 500mg ) , tablet 3.62 ofloxacin 0.3% w / v of ofloxacin ph.eur. ( 5 ml vial ) , eye drop [ 110332 ] 3.63 ofloxacin suspension [ 4670003 ] 3.64 ofloxacin suspension 50mg / 5 ml ( 30 ml bottle ) , suspension [ 120224 ] 3.65 olanzapine 20mg tab [ 4710506 ] 3.66 olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , eye drop [ 110337 ] 3.67 omeprazole 40mg ( vial ) , injection [ 120231 ] 3.68 omeprazole ( 20mg ) , capsule [ 120230 ] 3.69 ondansetron 8mg inj [ 4340019 ] 3.7 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch ( ) , powder [ 4550004 ] 3.71 oxaliplatin ( 50mg inj 25 ml vial ) , injection [ 120239 ] 3.72 oxytocin ( 5 iu / ml ( 2ml amp ) ) , injection [ 4350048 ] 3.73 paclitaxel 260mg inj 43.4ml vial [ 4340016 ] 3.74 paclitaxel 300mg inj [ 4350372 ] 3.75 paclitaxel 30mg inj ( 30mg ) , injection solution for [ 4350305 ] 3.76 paclitaxel inj ( 100mg ) , injection 3.77 pantoprazole tab ( 40 mg ) , tablet 3.78 paraffin liquid ( liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33mg ) , syrup 3.79 pentaprazole inj. 40mg 10ml vial ( ) , injection solution for [ 4350418 ] 3.8 pantaprazole ( 40mg tab ) , tablet 3.81 phenytoin sodium inj. ( 100 mg ) , vial 3.82 phenytoin sodium oral suspension 25 mg / ml ( 100 ml bottle suspension ( loan licencing will be accepted for this item. ) ) , suspension 3.83 pilocarpine eye drops ( 4% ) , eye drop 3.84 pilocarpine hydrochloride eye drops bp 2% 3.85 pioglitazone ( 30 mg ) , tablet 3.86 piroxicam ( 20mg ) , tablet or capsule 3.87 pneumococcal ( polysaccharide ) vaccine 23 valent / 0.5ml inj 3.88 potassium chloride inj. ( 150 mg / 10ml ) , injection solution for 3.89 potassium chloride inj. 150mg / ml 3.9 povidone iodine ointment 5% 250gm jar ( ) , each 3.91 povidone iodine surgical scrub solution. 7.5% ( 500 ml bottle ) , solution 3.92 pralidoxime chloride injection i.p. 1gm ( 20 ml ) , injection 3.93 prazosin tab ( 5 mg ) , tablet 3.94 prednisolone ( 10 mg ( dt also acceptable ) ) , tablet 3.95 prednisolone ( 10 mg / ml ) , eye drop 3.96 premixed insulin biphasic analogue 25 / 75 in penfill 300iu permanent pen one pen per five cartidges and ten needles per pen 3.97 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens one pen per five cartridges and ten needles per pen 3.98 promethazine inj 25 mg / ml ( 10 ml vail ) ( 10 ml vail ) , injection solution 3.99 promethazine tab ( 25 mg ) , tablet 4 propofol sodium 1%w / v ( 10mg / ml ( 20ml vial ) ) , injection 4.01 propranolol tab ( 40 mg ) , tablet [ 4.02 protamine sulphate inj 10mg / ml 4.03 quinine sulphate 150mg / 5ml syrup 60 ml 4.04 quinine sulphate inj. ( 300mg / ml ) , injection solution for 4.05 rabies vaccine inj ( vero cell culture ) inj. intra dermal ( ) , vial 4.06 rabies vaccine ip human ( ( cell culture ) ) , injection solution 4.07 rabies vaccine ip human cell culture 2.5 iu / dose ( intra muscular use ) , vial 4.08 rabies vaccine ip human ( purified chick embryo cell culture ) ( ) , vaccine 4.09 rabies vaccine ip inj human ( chick embryo / vero cell culture ) intra muscular ( ) , injection solution 4.1 ramipril ( 5 mg ) , tablet 4.11 rectified spirit ( 90% ) solution 4.12 ringer lactate inj iv 500ml bfs bottle ( ) , injection solution 4.13 ringer lactate inj iv 500ml ffs / bfs bottle ( ) , injection solution f 4.14 rituximab ( 100mg ) , injection [ 120268 ] 4.15 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule 4.16 snake venom anti serum ip liquid form ( ) , injection 4.17 snake venom anti serum inj. ( ) , injection solution for 4.18 sodium chloride 0.9% injection ip 100ml bottle ( ) , injection powder for 4.19 sodium chloride 1 / 2 normal, hyper tonic and dextrose 5% inj 4.2 sodium chloride inj iv 0.9% 500ml ( glass bottle ) ( ) , injection solution 4.21 sodium chloride inj iv 500ml bfs bottle ( ) , injection solution 4.22 sodium chloride inj iv 500ml bottle ( ) , injection solution 4.23 sodium chloride n / 2 injection ip 500ml bfs bottle ( ) , bottle 4.24 sodium chloride n / 2 injection ip 500ml ffs / bfs bottle ( ) , injection solution 4.25 sodium hypochlorite 5% solution ( 5 ltr ) , solution 4.26 sodium valproate enteric coated tab. bp ( 200 mg ) , table 4.27 sodium valproate ( 200mg ) , tablet 4.28 soluble insulin 30% isophane insulin 70% 100 iu inj 4.29 spironolactone tab 100mg ( 10x10 ) , tablet 4.3 streptokinase inj ( ) , injection solution 4.31 streptomycin inj ( 0.75g ) , injection solution for 4.32 succinyl choline inj. 50mg / ml 1ml amp 4.33 sulfacetamide eye drops ( 20% ) , eye drops / ointment 4.34 sulfamethoxazole and trimethoprim ( 100 mg and 20mg ) , tablet 4.35 sulfamethoxazole 200mg and trimethoprim 40mg per 5ml suspension ( 50ml bottle ) , suspensio 4.36 sulphadoxine 500mg and pyrimethamine 25mg tab. 4.37 surfactant suspension ( for intratrcaheal ) natural surfactant inj ( 25 mg / ml ) , injection solution for 4.38 surfactant suspension ( intratrcaheal ) bovine 4ml amp natural inj ( ) , ampoule 4.39 surgical spirit bp 500 ml ( ) , bottle 4.4 syrup 100ml bottle. ( 5ml 100mg elemental fe iron & folic acid syrup ( as per the standards provided ) ( ) , syrup 4.41 tamoxifen ( 20mg ) , tablet 4.42 telmisatran ( 20 mg ) , tablet 4.43 temozolomide ( 100mg ) , capsule 4.44 temozolomide 20mg cap 4.45 temozolomide 250mg cap 4.46 terbutaline suplhate inj 4.47 terbutaline suplhate tab ( 2.5mg ) , tablet 4.48 tetanous vaccine adsorbed ip 5ml ( tetanus toxide inj ) 4.49 tetanus immunoglobulin usp / ip ( 500 iu / vial ) , vial 4.5 tetanus toxide inj 5ml ( ) , injection solution for 4.51 tetanus toxiod ( inj. ) , injection 4.52 tetracycline eye oint 1% 4.53 thyroxine sodium tab 100 mcg ( 100 tab bottle ) ( 100 tab ) , tablet 4.54 thyroxine sodium tab ( 50mcg ( 100 tab bottle ) ) , tablet 4.55 tinidazole ( 500mg ) , tablet 4.56 tobramycin ( 0.3% 5ml ) , eye drop 4.57 torsemide ( 10mg ) , tablet [ 4.58 torasemide tab ( 20mg ) , tablet 4.59 tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ( brand: oliclinomel n7 2000 ml ) 4.6 tramadol ( 100mg / ml ( 2 ml amp ) ) , injection 4.61 tramadol cap ip ( 50mg ) , capsule 4.62 tramadol ( 100mg ) , tablet 4.63 tranexamic acid inj. 125mg / ml amp 4.64 trastuzumab ( 440mg vial ) , injection 4.65 triamcinolone acetate 40mg / ml ( 1ml amp ) , injection 4.66 urograffin 76% solution for injection 20ml vial ( 20ml ) , injection solution for 4.67 urograffin 76% solution for injection 50ml vial bottle 4.68 urokinase ( 5 lac iu / vial inj ) , injection powder for 4.69 valethamate bromide 8mg / ml ( 1ml ) , injection 4.7 vancomycin hydrochloride ( 250mg vial ) , injection 4.71 verapamil sugar coated tab ip ( 40mg ) , tablet 4.72 vildagliptin tab ( 50 mg ) , tablet 4.73 vinblastine 10mg inj. 4.74 vincristine inj 1mg / ml 4.75 vitamin a cap usp soft gelatin capsule ( 1 lakh iu ) , capsule ] 4.76 vitamin a cap usp soft gelatin capsule ( 2 lakh iu ) , capsule 4.77 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab ( ) , tablet 4.78 vitamin k inj ( phytonadione inj ) 1mg / 0.5ml ( ) , injection solution for 4.79 vitamin k inj. 10 mg / ml ( 10 mg / ml ) , injection solution for 4.8 vitamin. b complex ( nfi ( prophylactic ) ) , tablet 4.81 vitamin b12 inj 500 mcg / ml ( 30 ml amp / vial ) , injection 4.82 voglibose dispersible 0.3mg tab 4.83 water for injection inj 10 ml amp 4.84 zinc sulphate syrup 20mg / 5ml ( 50 ml bottle ) , syrup ] 4.85 bcg diluent ( normal saline ) 1ml 4.86 bcg with vvm 10 doses 4.87 measles diluent ( sterile water ) 4.88 ad syringe ( 0.1 ml ) , vaccine 4.89 ad syringe ( 0.5 ml ) , vaccine 4.9 disposable syringe ( 5 ml ) , syrings 4.91 tt with vvm 10 doses [ 3790004 ] 4.92 absorbable gelatine sponge ( ip 80mm x 50mm x 10mm ) , consumable 4.93 absorbent cotton wool ip 500 grms ( each ) roll ( iso:13485:2016 ) , consumable 4.94 adhesive plasters usp 7.5 cm x 10 mts / roll 4.95 adhesive plasters usp ( 7.5 cm x 5 mts / roll ) , consumable 4.96 ascorbic acid ( vitamin c ) tab i.p. ( 500mg ) , tablet 4.97 b.b silk with 1 / 2 cir rb needle ( size:3 / 0 20 mm length 75 cm ) , consumable 4.98 b.b silk ( 12 foils / pkt ) ( 3 / 8 rcut needle 45 mm length 76 cm, size 2 / 0 ) ) , consumable 4.99 b.b. silk 6 reels x 25 mts ( size:3 / 0 length 25 mts ) , consumable 5 benzyl benzoate application i.p 25%w / w ( 100ml bottle ) , radiology 5.01 blood administrations set 5.02 ceftazidime injection i.p. ( 0.5gm / vial ) , injection 5.03 cholesterol kit end point enzymatic kit 50 test / kit 5.04 coated polyster braided with cd white d ( needle 25 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 ) , consumable 5.05 coated polyster with cd green needle 17 mm ( curved reverse cutting or curved round body or taper cut ) size:2 / 0 length 90cm 5.06 cpk mb kit ( kinetic ) ( 25 test / kit ) , consumable 5.07 disposable dust mask jl246c equivalent to n 95 mask 5.08 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 5.09 disposable needles ( is 10654:2002 22g ) , surgical material 5.1 disposable needles ( is 10654:2002 24g ) , surgical material 5.11 disposable needles ( is 10654:2002 26g x 1 / 2 ) , surgical material 5.12 disposable syringes is 10258:2002 ( with needle is 10654:2002 cgs 10cc ( in ribbon pack ) ) , surgical material 5.13 disposable syringes is 10258:2002 with needle is 10654:2002 ( cgs 2cc ( in ribbon pack ) ) , surgical material 5.14 disposable syringes is 10258 2002 with needle is 10654 2002 ( cgs 5cc in ribbon pack ) , surgical material 5.15 field stain a ( 500ml ) , digonstic 5.16 field stain b ( 500ml ) , consumable 5.17 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 5.18 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 5.19 foleys urinary catheter ( 3 way size 12 ) , surgical material 5.2 g6pd deficiency ( test kit 10 test ) , consumable 5.21 glass slide 75mm x 25mm 1.1 mm 5.22 hbs antigeng kit card ( pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab ) , digonstic 5.23 hemoglobin color scale ( starter kit ) components ( 1 ) color scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit [ 6120003 ] 5.24 infant feeding tube ( ( catheter ) size: 5g ) , consumable [ 6760003 ] 5.25 infant mucus extractor sterile pvc ( each ) , surgical material [ 6550018 ] 5.26 intravenous set with airway and needle ( ( adult ) ) , surgical material [ 6450089 ] 5.27 intravenous set with airway and needle ( children ) , surgical material [ 645090 ] 5.28 iv cannula ( two way ) ( size 20 ) , surgical material 5.29 iv cannula ( two way ) ( size 22 ) , surgical material 5.3 iv cannula size 24g with inj.valve ( port ) , surgical material 5.31 k wire length 375mm ( size:1.6mm roll ) , surgical material [ mis70 ] 5.32 k wire size:1mm 5.33 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card ( as per gio nvbdcp specification ) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab [ 6120089 ] 5.34 micro volume ( drip set ) , digonstic 5.35 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 30mm length 70 cm non absorbable ( surgical sutures usp size 1 ) , digonstic [ 6450117 ] 5.36 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 30 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.37 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 2 / 0 ( 12 foils / pkt ) , surgical material 5.38 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 13.5 ltr 5.39 pregnancy detection kit ce marked / isi marked 5.4 pregnancy detection kit ce marked / isi marked 30 test / kit ] 5.41 pyrethrum extract 2% ( 25 litre drum ) ( as per specification attached in tender ) , chemical 5.42 reuse prevention syringe sterile single use reuse prevention syringewith detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( 2ml ) , surgical material 5.43 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 type i and type b, flow wrap / blister package using medical grade breathable paper, eto sterilized, non latex stopper ( preferred material thermoplastic elastomer ) ( 5ml ) , surgical material 5.44 disposable spinal ( l.p. ) needle ( 25g ) , surgical material 5.45 stainless steel wire 28g 5.46 stainless steel wire 30g 5.47 surgical blade, size 11 5.48 synthetic absorbable suture 1 with 1 / 2 circle taper cut needle ( h ) size :1 40mm length 90cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( 12 foils per pkt ) , surgical material 5.49 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 40mm length 90cm polyglycolic acid ( pga ) [ 6450024 ] synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0 20mm length 70cm polyglycolic acid ( pga ) [ 6450017 ] 5.51 synthetic absorbable suture 3 / 0 with 1 / 2 cir rb needle size:3 / 0, 40mm length 90cm polyglycolic acid ( pga ) 5.52 synthetic absorbable suture 4 / 0 with 3 / 8 cir cutting needle size:4 / 0 16mm length 45 cm polyglycolic acid ( pga ) 5.53 three layer surgical mask 5.54 urinary drainage bag 2 litre cap with non return valve ( eo sterile ) 5.55 wbc diluting fluid ( 500 ml bottle ) , consumable [ mis144 ] 5.56 x ray film 10 x 12 50 sheets / pack 5.57 x ray film 12 x 12 50 sheets / pack 5.58 x ray film 14 x 14 50 sheets / pack 5.59 x ray film 14 x 17 50 sheets / pack x ray film 6.5 x 8.5 50 sheets / pack 5.61 x ray film 8 x 10 50 sheets / pack 5.62 ceftazidime inj ( 500mg / vial ) , injection 5.63 disposable sterile gloves isi marked surgical rubber hypoallergenic latex 100% powder free 7 1 / 2 inc 5.64 disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiatio eto is no:13422:1992 as amended upto , 7inch / pair ( pair ) , consumable 5.65 ventilator adult model new port e 360 [ 360 ] 5.66 k wire length 375mm ( size:1.8mm roll ) , surgical material [ mis71 ] 5.67 poly propylene mono filament sterile precut with 1 / 2 cir rb needle 25 mm length 70 cm non absorbable surgical sutures usp size 3 / 0 5.68 poly propylene mono filament sterile precut with 1 / 2 cir rb ( needle 40 mm length 70 cm non absorbable surgical sutures usp size 1 / 0 ) , surgical material 5.69 powder developer suitable for processing medical xray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 9.0 ltr [ 6521029 ] 5.7 tetanus toxoid ( adsorbed ) ip ( 5ml vial ) , injection 5.71 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 7 inches 5.72 x ray film 12 x 15 50 sheets / pack 5.73 foldable iol sterile lens + 18d ( usfda approved, as per specification ) ( each ) , consumable 5.74 foleys urinary catheter 3 way size 18 5.75 foleys urinary catheter 3 way size 20 5.76 foldable iol sterile lens + 18.5 d ( usfda approved, as per specification ) ( each ) , consumable 5.77 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 5.78 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 5.79 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) 5.8 reuse prevention syringe sterile with detachable needles complaint to iso ( 7886:4 typei and typeb 3ml ) , consumable 5.81 foldable iol sterile lens + 19d ( usfda approved, as per specification ) ( each ) , consumable 5.82 foldable iol sterile lens + 19.5d ( usfda approved, as per specification ) ( each ) , consumable 5.83 foldable iol sterile lens + 20d ( usfda approved, as per specification ) ( each ) , consumable 5.84 foldable iol sterile lens + 20.5d ( usfda approved, as per specification ) ( each ) , consumable 5.85 foldable iol sterile lens + 21d ( usfda approved, as per specification ) ( each ) , consumable 5.86 foldable iol sterile lens + 21.5d ( usfda approved, as per specification ) ( each ) , consumable 5.87 foldable iol sterile lens + 22d ( usfda approved, as per specification ) ( each ) , consumable 5.88 foldable iol sterile lens + 22.5d ( usfda approved, as per specification ) ( each ) , consumable 5.89 micro pipet 1000 fix and variable each 5.9 baby oxygen mask set of all sizes 5.91 catgut chromic size:2 / 0 length 150 cm 5.92 disposable syringes is 10258:2002 with ( needle is 10654:2002 20ml ) , consumable 5.93 endotracheal tube internal dia 5.5mm to 9.5mm 5.94 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 5.95 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine 5.96 sgot kit ( kinetic ) 5x20ml 200 test / kit 5.97 aciclovir 3% ( 5gm tube ) , ointment 5.98 acyclovir suspension 400mg / 5ml ( 100 ml bottle ) , suspension 5.99 aciclovir tab 400 mg ( 400 mg dt tablet also acceptable ) , tablet 6 amino infusions ( 200ml bottle ) , infusion 6.01 amitriptyline tab. ip ( 25 mg ) , tablet 6.02 ampicilline + cloxacilline injection ( 250 mg + 250 mg ) vial injection 5ml vial ( ) , injection 6.03 anti rabies immunoglobulin ( inj.150 iu per 2 ml vial ) , injection 6.04 ascorbic acid ( vitamin c ) tab. 500 mg. 6.05 atracurium besylate ( 10mg / ml inj amp ) , injection 6.06 botropase injection ( ( haemocoagulase 1cu ) 1ml ) , injection 6.07 oseltamivir h1 n1 antiviral cap 75 mg 6.08 clonidine injection, 10ml vial ( 1mg ) ( 10ml vial ) , injection 6.09 cyclophosphamide 50 mg tab 6.1 diphenhydramine syrup 12.5mg / ml 6.11 disposable cap 6.12 disposable ( needles 23g ) , consumable 6.13 disposable pricking lancet ( pkt of 200 units ) ( packet ) , consumable 6.14 enalapril maleate inj. ( 1.25 mg per ml ) , injection 6.15 ethamsylate inj ( 250mg ( 2ml amp ) ) , injection 6.16 ethamsylate tab ( 500mg ) , tablet 6.17 fluconazole iv ( 2mg / ml ( 100ml bottle ) ) , infusion 6.18 foleys urinary catheter size 16 2 way 6.19 foleys catheter size 18 2 way 6.2 glucose kit ( god / pod ) ( 350ml, digonstic ) , consumable [ mis60 ] 6.21 hcv kit card test ( 25 test / kit ) , digonstic 6.22 hydrocortisone sodium succinate inj. 200mg vial ( ) , injection 6.23 iv cannula size with inj.valve ( port ) ( 18g ) , consumable 6.24 ketamine hydrochloride inj. 50mg / ml ( 2 ml amp ) 6.25 meropenem inj 125mg / vial ( each ) , injection [ 6.26 inj.iv dns ( ) , injection 6.27 multivitamine 200ml syrup ( 200ml ) , syrup 6.28 n acetyl cysteine inj 200mg / ml in 10ml amp 6.29 nimesulide ( 100 mg ( dispersiable tablet also accepted ) ) , tablet 6.3 norfloxacine 400mg and tinidazole 600mg ( tab ) , tablet 6.31 oxygen inhelation mddial oxygen steel aluminium cylinder 10 ltr ( ) , consumable 6.32 oxygen nasal cannula ( neonatal ) , consumable 6.33 paracetamol drop ( 100 mg / ml ) , drop 6.34 paracetamol drop 10mg / ml 6.35 phenobarbitone syp 200mg / 5ml ( ) , syrup 6.36 povidone iodine cream 250 gm 6.37 salbutamol ( 2mg / 5ml ( 100ml bottle ) ) , syrup 6.38 salicylic acid ointment ( 6% ) , ointment 6.39 salt testing kit ( as per attached specification , kit ) , consumable 6.4 mesalamine ( 5 aminosalicylic acid 400 mg ) tab 6.41 thiopentone injection 1gm 6.42 tobramycin + dexamethasone ( 0.3%w / v + 0.1%w / v ( 5ml vial ) ) , eye drop 6.43 torasemide inj 100mg ( 2ml vial / amp ) , injection 6.44 umblical cotton tape length 75cm. 6.45 verapamil 80mg ( tablet ) , tablet 6.46 foldable iol sterile lens +18d ( each ) , lens 6.47 microsurgery speciality gloves ( size 6.5 ) , lens 6.48 alchohol repellent and anti static sms fabric csection drape with 16in x 14in adhesive full incise, 270 degrees pe film fluid collection pouch with malleable band and suction port and sms arm board covers and tube holders 120in x 100in 50gsm 6.49 alchohol repellent and anti static sms fabric drape with absorbent material. fluid collection pouch with malleable band and suction port, having filter screen for sample collection and graduated markings on pouch 40 in x 44 in 50gsm 6.5 silver impregnated peripherally inserted central catheter 4 fr with integrated hub 6.51 non foldable iol sterile lens pc + 18.5 ( each ) , lens 6.52 non foldable iol sterile lens pc + 19 ( each ) , lens 6.53 non foldable iol sterile lens ( pc + 20.5 ) , lens 6.54 non foldable iol sterile lens pc + 20 6.55 non foldable iol sterile lens pc + 21.5 6.56 non foldable iol sterile lens pc + 21 ( each ) , lens 6.57 non foldable iol sterile lens pc + 22 ( each ) , lens 6.58 non foldable iol sterile lens pc + 23 6.59 non foldable iol sterile lens pc + 24 6.6 non foldable iol sterile lens ac + 20 6.61 non foldable iol sterile lens ac + 18 6.62 gefitinib tab 250mg 6.63 pancreatin 170 mg+oxbile extract 50 mg+ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) , tablet 6.64 paclitaxel 260mg inj ( 260mg ) , injection 6.65 filgrastim 300 mcg ( prefilled syrings ) , vial 6.66 dacarbazine inj. ( dtic ) ( 500 mg vial ) , injection 6.67 5 fluorouracil ( 5 fu ) ( 500mg inj ) , injection 6.68 paclitaxel protein bound particles inj 6.69 tamsulosin 4mg tab 6.7 nilotinib ( 200mg ) , tablet or capsule 6.71 nilotinib ( 150mg ) , tablet or capsule 6.72 oxytocin 10 iu / ml ( 1ml ampoule ) , injection 6.73 foleys urinary catheter 3 way size 16 6.74 chymotrypsin and trypsin 100000 iu tab 6.75 l ornithine +l aspartate 5mg inj ( 5mg ) , injection 6.76 quinine sulphate ( ip 600mg ) , tablet 6.77 personal protection kit ( kit ) , consumable 6.78 oseltamivir ( 45mg ) , capsule 6.79 oseltamivir h1 n1 antiviral cap 30 mg 6.8 chromic with st rb needle ( 12 foils / pkt ) ( 60 mm length 76 cm size:2 / 0 ) , consumable 6.81 dextrose 5% inj 500ml ffs / bfs bottle ( 500ml ) , bottle 6.82 acyclovir intervenous infusion i.p ( 500mg / vial ) , injection 6.83 propofol sodium ( 1% w / v 10mg / ml, 10ml vial ) , injection 6.84 digital x ray film 8x10 ( 150 films / pkt ) 6.85 digital x ray film 10x12 ( 150 films / pkt ) 6.86 digital x ray film 11x14 ( 150 films / pkt ) ( 11x14 ( 150 films / pkt ) ) , film 6.87 ecg paper ( chemical coated ) 50mm x 30 mtr. roll 6.88 plaster of paris bandage 15cm x 2.7mtr / roll ( roll ) , bandage ] 6.89 plaster of paris bandage bp 10 cm x 2.7 mtr / roll 6.9 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings 6.91 ecg jelly 250 gms ( bottle ) , jelly 6.92 ecg paper ( wax coated ) 50mm x 30 mtr, roll 6.93 nebulization mask kit ( adult ) , mask 6.94 oxygen mask adult ( standard size ) , mask 6.95 oxygen mask paediatric ( standard size ) , mask 6.96 ecg paper ( wax coated ) heavy quality 50mm x 30 mtr / roll 6.97 mackintosh double colour water proof rubber marked isi hospital rubber sheeting is:4135 1974 packing and making : as per clause no 4.1 and 4.3 / mtr 6.98 instrument sterilant 10 minute sporicidal sterilant aldehyde free containing sodium perborate ( ( 810 grm packet ) ) , powder 6.99 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( ( 5kg packet ) ) , powder 7 b.b silk with 1 / 2 cir rb needle 20 mm length at least 75 cm non absorbable surgical suture usp size 3 0, ( 12foils / pkt ) , needle 7.01 black braided silk with 1 / 2 cir rb needle 30 mm length 75 cm 2 / 0 12 foils / pkt 7.02 black braided silk with 1 / 2 cir rb needle 20 mm length 75 cm 1 / 0 13 foils / pkt 7.03 black braided silk with 1 / 2 cir cd cutting needle 16 mm length 75 cm 3 / 0 ( 14 foils / pkt ) 7.04 disposable needles ( 26g x 1 / 2 ) , consumable 7.05 halothane ( 200ml ) , bottle 7.06 erythromycin ( as estolate ) powder for susp ( 125 mg / 5ml 40ml bottle ) , consumable 7.07 potassium chloride oral solution 500mg / 10ml 7.08 cefixime syrup 50mg / 5ml ( 30 ml bottle ) , syrup 7.09 ferric ammonium citrate 200mg, folic acid 0.5mg ( bottle ) , syrup 7.1 multivitamin 10ml ( amp inj ) , injection 7.11 vecuronium bromide inj 4mg / ml amp ( 4mg / ml amp ) , solution [ 987609 ] 7.12 iron sucrose ( 20 mg ) , injection 7.13 clofazimine ( 50 mg ) , capsule 7.14 b complex minerals with zinc ( capsule ) , capsule 7.15 antioxident ( cap ) , capsule 7.16 vaseline white / yellow ( 1 / 2 kg ) , consumable 7.17 silver sulphadiazine cream 500gm 7.18 hydroxypropyl methylcellulose ophthalmic solution 2% ( 5ml vial ) , consumable 7.19 atracurium besylate usp inj injection 7.2 diphenhydramine inj 50mg / ml ( 50mg / ml ) , injection 7.21 dextran 70 injectable sol inj 500ml ( solution ) 7.22 hydrocortisone sodium succinate inj. 200 mg / vial ( 200 mg / via ) , injection 7.23 ofloxacin inj 2mg / 1ml ( 100ml ) , injection 7.24 meropenam 500mg inj 7.25 inj. meropenam 125mg ( 125mg ) , injection 7.26 meropenem ( 1gm ) , injection 7.27 phenobarbitone inj. 100 mg / ml 7.28 inj. heamocoagulase 1cu 1ml 7.29 diclofenac sodium injection, 3ml ( ) , injection 7.3 inj. b complex 30ml 7.31 inj. l ornithine l aspartate ( 10ml ) , injection 7.32 inj. diclofenac 30ml 7.33 drop iron ( 15ml ) , consumable 7.34 neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment ( 15gm tube ) ) , tube 7.35 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol ( 0.025% + 1% + 0.5% + 0.1% w / w ( 5gm tube ) ) , ointment or cream 7.36 diclofenac + menthol ( 30gm ) , tube 7.37 oint. gentamycin sulphate ( 15gm ) , ointment 7.38 nimesulide oint gel 20gm 7.39 heparin and benzyl nicotinate 20mg oint. 7.4 oxygen inhelation ( oxygen ip medical oxygen in steel or aluminium, cylinder ( 10 litres water cap ) ( 10 liters ) , consumable 7.41 powder protien +vitamins +corbohydrates & minerals 200gm ( 200gm ) , consumable 7.42 calcium syp 100ml syrup ( 240mg / 5 ml ) 7.43 multivitamin 200ml syrup 7.44 cetirizine ( 5mg / 5ml ( 60 ml bottle ) ) , syrup 7.45 magnesium hdroxide+aluminium hydroxide ( 625mg+312mg / 5ml ) [ 987646 ] 7.46 dicyclomine syrup [ 987647 ] 7.47 vitamin b complex nfi formula ( 100ml bottle ) , syrup 7.48 syp. ferric ammonium citrate 200mg +folic acid 0.5mg+vitamin b 125mcg+zinc 5ml syrup 7.49 antacid mint flavour ( 170ml ) , syrup 7.5 drop paracetamol 100mg / 15ml 7.51 norfloxacin + tinidazole ( ( 100 mg + 100 mg ) / 5 ml 30ml syrup ) , syrup 7.52 norfloxacin +metronidazole 30ml syrup 7.53 ibuprofen 10mg+paracetamol 125mg syrup 7.54 ampicilline 125mg / 30ml syrup 7.55 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup ( 60 ml bottle ) , syrup 7.56 syp. cefodroxil 125mg / 30ml syrup 7.57 vitamin b complex nfi formula ( 200ml bottle ) , syrup 7.58 cyproheptadine hcl + tricholine citrate ( 2mg + 275 mg / 5 ml ( 200ml bottle ) ) , syrup 7.59 syp. cetirizine 5mg / 5ml 30ml syrup ( syp. cetirizine 5mg / 5ml 30ml syrup ) , syrup 7.6 calcium gluconate syrup ( 200ml ) , syrup 7.61 amoxicillin dispersible ( 125 mg ) , tablet 7.62 dicyclomine 20mg tab 7.63 clonidine tablet ( 100 mcg ) , tablet 7.64 diphenhydramine ( 25mg ) , capsule 7.65 dexamethasone ( 4 mg ) , tablet 7.66 vitamin c tab 500 mg tablet 7.67 mesalamine ( 5 aminosalicylic acid ) ( usp 400mg ) , tablet 7.68 isoxsuprine tablets i.p. 20 mg tablet 7.69 anticold ( paracetamol 300mg+cetirizine hcl 5mg tablet 7.7 pentoprazole 40mg, domperidone 10mg tab tablet 7.71 pentoprozole 40mg +domperidone 10mg tab 7.72 calcium citrate 500mg with vitamin d3 200mcg tablet 7.73 norfloxacine 400mg and tinidazole 600mg tab 7.74 losartan 50mg +hydroclorothiazide 12.5mg tablet 7.75 ethamsylate tablet ( 250mg ) , tablet 7.76 diclofenac 50mg +paracetamol 325mg+chlorzoxazone 500mg ( tab ) , tablet 7.77 ofloxacin 200mg +tinidazole 600mg ( tab ) , tablet 7.78 azythromycin 1 gm + fluconazole 150 mg, + secnidazole 2 g, tablet c tablet 7.79 amlodipine 5mg+atenolol ( 50mg ) , tablet 7.8 iron & folic acid entric coated 100mg, of elemental iron ( adult ) +fa 1.5mg tab. 7.81 aceclofenac 100mg+paracetamol 500mg tab 7.82 dicyclomine 20mg+paracetamol 325mg tab 7.83 norfloxacin + tinidazole 400mg tab 7.84 norfloxacin +tinidazole 400mg tab 7.85 roxithromycin 150mg tablet 7.86 domperidone +ranitidine 150mg tab 7.87 povidone iodine cream 250gm 7.88 amoxycillin and potassium clavulanate i.p. ( 1 gm + 0.2 gm / 10 ml vial ) , injection 7.89 dexamethasone + gentamycin eye drop 0.1%+0.3% 7.9 prostaglandin e2 gel 0.5mg ( 3gm tube ) , tube 7.91 who hemoglobin color scale ( starter kit ) components ( 1 ) colour scale 01 / kit ( 2 ) test strip 1000 / kit ( 3 ) printed literature for method of use / kit ( 4 ) lancet 1000 / kit 10x100 ( nabl / cap accrediated lab test certificate for the batch no. must be enclosed with each supply delivered ) , consumable [ mis145 ] 7.92 strip for albumin urine and suger 7.93 glass slide 75mm x 25mm 1.35 mm 7.94 cover slip 18 x 18 mm 10gm 7.95 variable auto pippets 10 to 100 micro litres ( 10, 25, 50, 100 ) each 7.96 tips for auto pippetes 10 to 100 micro litres 7.97 glucometer strip ( 1x50 ) , consumable 7.98 urea kit berthelot ( 100 test / kit ) , consumable 7.99 acetone detection kit ( 100 gm ) , powder 8 crp test kit ( latex / card ) ( 25 test / kit ) 8.01 cyanemeth solution for hb ( 5 litre ) , consumable 8.02 leishman stain ( 500 ml bottle ) , consumable 8.03 hcl n / 10 ( 500 ml bottle ) 8.04 semen dilution fluid ( 100 ml bottle ) , consumable 8.05 gram iodine ( gram stain ) 125 ml 8.06 sodium citrate 3.8% ( 500 ml bottle ) , consumable 8.07 edta solutions k3 ( 500 ml ) 8.08 disposable cup for urine sputum 30ml 80 to 90 mm diameter 100 / pkt 8.09 disposable pricking lancet 100 units consumable 8.1 paper adhesive plaster 1 x 9.0mts 8.11 barium chloride 10% ( 500 ml bottle ) , consumable 8.12 sulfur powder 8.13 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup ( 10 ml ) , syrup 8.14 alkaline citrate with k oral solution ( 100ml ) , syrup 8.15 total protein lysozyme 1x50 ml 8.16 b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical sutures usp , 2 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical 8.17 b.b. silk 6 reels x 25 mts size:1 / 0 ( 6 reels is per box rate should be quoted for 6 reels ) , surgical material 8.18 bandage than ( 1mtrx20mtr ) , consumable 8.19 rolled bandage 15cm � 5 m 8.2 rolled bandage 10cm � 5m 8.21 rolled bandage 7.5cm � 5m 8.22 bandage clothes 01m � 20m consumable 8.23 cotton crape bandage 15cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.24 cotton crape bandage 10cm x 4m ( box of 10 bandages ) ( no. ) , consumable 8.25 rolled bandage 5cm � 5m 8.26 iv cannula ( two way ) ( size 24 ) , consumable 8.27 keratome 3.2 keratome round stock 3.2mm full handle knives e.t.o. sterile angled bevel up 45 deg ( ) , consumable 8.28 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 8.29 hiv 1&2 test cards 8.3 urine albumin & suger 8.31 dengue card test 100 test kit 8.32 typhoid test card ( an immunochromatography assay for the rapid visual detection of typhoid antibody igg / igm in human serum / plasma ) ( 50 test per pack ) , consumable 8.33 hiv kit 100 test / kit 8.34 sodium hypo chloride 5 lit jar 8.35 disposable paper gloves size 7 inches consumable 8.36 disposable paper gloves size 7, 1 / 2 inches consumable 8.37 usg thermal paper 8.38 orthopaedic speciality gloves ( size 7 ) , consumable 8.39 disposable appron consumable 8.4 cannula fixer ( set ) , consumable [ 987748 ] 8.41 cotton delivery belt 8.42 gauze swab / pad 6 layer 20 � 20 8.43 disposable sterile gloves size 6 inches consumable 8.44 disposable sterile gloves size 61 / 2 inches consumable 8.45 disposable sterile gloves size 7, 1 / 2 inches consumable 8.46 c.p.d.blood bag 350 ml consumable 8.47 fixer powder ( bromex acid fixer with hardner ) ( 22.5 ltr / pkt ) 8.48 bilirubin kit ( colorimeter semi auto ) ( 4x60 ml 480 test / kit ) , consumable 8.49 cholesterol kit end point enzymatic kit ( 5x20ml 200 test / kit ) , consumable 8.5 hdl kit ppt ( 2x50ml 200 test / kit ) , consumable 8.51 triglyceride kit enzymetic ( 5x20ml 200test / kit ) , consumable 8.52 creatinine calorimeter for semi auto kinetic 4x60ml 480test / kit 8.53 alkaline phosphatase kit ( kinetic ) 10x2.2ml 44 test / kit consumable 8.54 ra factor 50 test kit qualicative 8.55 chromic with cd.rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 ) , surgical material 8.56 chromic with 1 / 2 cir rb needle 30 mm length 76cm, 2 0 usp, absorbable surgical suture surgical material ( 12 foils / box ) , surgical material 8.57 chromic with 1 / 2 cir rb needle 20 mm length 76 cm, 3 0 usp, absorbable surgical suture surgical material 12foils / box 8.58 chromic with 1 / 2 cir rb needle size:1 / 0, 30 mm length 76cm absorbable surgical suture surgical material 8.59 chromic with 1 / 2 cir rb needle 40 mm length 76 cm ( with needle ) ) absorbable surgical sutures usp, ( size 1, 12 foils / pkt ) , surgical material 8.6 chromic with cd rb needle 30 mm length 76 cm size:2 / 0 ( absorbable surgical suture surgical usp, 12 foils / boxmaterial ) , surgical material 8.61 chromic with cd cutting needle 12 mm length 70cm size:3 / 0 8.62 chromic catgut ( 12 foils / pkt ) ( size:1 / 0 length at least 150 cm ) , consumable 8.63 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 8.64 b.b silk with 1 / 2 cir rb needle size:2 / 0 30 mm length 75 cm surgical material 8.65 poly propylene with 1 / 2 cir rb needle 16 mm length 70 cm size:4 / 0 ( 12 foils / pkt ) , consumable 8.66 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm non absorbable surgical sutures usp size 2 / 0 ( size:2 / 0 ( 12 foils / pkt ) ) , consumable 8.67 disposable needles ( 22g consumable ) , consumable 8.68 polyamide with cd r cut extra penetrating needle ( 12 foils / pkt ) ( size 4 / 0 ) , consumable 8.69 needle hypodermic0insulin ( metallic non0sterile ) 8.7 suture needles curved 1 / 2 circle round bodyassorted size 1 5 8.71 suture needles curved 1 / 2 circle round bodyassorted size 11 15 8.72 suture needles curved 1 / 2 circle round bodyassorted size 16 20 8.73 spinal ( l.p. ) needle disposable ( 24g ) , consumable 8.74 spinal ( l.p. ) needle disposable 26g consumable 8.75 chromic catgut , round body needle no. 1.0 8.76 needle hypodermic size is ( 10654:2002 24g ) , consumable 8.77 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 1 consumable 8.78 bleaching power gr ii ( 25kg ) bags consumable 8.79 bleaching powder gr ii is 1065 / 1989 with upto date amendment packed in 25 kg hdpe bags isi marked stable consumable 8.8 disposable suction catheter assorted covering ( all sizes 10, 12, 14, 16, 18 ) , consumable 8.81 foleys urinary catheter silkolatex 2 way sterile, non toxic size 10 8.82 ecg paper computerizesd triple channel 20m 8.83 infant feeding tube size: 6g 8.84 b.b silk with 1 / 2 cir rb needle size:1 / 0 20 mm length 75 cm non absorbable surgical sutures usp surgical material [ 987794 ] 8.85 gauze swab / pad 6 layer 10 � 10 8.86 endotracheal tube internal dia 2.5 mm to 5 mm 8.87 complete delivery kit 1plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) .disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) .face mask 2 free size, ( 4 ) .plastic disposable cap ( non woven plastic laminated, leak proof ) ( 1pair, ( 5 ) .long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) , ( 6 ) disposable shoe covers, till calf ( plastic ) 2pair ( free size ) as per attached specification ) , consumable 8.88 malaria card ( antigen ) atleast 100 microbes / desi ltr. for both species 8.89 seman diluting fluid 100 ml. 8.9 n / 10 hcl 500ml 8.91 widal 2x2 sera slide kit 8.92 syphalis card igg+igm s / s above 99.5 % syrup 8.93 edta k3 vial each 8.94 crp latex slide per test 8.95 urine culture pot 30 ml. 8.96 rapid ra 25 test 8.97 cell pack, reagent pack for cell counter ( ( erma and mindrug ) complete set ) , consumable 8.98 capillary tube ( 100 pieces ) , consumable 8.99 crp kit 1x100 biolab qualitative ) 9 vdrl ( rpr ) 1x100 strip 9.01 widal 4x5 ml 9.02 anti abd grouping serum 3x10ml consumable 9.03 sgpt kit lyphozyme 5x20 ml 9.04 urea uv gloh 5x20ml 9.05 urea ( brethelot ) 3x100ml lyphozyme 2x10ml 9.06 creatinin kit 9.07 uric acid biosystem 9.08 sugar albumin strip 9.09 test tube 15x125 9.1 disposable syringes ( with needle cgs 2cc ) , consumable 9.11 disposable syringes ( with needle cgs 5cc ) , consumable 9.12 disposable syringes with needle ( cgs 10cc ) , consumable 9.13 insulin syringe ( 40 units / ml iso 8537:2007 ) , consumable 9.14 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 3ml ) , consumable 9.15 disposable syringe with needle cgs 1cc with mark 0 1ml consumable ( ) , consumable 9.16 malaria pf / pv rapid test 9.17 malaria pf / pv antigen card 9.18 ryles tube ( pvc ) size ( children: 10 ) , consumable 9.19 ryles tube ( pvc ) size : adult: 16 ( each ) , consumable 9.2 infant feeding tube ( catheter ) size: 8g ( each ) , consumable 9.21 edta vail 9.22 edta vial with safty cap ( 2ml. ) capsule 9.23 plain vial with screw cap ( 12 x 75 ) , consumable 9.24 bed sheet white 60 x 90 consumable 9.25 basta cloth 44 x 44 ( 44x44 ) , consumable 9.26 draw sheet bleach 45 x 45 9.27 instrument wash 500ml with spray pump 9.28 liquid hand wash solution with dispenser consumable ( 500 ml ) , consumable 9.29 surgical blade isi marked, size 15 ( 100 per packet ) , surgical material 9.3 surgical blade isi marked, size 23 ( 100 / pkt ) , surgical material 9.31 suture mersilk 8 0 ( 12 foil ) [ 987841 ] 9.32 paper adhesive plaster 1 / 2 x 9.0mts 9.33 inj. primacort hydrocotisone ( 200 mg ) , injection 9.34 iv dextrose 40% 9.35 absorbent cotton roll 100 gm each consumable 9.36 acetic acid solution ( 3% 100 ml bottle ) , consumable 9.37 acetone solution ( 100 ml ) , bottle 9.38 antacid syrup , 170 ml ( dried alluminium hydroxide gel 200 mg, simethicon ( 25 mg / 5 ml ) , syrup 9.39 azithromycin + fluconazole +secnidazole ( 1 gm+150 mg+ 1 gm, tablet combipack ) , tablet 9.4 bandage cloth bleach consumable 9.41 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate ( 0.025 % + 0.5 % + 2 % ( 5 gm tube ) ) , ointment 9.42 buppivacaine 5 mg, dextrose80 mg / ml ( 4 ml inj injection ) , injection 9.43 calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml ( 100 ml syrup ) , syrup 9.44 cefixime 50 mg / 5ml, 30 ml, drop ( 30 ml ) , drop ] 9.45 chair cushion box type 18x18 9.46 neonatal hyperthermia prevention double layer pe bag with hood and velcro protection 9.47 chloramphenicol 0.5% ( 5ml ) , eye drop 9.48 chlorhexidine 0.5 % propanol 70 %, 100 ml hand rub ( 100 ml ) , consumable 9.49 chlorhexidine acetate 0.5 %, medicated gauze 9.5 chlorquine phosphate 64.5 mg / ml, 5 ml inj ( 5 ml ) , injection 9.51 cold cough drop , 15 ml ( phenyl ephrine 5 mg, chlorphenaramine 0.5 mg, paracetamol 125 mg / 5 ml ) , consumable 9.52 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 9.53 dengue duo serum plasma 10 test / kit ( sd ) 9.54 dexamethasone sodium ( 0.5 mg ) , tablet 9.55 dextrose 25 %, 25 ml inj 9.56 dextrose 50 %, ( 25 ml ) inj ( 50 % ) , injection 9.57 digestive drop ( digestive enzyme and multivitamin with l lysine ) ( 15 ml ) , drop 9.58 digital x ray film size 14 x 17 ( ( 100 sheet per packet ) ) , film 9.59 kellys pad disposable 9.6 dusting powder, 10 gm ( neomycin sulphate 5 mg, baccitracin 250 unit, sulphacetamide sodium 60 mg ) 9.61 enema 100 ml ( sodium acid phosphate 10 gm, sodium phosphate 8 gm / 100 ml ) 9.62 foleys urinary catheter 3 way size 22 9.63 frusemide 20mg + spironolactone 50mg ( tablet ) , tablet 9.64 g 6pd kinetic per ml 9.65 gauze clothes 90cmx20m 9.66 gauze swab / pad ( 4 layer 20x40 ) , consumable 9.67 gentian violet ( gram stain ) 100ml bottle 9.68 glass test tube 5 without edge 9.69 haemoccel ( electrolight na, k, ca, cl ) ( 500 ml inj ) , injection ] 9.7 haemocoagulase 1 nih unit / ml, 1 ml inj 9.71 hdl kit 50 test 9.72 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 9.73 hematology cell counter reagents dilutent ( 20 ltr ) 9.74 hematology cell counter reagents rinse solution ( 20 ltr ) 9.75 heparin sodium benzyl nicotinate oint 9.76 hiv 1+2 ( rapid ) per card j mitra 9.77 inj. sigmacrome ( obrochrome ) 10ml 9.78 iron syrup 200 ml ( elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg / 5 ml ) , consumable 9.79 iv cannula size 26g ( ) , consumabl 9.8 labetalol 5 mg / ml, 2 ml inj ( 2 ml ) , injection 9.81 losartan potassium, hydrochlorthiazide ( 50 mg + 12.5 mg ) , tablet 9.82 medigard hand scrub 9.83 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) , capsule 9.84 metresses 3x6 with raxine cover 4 density 9.85 miconazole nitrate 2 % w / w 15 gm, oint 9.86 micropiptte 100 1000 9.87 ofloxacin + dexamethasone 10 ml eye drop ( 10 ml ) , drop 9.88 pantoprazole 40 mg, domperidone 10 mg ( tab ) , tablet 9.89 paracetamol 100 mg / ml, 150 ml drop ( 150 ml ) , consumable 9.9 paracetamol 75 mg / ml ( 10 ml inj ) , injection 9.91 phenobarbitine ( 20 mg / ml, 60 ml syrup ) , syrup 9.92 poly propylene mesh ( 7.5cmx15cm ) , consumable 9.93 sgpt test kit reagent 9.94 strip for malaria antigen, p vivex, p falciparum ( 50 tests ) 9.95 synethetic absorbable suture 1 / 0 with 1 / 2 cir rb needle size: 1 / 0 length 90cm 9.96 telmisartan, hydrochlorthiazide ( 40 mg + 12.5 mg ) , tablet 9.97 tuberculin diluted ppd 5 tu / 0.1 ml ( 5 ml ) , solution 9.98 uri stix 100 test 9.99 vitamin b complex syp 200 ml 10 white petrollium jelly 500 gm 10.01 widal 2x2 tube test kit 10.02 b.b silk with 1 / 2 cir rb / cutting needle 30 mm length 75 cm non absorbable ( size 2 0, 12 foils / pkt ) , consumable 10.03 collagen sheets 10 x 10 cm sheet 10.04 foleys catheter size 14 3 way 10.05 foleys catheter size 14 2 way 10.06 ryles tube ( pvc ) size : adult ( 18, each ) , tube 10.07 ryles tube ( pvc ) size ( children : 12 ) , tube 10.08 disposable suction catheter ( size 14 ) , consumable 10.09 disposable suction catheter ( size 12 ) , consumable 10.1 disposable scalp vein set ( size 20 no ) , consumable 10.11 disposable scalp vein set size 22 no ( each ) , consumable 10.12 paediatric drip set ( set ) , digonstic 10.13 measure volume ( drip set ) , each 10.14 cvp line complete set 10.15 triple lumen jugular catheter 12 x 16 10.16 oseltamivir h1 n1 antiviral syp 75 mg 10.17 swine flu vaccine ( vaccine ) , vaccine 10.18 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll ( 1 inch * 9 m / roll ( iso 13485:2016 ) ) , consumable 10.19 paper adhesive plaster microporous surgical tape ( 4 inch x 9 m / roll ( iso 13485:2016 ) ) , consumable 10.2 paper adhesive plaster microporous surgical tape ( 2 inch x 5m / roll ) , consumable 10.21 paper adhesive plaster microporous surgical tape ( 6 inch x 5m / roll ) , consumable 10.22 plaster of paris bandage 10 cm x 2.7 mtr / roll ( roll ) , bandage 10.23 vdrl kit ( strip ) ( 50 test / kit ) , consumable 10.24 disposable spinal needle ( 23 no ) , each 10.25 disposable spinal needle 18 no 10.26 disposable spinal needle ( 22 no ) , each 10.27 dj stent for ureter ( 8 fr ) , each 10.28 dj stent for ureter ( 6 fr ) , each 10.29 double lumen hoemodialysis catheter with pur ext ( tube ) , each 10.3 trucut biopsy needle ( 18 g length 15 cm ) , each 10.31 disposable ( 20 g no isi marked ) , needle 10.32 disposable syringe ( 50 ml ) , syrings 10.33 reuse prevention syringe ( 10 ml ) , syrings 10.34 glass test tube 12 x 100 ( medium size ) heavy quality 100 / pkt ( no. ) , tube 10.35 test tube 12 x 100 ( medicm size ) 100 / pkt 10.36 test tube 12 x 75 ( small size ) 100 / pkt ( 12 x 75 ( small size ) 100 / pkt ) , tube 10.37 tips for auto pipettes 2 to 100 micro litres 1000 / pkt ( 2 to 100 micro litres 1000 / pkt ) , each 10.38 tips for auto pipettes 200 to 1000 micro litres 500 / pkt ( 200 to 1000 micro litres 500 / pkt ) , each 10.39 abdominal drain ( set 32 no ) , each 10.4 abdominal drain set ( 28 no ) , each 10.41 icd bag 1000 ml 10.42 foleys urinary catheter 2 way size 8 10.43 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque blue line 10.44 wound suction catheter ( no 18 ) , each 10.45 foleys urinary catheter pediatrics ( size 10 ) , each 10.46 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 10.47 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 10.48 chikungunya card test 1 gg + 1 gm ( 25 test / kit ) 10.49 alpha beta arteether inj 75 mg / 2 ml 10.5 cefadroxil ( 500 mg ) , tablet 10.51 clotrimazole suspension i.p 50mg / 5ml ( 50mg / 5ml ) , suspension 10.52 olopatadine hydrochloride ophthalmic solution usp 01% w / v 5ml ( ) , eye drop [ 10.53 atorvastatin ( 20mg ) , tablet 10.54 soframycin ointment 30 mg tube ( ) , ointment 10.55 atorvastatin ( 10 mg ) , tablet 10.56 glass test tube 12 x 75 ( small size ) ( heavy quality 100 / pkt ) , tube 10.57 b.b. silk 6 reels x 25 mts length 25 mts. black braided silk without needle in reels non absorbable surgical sutures usp 3 0 ( 6 reels is per box rate should be quoted for 6 reels ) , consumable 10.58 chromic catgut no 1.0 round dody, 40 mm 12 foils / pkt 10.59 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair 10.6 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 as amended upto, 6.5 inch / pair ( pair ) , consumable 10.61 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992 ( 7 inch / pair ) , consumable 10.62 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422:1992, as amended upto, 7.5 inch / pair ( pair ) , consumable 10.63 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6 inch / pair 10.64 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6.5 inch / pair 10.65 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 7 inch / pair 10.66 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free ( 7.5 inch / pair ) , consumable 10.67 diagnostic strips for urine sugar / albmin packing: 100 strip / pkt 10.68 disposable syringes is 10258:2002 with needle is 10654:2002 ( 10ml ) , syrings 10.69 i.v. cannula with injection valve ( 20g ) , consumable 10.7 needle hypodermic size is ( 10654:2002 23g ) , needle 10.71 sterile hypodermic syring with needle ( 5 ml ) , syrings [ 10.72 sterile hypodermic syring with needle 10 ml [ 10.73 sterile hypodermic syring with needle 20 ml 10.74 disposable needles ( 23 no ) , needle 10.75 i.v. cannula with injection valve ( size 24 g ) , consumable 10.76 triway cannula ( 3 way stop cock ) , consumable 10.77 three way stop ( cock ) , consumable 10.78 syrup 50ml bottle ( each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup as per the standards provided with dropper ) , syrup 10.79 formaldehyde ( formalin ) 37% acq dilute 34 ml formaledehyde solution with water to produce 100ml ( 450 ml bottle ) ( 34 ml ) , bottle 10.8 irinotecan 100 mg inj ( 1 ml amp ) [ 10.81 azithromycin ( 100mg / 5ml ( 15 ml bottle ) ) , suspension 10.82 compound sodium lactate injection ip ( ringers lactate ) 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500 ml bottle ) ( ) , solution 10.83 gram iodine ( gram stain ) ( 100ml bottle ) ( bottle ) , consumable 10.84 trisodium citrate 3.8% ( 500 ml bottle ) 10.85 basic carbol fuchsin for afb staining 25 gm / pkt 10.86 carbol fuchsin for zn stain ( 500ml bottle ) 10.87 fouchets reagent ( 100 ml bottle ) , consumable [ mis56 ] 10.88 kit for total protein ( including albumin and total protein ) 100ml bottle 10.89 methyl blue for ( z n ) ( 125 ml bottle ) , consumable 10.9 platelet dilution fluid ( 100 ml ) , consumable 10.91 safranine ( gram stain ) ( 500 ml bottle ) , consumable 10.92 papaniculau stain kit ( 125ml bottle ) 10.93 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 2 lit can ( to make 9 liters working solution ) ( bromodex mp developer concentrate ) 9ltr packing 10.94 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life 3 lit can ( to make 13.5 liters working solution ) ( bromodex mp developer concentrate ) 13.5 ltr packing 10.95 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast / fog ratio and good shelf life ( 5 ltr can to make 22.5 liters working solution ) 10.96 echo jelly 250ml bottle ( bottle ) , jelly 10.97 surgical blade isi marked, size 22 ( 100 / pkt ) , surgical material 10.98 surgical blade isi marked, size 24 ( 100 / pkt ) , surgical material 10.99 developer powder ( 22.5 ltr ) 11 brain thromboplastin for prothrombin time ( pt reagent ) 5ml ( liquiplastin ) 11.01 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail ( eryclone anti d igm ) 11.02 hiv kit card ( 25 test / kit ) , kit 11.03 ra factor rapid kit ( 25 test / kit ) 1: ) should be based on latex agglutination slide test. 2: ) qualitative and semiquantitative testing facility possible. 3: ) test speed must be less than 2 minutes 11.04 typhoid card test kit ( for igg and igm antibody detection ) ( 25 test kit ) 11.05 auto pippets fixed volume ( 10 micro liters each ) , consumable [ mis11 ] 11.06 auto pippets fixed volume ( 20 micro liters each ) , consumable [ mis13 ] 11.07 auto pippets fixed volume ( 1000 micro liters each ) , consumable [ mis12 ] 11.08 central venous catheter kit ( single lumen ) , kit 11.09 desferioxamine injection 500mg ( 500mg ) , injection 11.1 octreotide lar ( 30mg ) , injection 11.11 vildagliptin + metformin ( 50mg + 500mg ) , tablet 11.12 levofloxacin 500 mg ( 100 ml ffs bottle ) , injection 11.13 imatinib ( 400 mg ) , tablet 11.14 imatinib 100 mg cap 11.15 calcium leucovorin ( 50 mg / vial inj ) , injection 11.16 tamoxifen ( 10 mg ) , tablet 11.17 paclitaxel nanoparticle / protein bound particles inj. ( 100mg vial ) , vial 11.18 amlodipine ( 2.5mg ) , tab 11.19 oseltamivir 12 mg / ml syrup ( 75ml bottle ) , syrup 11.2 sitagliptin ( 100 mg ) , tablet 11.21 methyl prednisolone sod. succinate ( 500 mg vial ) ( inj 40mg / ml , 12.5 ml vial ) , injection 11.22 hydrocortisone inj 100 mg / vial ( ) , injection 11.23 oseltamivir 30mg ( capsule ) , capsule 11.24 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules ( red tablet ) ( ) , tablet 11.25 a v blood lines with av pressure transducer protector for all machines types and dialysers ( acceptable for fitting to all standard dialysers ) , set 11.26 femoral catheters single lumen size adult ( set of 12 different sizes set ) , consumable 11.27 femoral catheters single lumen size size pediatrics ( ( set of 12 different sizes ) , set ) , consumable 11.28 femoral catheters double lumen kit curved double lumen catheter set ( 12 f ( curved ) adult ) , consumable 11.29 adult double lumen catheter ( set 11.5 f 12 fr, 13cm ( curved ) , kit ) , consumable 11.3 adult double lumen catheter set ( 11.5 f 12 fr, 13cm ( straight ) , set ) , consumable 11.31 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( curved ) , kit 11.32 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm ( straight ) , set 11.33 jugular catheters : double lumen kit ( curved ) , set [ 700233 ] 11.34 femoral guide wires : straight ( 0.325 mm size ) should meet the following standards : european ce, iso13485, sterile, fda, set 11.35 blood vessel introducers needles 16g, sterilized, set 11.36 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) cotton gauze pieces 1 11.37 tourniquet with belt ( good quality pairs ) ( each ) , consumable 11.38 kores indelible ink marker pen 11.39 ecg paper ( chemical coated ) ( 50mm*20 mm roll ) , each 11.4 tmt graph paper a4 size, 100 piece / pkt 11.41 ecg roll three channel 20m 11.42 iv cannula size with inj.valve ( port ) ( 22g ) , consumable 11.43 1.3 / 1.4 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) ( 200ml bottle ) , consumable 11.44 1.5 / 1.6 adult dialyzer ( dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone ) 11.45 rpr rapid card test kit ( 50 test / pkt ) 11.46 disposable sharp collection containers ( 1.5 l ) , consumable 11.47 polybutylate coated with polyester braided ( green ) with 1 / 2 cir tap cut v 5 da needle 17mm, non abs surg suture usp 2 0 length 90cm ( 12 foils / pkt ) 11.48 mva kit ( mannual vaccum aspiration kit 11.49 fistula 16g, single sterilized eto single needle packing fistula 17g, single sterilized eto single needle packing 11.51 disinfectant renaclean cold sterilant ( 5 ltr can ) 11.52 disinfectant renasteril hot disinfectant ( 5 ltr can ) 11.53 hemodialysis fluid for bicarb made ( part a 10 ltr +part b 500gm 2 / pkt ) , consumable 11.54 intracath cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) , consumable 11.55 quincke bevel pediatric spinal needle, g 25, length 1.2 inch 11.56 exchange transfusion catheter with four way adaptor ( size 4 cm, l 40 cm ) , consumable [ mis52 ] 11.57 single umbilical catheter with luer lock stopcock fr 2, l 40 cm 11.58 single umbilical catheter with luer lock stopcock fr 3, l 40 cm ] 11.59 single umbilical catheter with luer lock stopcock ( fr 4, l 40 cm ) , consumable [ mis113 ] single umbilical catheter with luer lock stopcock ( fr 5, l 40 cm ) , consumable [ 11.61 short iv catheter with straight / j tip guidewire ( l 20, fr 2, g 22 ) , consumable [ mis108 ] 11.62 long line silicon catheter ( g 24, fr 2, l 30cm ) , consumable [ mis76 ] 11.63 short iv catheter with straight guidewire. l 20, fr 2, g 22 11.64 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 30mm length 70cm size : 1 / 0 ( 12 foils / pkt ) , consumable [ 11.65 skin closure stapler ( 35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure ( 7.2 x 4.3 mm ) , consumable 11.66 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 15cm 11.67 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 20cm 11.68 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20 ( length 8cm ) , consumable 11.69 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, ( length 15cm ) , consumable 11.7 spinal needle g 23 with metal stylet. 11.71 low profile titenium chemo port with cilicon catheter ( 9.6 fr, 6.6fr, 3.9fr, ) length 60cm, guide wire, peel away desilet, hubsite needle ( 22g*20mm ) ( 22g*20mm ) , needle 11.72 i.v cannula size with injection valve ( port ) ( 18g ) , consumable 11.73 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 22 ) , consumable 11.74 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 20 ) , consumable 11.75 xro catheter with ptfe material, i.v. safety cannula, with luer lock ( g 18 ) , consumable ] 11.76 ptfe material, i.v. safety cannula, with luer lock, g 16 ] 11.77 quincke pediatric spinal needles g 25, length 2.0 inch 11.78 central venous catheter kit single lumen ( 18 g ) , consumable 11.79 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg ( 250mg ) , capsule 11.8 polyethylene high pressure extension tube, length 100cm 11.81 polyethylene high pressure extension tube ( length 150cm ) , consumable [ mis94 ] 11.82 polyethylene high pressure extension tube, length 200cm 11.83 a.v fistula needle 17 g 11.84 a.v fistula needle 16 no 11.85 guide wire 3mm 11.86 urosticks ( 50 / pkt ) , consumable 11.87 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 11.88 adhesive roll 1 inch x 5 m / roll 11.89 light weight composite mesh : polypropylene and polyglycolic acid partially absorbable composite mesh with large pore size 6 x 11 cm 11.9 chromic catgut monofilament with 1 / 4 circle reverse cutting needle 6 0 ( 12 / pkt ) 11.91 a.v. blood line ( post haemodialysis tubing ) high quality 11.92 endotreheal tube size 3 cuffed piece, should have silicon tube with radio opaque blue line 11.93 endotreheal tube size 4 cuffed piece, should have silicon tube with radio opaque blue line 11.94 disposable sharp collection containers ( 5 ltr ) , consumable 11.95 ondansetron syrup 2mg / ml 11.96 insulin intermediate inj 11.97 doxorubicin ( lypholozed ) 10 mg / vial 11.98 doxorubicin ( lypholozed ) 50 mg / vial ( 50 mg / vial ) , injection 11.99 pemetrexed ( 100 mg vial ) , injection 12 bleomycin 15 units / vial 12.01 daunorubicin ( 20 mg / vial ) , injection 12.02 egc roll ( 66 mm x 15 mm ) , consumable 12.03 umbical cord clamps ( plastic material ) , consumable 12.04 nebulization mask kit ( pediatrics ) , consumable 12.05 1 / 2 ccs cut needle 48 mm stainless steel ( length 45 cm size 4 ) , needle [ mis03 ] 12.06 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 5 ) , needle [ mis01 ] 12.07 1 / 2 ccs cut needle 48 mm stainless steel length ( 45 cm size 6 ) , needle 12.08 poly propylene monofilament sterile precut with 1 / 2 cir rb needle 40 mm length 70 cm size 1 ( 12 foils / pkt ) , needle 12.09 poly propylene mesh ( 15 x 15 cm ) , consumable [ 12.1 polymaide mono filament ( nylon ) with cd cut needle 20 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) 1 ] 12.11 polyglactin 30 mm 1 / 2 circle round body 90 cm size 1 / 0 ( 12 foils / pkt ) , consumable [ 12.12 polyglactin 40 mm 1 / 2 circle round body 90 cm size 1 ( 12 foils / pkt ) , consumable 12.13 polyglecaprone with 1 / 2 cir oval / rb needle 26 mm length 70 cm size 3 / 0 ( 12 foils / pkt ) , consumable [ mis95 ] 12.14 poly propylene mono filament sterile precut with 1 / 2 cir rb d needle 16mm length 70 cm non absorbable surgical sutures usp size 5 / 0 ( 12foils / pkt ) , consumable 12.15 poly propylene mono filament sterile precut with 1 / 2 cir rb heavy needle 16 mm length 70 cm non absorbable surgical sutures usp 5 / 0 ( 12 foils / pkt ) 12.16 polyester braided coated with cd white dn 25mm ( curved rb ) 2 0 length 90cm ( 12 foils / pkt ) 12.17 polyester braided coated with 1 / 2 cir cd white dn 17 mm taped cut 90 cm 2 / 0 size ( 12 foils / pkt ) , consumable [ mis93 ] 12.18 polyester braided coated with cd white dn 17 mm ( curved rev cut ) cut 90 cm 2 / 0 ( 12 foils / pkt ) 12.19 polyester braided coated with cd white dn 17 mm curved rb 90cm 2 / 0 ( 12 foils / pkt ) 12.2 5 0 da polyglactin 910 coated with polyglactin 910 and calcium state mono with 1 / 4 circle spatulated needle ( 12 foils / pkt ) , consumable 12.21 whitacre pencil point spinal needle 25 g with introducer [ 12.22 lead letter 0 9 sets ( 100 clips / pkt ) 12.23 lead letter a to z set [ 12.24 cassette ( 12 x 15 ) , consumable 12.25 cassette ( 10 x 12 ) , consumable 12.26 gloves latex autoclavable ( 8 no ( pair ) made of natural latex micro rough finish for better grip ) , consumable [ mis59 ] 12.27 sulfamethoxazole and trimethoprim suspension 50ml ( ) , suspension [ 12.28 sargramostim ( recombinant human granulocyte macrophage colony stimulating factor ) ( 500 mcg / ml ) , injection 12.29 magnesium suplhate injection i.p.50 % w / v 10ml amp 12.3 gentamicin inj. 40 mg / ml, 2ml amp 12.31 white petrollium jelly 1kg 12.32 white petrollium jelly 20 kg 12.33 hypodermic syringe for single use ( 10ml bp / bis ( without needle ) ) , syrings 12.34 hypodermic syringe for single use 2ml bp / bis ( without needle ) , syrings 12.35 hypodermic syringe for single use 5ml bp / bis ( without needle ) , syrings [ 700356 ] 12.36 ptfe material, iv cannula ( with luer lock, g 18 ) , consumable [ 700357 ] 12.37 diclofenac gel 1% 10gm tube 12.38 schirmer strip for ophthalmic use 12.39 actinomycin d ( 0.5mg vial ) , injection [ 12.4 cytra.bine 100 mg vial 12.41 ifosphamide + mesna ( 1gm ) , injection [ 12.42 vincristin sulphate 1 mg vial ( ) , vial [ 12.43 azithromycin ( 500 mg / 5ml inj ) , vial 12.44 carboprost promithamin ( 1ml amp ) ( 250mcg / ml ) , injection 12.45 metformine 500mg + glibenclamide 5mg ( tab ) , tablet 12.46 ampicillin ( 250 mg ) , capsule [ 12.47 metronidazole 100mg / 5ml ( 30ml ) , syrup 12.48 prednisolone ( dt tablets also accepted ) ( 5mg ) , tablet 12.49 salmeterol 25 mcg + fluticasone 125 mcg ( 120mdi ) , inhaler 12.5 salmeterol 25 mcg + fluticasone 250 mcg inhaler ( 120mdi ) ( 250 mcg ) , inhaler 12.51 enoxaparin sodium 40mg ( 20mg / 0.2ml ) prefilled syringe inj ( syringe inj ) , syrings [ 12.52 meropenem ( 1000 mg ( vial ) ) , injection 12.53 ceftriaxone 1000mg + sulbactam 500mg ( vial ) , injection 12.54 paracetamol 1000mg i v infusion ( 100 ml ffs bottle ) , injection 12.55 vitamin d3 granules ( 60000 iu sachet ) , powder 12.56 risperidone ( 1mg ) , tablet 12.57 hcg ( human chorionic gonadotropin ) inj 5000 iu vial 12.58 azithromycin 1gm + cefixime 400mg ( ( 1 + 1 tab ) ) , tablet 12.59 vitamin a ( soft gelatin cap ) 50000 i.u 12.6 chlorpromazine ( 50 mg ) , tablet 12.61 surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial 12.62 sterlium 500 ml 12.63 glucometer strip ( 1x100 ) 12.64 aceborophylline ( 100 mg ) , capsule 12.65 sildenafil ( 50 mg ) , tablet 12.66 ursodeoxycholic acid ( 150 mg tab ) , tablet 12.67 ursodeoxy cholic acid 300 mg tab 12.68 vitamin e usp ( 400 mg ) , capsule 12.69 benzyl benzoate lotion 25% ( 100ml bottle ) , bottle 12.7 disposable needles is ( 10654:2002 26 g ) , needle 12.71 hypodermic syringe for single use 1ml, is : 10258 ( 10 ml vial ) , syrings 12.72 spinal needle g 22 l 120 mm*0.71 / piece 12.73 spinal needle g 27 l 120 mm*0.40 / piece 12.74 hypodermic needles for single use gauze 22 bis length, 25 +1 / 2 12.75 hypodermic needles for single use gauze 23 bis length, 25 +1 / 2 12.76 feeding tube ( catheter ) ( 10 g, each ) , consumable ] 12.77 amoxicillin trihydrate dispersible 125 mg tab ( 125 mg ) , tablet ] 12.78 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets ( detail specification as per tender ) ( 400 mcg ) , tablet 12.79 phenytoin sodium 250 mg / 5 ml ( 5ml vial ) , injection 12.8 dextromethorphan hydrobromide syrup 13.5 mg / 5ml ( 30 ml bottle ) , syrup 12.81 diphtheria antitoxin 10000 iu ( 10ml vial ) , injection 12.82 glass slide with isi mark at least 75mm x 25 mm thickness at least 1.1mm, detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions ( 50 slides / packet ) , consumable 12.83 cover slip with isi marked size:18x18mm ( + / 1.00mm ) , thikness 0.13.. to 0.17mm ( pkt of 50 pieces ) , consumable 12.84 spinal needle ( 24 g ) , consumable 12.85 absorable surgical suture rb needle size no 1 0, 30 mm length 70 cm , 12 foils per packet , polyglycolic acid ( pga ) [ 12.86 catgut chromic with 1 / 2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet ( needle 30 mm length 70cm no. 1 0, 12 foils per packet ) , consumable [ 12.87 kellys pad ( rubber / each ) , consumable 12.88 disposable syringe with needle ( 3ml each ) , syrings 12.89 disposable syringe with needle ( 2ml each ) , syring ] 12.9 medical x ray film polyester based imaging film 30.5 cm x 30.5cm ( 12x12 ) size: 50 sheets in one packet 12.91 medical x ray film polyester based imaging film 35.6cm x 35.6cm ( 14x14 ) size: 50 sheets in one packet 12.92 medical x ray film polyester based imaging film 35.6 cm x 43.2cm ( 14x17 ) size: 50 sheets in one packet 12.93 syrup cefpodoxime ( 50 mg ) , syrup 12.94 a.v. blood line ( post haemodialysis tubing ) 12.95 non foldable iol sterile lens pc+14d ( 2 ) , pc+16d ( 3 ) , pc+18d ( 5 ) , pc+19d ( 5 ) , pc+19.5d ( 5 ) , pc+20d ( 15 ) , pc+20.5d ( 15 ) , pc+21d ( 13 ) , pc+21.5d ( 10 ) , pc+22d ( 10 ) , pc+22.5d ( 5 ) , pc+23d ( 5 ) , pc+24d ( 3 ) , pc+26d ( 2 ) , ac+19d ( 2 ) ( box ) , lens 12.96 total protein test kit ( 100 ml bottle ) , consumable 12.97 cervical collar / each soft, ( medium sized ) , consumable 12.98 baby diapers small ( 10 diaper per pkt ) , consumable 12.99 gauze sponge / each ( size 3 x 3 ) , consumable 13 chadar medical bleach ( name print ) ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) 13.01 chadar medical bleach ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.02 chadar medical bleach ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.03 dr sheet bleach ( 45 inch x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.04 sheeting cloth bleach ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.05 pillow cover cloth bleach ( 1 m x 40 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.06 chadar rangeen check ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.07 chadar rangeen ( ( name print ) 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.08 chadar rangeen ( 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.09 chadar rangeen ( ( name print ) 60 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.1 table cloth rangeen ( 54 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.11 table cloth rangeen ( 72 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) 13.12 curton cloth rangeen ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 34 / inch ) ) 13.13 curton cloth rangeen design ( 1 m x 48 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 36 x 36 / inch ) ) , 13.14 honeycomb towel bleach ( 54 inch x 27 inch tana x bana ( 2 / 20 s x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.15 napkin bleach ( 27 inch x 17 inch tana x bana ( 2 / 20 x 10 s ) reed x pik ( 40 x 40 / inch ) ) , 13.16 do suti bleach ( 1 m x 50 inch tana x bana ( 20 s x 14 s ) reed x pik ( 32 x 32 / inch ) ) 13.17 gaadi pot patta ( 1 m x 45 inch tana x bana ( 2 / 20 s 10 s ) reed x pik ( 36 x 32 / inch ) ) 13.18 basta cloth ( 36 inch x 36 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.19 basta cloth ( 44 inch x 44 inch tana x bana ( 10 s x 10 s ) reed x pik ( 28 x 26 / inch ) ) , 13.2 patient cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 48 x 52 / inch ) ) 13.21 astar cloth ( 1 m x 54 inch tana x bana ( 2 / 40 s x 20 reed x pik ( 48 x 52 / inch ) ) 13.22 peticote / blauge cloth shuti bleach ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.23 peticote blauge cloth shuti rangeen ( 1 m x 40 inch tana x bana ( 2 / 60 s x 2 / 60 s ) reed x pik ( 60 x 60 / inch ) ) , 13.24 gray duster cloth ( 24 inch x 24 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.25 gray duster cloth ( 28 inch x 28 inch tana x bana ( 10 s x 10 s ) reed x pik ( 20 x 24 / inch ) ) , 13.26 macchardaani kapda cotten ( 1 m x 53 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 40 x 40 / inch ) 13.27 chadar check rangeen ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.28 chadar check rangeen naam print ( 84 inch x 48 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.29 blauze cloth tericat rangeen ( 1 m x 40 inch tana x bana ( 83 / 34d x40 cott. ) reed x pik ( 72 x 72 / inch ) ) , 13.3 tericat shirting cloth ( 1 m x 36 inch tana x bana ( 2 / 60s x 60 p.v. ) reed x pik ( 68 x 64 / inch ) ) , 13.31 tericat shuting ( 1 m x 56 inch tana x bana ( 2 / 30p : vx2 / 30 p:v ) / 65:35 reed x pik ( 60 x 48 / inch ) ) , 13.32 gauze cloth bleach 91cm x 20m tana x bana ( 26 s 26 s ) reed x pik ( 17 x 14 / inch ) , 13.33 bandage cloth bleach 1 m x 20 m tana x bana ( 26 x 26 s ) reed x pik ( 34 x 24 / inch ) , 6 ] 13.34 blazer cloth ( woolen 1 m x 54 inch tana x bana ( 8 n.m. x 8 n.m. ) reed x pik ( 28 x 24 / inch ) ) , 13.35 cotten sharee safed / rangeen ( 46 inch x 5.50m tana x bana 2 / 120sx80s reed pik 80 x 70 72 / inch ) ) , 13.36 tericot sharee rangin ( 46 x 5.50m tana x bana ( 2 / 120sx83 / 34 poly reed x pik ( 72 x80 / inch ) ) , 13.37 razai cloth ( 1 mts x 54 inch tana x bana ( 2 / 40s x 20s ) reed x pik ( 44 x44 / inch ) ) , 13.38 tericot astar cloth ( 1 mts x 54 inch tana x bana ( 2 / 60pv x 155d. ) reed x pik ( 68 x64 / inch ) ) , 13.39 tericat macchardani gray cloth ( 1 mts x 53 inch tana x bana ( 2 / 60pv x 30 p.v. ) reed x pik ( 48 x46 / inch ) 13.4 roll bandage 15 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.41 roll bandage 10 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.42 roll bandage 7.5 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , 13.43 roll bandage 05 cm x 05 m tana x bana ( 26s x 26s ) reed x pik ( 34x 24 ) , ] 13.44 chadar medical bleach ( 54 inch x 90 inch tana x bana ( 2 / 40 s x 20 s ) reed x pik ( 52 x 54 / inch ) ) , 13.45 sodium hypochlorite solution 100 ml bottle 13.46 lignocaine hydrochloride for spinal anaesthesia ( heavy ) ( 0.05 2 ml amp ) , injection 13.47 bupivacaine hcl for spinal anaesthesia ( 0.5% ( heavy ) ) , injection 13.48 medical oxygen steel / aluminium cylinder ( 10 water cap ) with gas specific pin system ( 10 liters ) , inhalation 13.49 flumazenil 0.1 mg / ml 5 ml multiple dose vial 13.5 carbamazepine ( 100 mg / 5 ml 100 ml bottle ) , 13.51 amoxicillin ( 250 mg / vial ) , injection 13.52 amoxicillin + clavulanic acid ( 125 mg + 25 mg ) , injection 13.53 cefixime 10 ml bottle ( 100 mg / 5 ml ) , suspension 13.54 cefpodoxime ( 50 mg ( dt tablet also acceptable ) ) , tablet 13.55 cephalexin dispersible ( 125 mg ) , tablet 13.56 chloramphenicol ( 500 mg ) , capsule 13.57 penicillin v 125 mg 13.58 penicillin v ( phenoxymethyl penicillin potassium ) ( 250 mg ) , tablet 13.59 tinidazole 150 mg / 5 ml ( 60 ml bottle ) , suspension 13.6 diethylcarbamazine ( 50 mg ) , tablet 13.61 epirubicin inj 100mg / vial vial ( each ) , injection 13.62 methotrexate tab ( 5 mg ) , tablet 13.63 levodopa + carbidopa 200 mg + 50 mg 13.64 dobutamine ( 12.5 mg / ml 20 ml vial ) , injection 13.65 fusidic acid 0.02 ( 15 gm ) , cream 13.66 metronidazole 1% ( 15 gm tube ) , ointment 13.67 salicylic acid ( 0.02 30 gm ) , ointment [ 13.68 chlorthalidone ( 50 mg ) , tablet 13.69 torasemide ( 20 mg / 2 ml vial ) , injection 13.7 dicyclomine hydrochloride oral solution 10 mg 30 ml bottle ( 10 mg ) , solution 13.71 doxylamine succinate ( 10 mg ) , tablet 13.72 ondansetron ( 2 mg ) , tablet 13.73 dydrogesterone ( 10 mg ) , tablet 13.74 micronised progestrone ( 200 mg ) , tablet 13.75 cabergoline ( 0.5 mg 4 tablets / strip ) , tablet 13.76 fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye [ 13.77 gentamycin + hydrocortisone 0.3% + 1% ( 5 ml vial ) , ear drops 13.78 fluconazole 0.3% eye / ear ( 5 ml ) , drop 13.79 cerumenolytic ( for ear wax ) each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% ( 10 ml vial ) , ear drops 13.8 fluphenazine ( 2.5 mg ) , tablet 13.81 fluoxetine ( 10 mg ) , tablet or capsule 13.82 sertraline ( 50 mg ) , tablet 13.83 venlafaxine ( 75 mg ) , capsule 13.84 salbutamol sulphate ( 2 mg ) , tablet 13.85 formaldehyde ( formalin ) 34% acq 450 ml bottle 13.86 sodium hypochlorite ( 0.03 5 ltr ) , solution 13.87 albendazole 100 mg ( tab ) , tablet 13.88 albendazole tab ( 200 mg ) , tablet 13.89 alfacalcidiol capsule ( 0.25 mcg ( soft gelatin capsule also acceptable ) ) , capsule 13.9 amitryptiline tab ( 50 mg ) , tablet 13.91 amitryptiline ( 75 mg ) , tablet 13.92 atorvastatin ( 5 mg ) , tablet 13.93 benzoic acid + salicylic acid ( 6% + 3% ( 15 gm tube ) ) , ointment 13.94 benzoyl peroxide 2.5% 20 gm ( ointment / gel ) , tube 13.95 busulphan ( 2 mg ) , tablet 13.96 capreomycin 1000 mg / vial injection ( 10 ml ) , vial 13.97 chlorambucil ( 2 mg ) , tablet 13.98 ciprofloxacin 125 mg / 5 ml 60 ml bottle ( 125 mg / 5 ml 60 ml bottle ) , suspension 13.99 ciprofloxacin + tinidazole ( 250 mg + 300 mg ) , tablet 14 clindamycin ( 1% w / w 10 gm ) , gel 14.01 clobazam ( 5 mg ) , tablet [ 14.02 clobazam ( 10 mg ) , tablet 14.03 clonazepam 0.25 mg ( tablet ) , tablet 14.04 clonazepam ( 1 mg ) , tablet 14.05 cloxacillin cap ( 250 mg ) , capsule 14.06 cloxacillin ( 250 mg / vial ) , injection 14.07 cloxacillin ( 125 mg / 5 ml 40 ml bottle ) , syrup 14.08 colistin sulphate ( 12.5 mg / 5 ml 30 ml bottle ) , suspension 14.09 crystalline penicillin 5 lakh iu / vial ( vial ) , injection 14.1 cycloserine 250mg ( capsule ) , capsule 14.11 daunorubicin 50 mg / vial vial 14.12 didanosine 250 mg 14.13 didanosine ( 400 mg ) , capsule 14.14 dimercaprol 50 mg / ml ( 2 ml amp ) , injection 14.15 ephedrine 30 mg / ml ( 1 ml amp ) , injection 14.16 estradiol cypionate + medroxy progesterone acetate 5 mg + 25 mg / 0.5 ml 0.5 ml ( ) , injection 14.17 ethacridine lactate 1 mg / ml ( 50 ml ) , infusion 14.18 ethinyl estradiol 0.01 mg 10 tablets 14.19 ethinyl estradiol 0.05 mg 10 tablets 14.2 etoposide ( 50 mg ) , capsule 14.21 fluconazole ( 50 mg ) , tablet 14.22 fluconazole 100 mg [ 14.23 fluconazole ( 200 mg ) , tablet [ 14.24 flunarizine ( 10 mg tab ) , tablet 14.25 human chorionic gonadotropin 2000 iu / ml 1 ml amp 14.26 hydrochlorthiazide ( 12.5 mg ) , tablet 14.27 iron dextran 50 mg / ml ( 2 ml amp ) , injection ] 14.28 levamisole ( 50 mg ) , tablet 14.29 levocetirizine + monteleukast ( ( 2.5 mg + 4 mg ) / 5 ml, 30 ml bottle ) , syrup [ 14.3 lithium carbonate ( sr ) ( 450 mg ) , tablet 14.31 medroxy progesterone acetate ( 150mg / ml 1 ml amp ) , injection 14.32 mesalamine ( 5 aminosalicylic acid ) usp ( 800 mg ) , tablet 14.33 methotrexate ( 7.5 mg ) , tablet 14.34 methylcobalamin inj ( 500 mcg / ml ( 10 ml vial ) ) , injection 14.35 methylcobalamin / mecobalamin ( 500 mcg ) , tablet 14.36 metoclopramide syrup ( 5mg / 5ml ( 30 ml bottle ) ) , syrup 14.37 mirtazapine ( 7.5 mg ) , tablet 14.38 misoprostol 400 mcg ( 4 tablets / strip ) , tablet 14.39 ofloxacin + ornidazole ( 50 mg + 125 mg ) / 5ml 30 ml bottle ( 30 ml ) , suspension 14.4 olanzapine ( 2.5 mg ) , tablet [ 14.41 olanzapine ( 7.5 mg ) , tablet 14.42 omeprazole ( 10 mg ) , capsule 14.43 omeprazole capsule ( 40 mg ) , capsule 14.44 ornidazole tab ( 500 mg ) , tablet 14.45 oxcarbazepine 150 mg 14.46 oxcarbazepine ( 300 mg ) , tablet 14.47 oxcarbazepine ( 600 mg ) , tablet 14.48 pancuronium 2 mg / ml ( 2 ml amp ) , injection 14.49 procaine penicillin 4 lac iu / vial vial ( ) , injection 14.5 ribavirin ( 200 mg ) , tablet capsule 14.51 roxithromycin ( 50 mg / 5 ml 30 ml bottle ) , syrup 14.52 roxithromycin ( 300 mg ) , tablet [ 14.53 secnidazole ( 500 mg tab ) , tablet 14.54 sodium valproate + valproate ( 333 mg + 145 mg ) , tablet 14.55 venlafaxine er / pr ( 37.5 mg ) , tablet or capsule 14.56 venlafaxine ( 150 mg ) , tablet or capsule 14.57 acarbose ( 25 mg ) , tablet 14.58 atenolol ( 25 mg ) , tablet 14.59 cefadroxil 250 mg ( tab ) , tablet 14.6 cefepime ( 250 mg / vial ) , injection 14.61 cefpodoxime tablet 100 mg ( dt tablet also acceptable ) , tablet 14.62 dextrose, d 50 0.5 25 ml ( 25 ml ) , injection [ 14.63 dextrose, d 25 0.25 25 ml ( 25 ml ) , injection 14.64 aceclofenac + paracetamol + chlorzoxazone ( 100 mg + 500 mg + 500 mg ) , tablet 14.65 amisulpride ( 100 mg ) , tablet 14.66 amisulpride ( 50 mg ) , tablet 14.67 amisulpride ( 200 mg ) , tablet 14.68 amitriptyline ( 10 mg ) , tablet 14.69 amoxicillin 100 mg / ml ( 10 ml with dropper ) , drop 14.7 amoxicillin + clavulanic acid ( 200 mg + 28.5 mg ) , tablet 14.71 aripiprazole ( 10 mg ) , tablet 14.72 aripiprazole 15 mg ( tablet ) , tablet 14.73 aripiprazole ( 20 mg tab ) , tablet 14.74 aripiprazole ( 5 mg tab ) , tablet 14.75 atropine + dexamethasone + chloramphenicol 1% + 0.1% + 0.5% ( 5 ml ) , eye drop 14.76 benzathine penicillin ( 24 lac iu / vial vial ) , injection 14.77 bismuth iodoform paraffin paste ( 200 gm jar ) , ointment 14.78 butorphanol tartrate 1mg / ml ( 1 ml ) , injection 14.79 calcitriol cap ( 0.25 mcg ) , tablet 14.8 calcium acetate ( 667 mg ) , tablet 14.81 cefixime + azithromycin 200 mg + 250 mg ( tab ) , tablet 14.82 cefoperazone 1gm / vial vial 14.83 cefotaxime + sulbactam 1000 mg + 500 mg vial ( 1000 mg + 500 mg ) , injection 14.84 ceftriaxone tab ( 250 mg ) , tablet 14.85 cefuroxime 500 mg 10 x 10 ( 500 mg ) , tablet 14.86 cefuroxime 250 mg 10 x 10 ( 250 mg ) , tablet 14.87 cephalexin 100 mg / ml ( 10 ml with dropper ) , drop 14.88 cetrimide + choline salicylate 0.01% + 8% all w / v ( 10 gm tube ) , gel 14.89 chloramphenicol 1% w / w ( 50 / pack ) , eye applicap 14.9 chloraxozone + paracetamol ( 250 mg + 500 mg ) , tablet 14.91 chlordiazepoxide ( 20 mg ) , tablet 14.92 chlordiazepoxide ( 25 mg ) , tablet [ 14.93 chlordiazepoxide ( 10 mg ) , tablet 14.94 cholecalciferol ( 60000 iu ) , tablet 14.95 gel containing choline salicylate + benzalkonium chloride 9% + 0.02% ( 10 gm ) , gel [ 20200913 ] 14.96 clobetasol propionate 0.05% ( 15 gm tube ) , cream [ 14.97 clomiphene citrate ( 100 mg tab ) , tablet 14.98 clomipramine ( 75 mg ) , tablet 14.99 clomipramine 25 mg ( tablet ) , tablet 15 clomipramine ( 50 mg ) , tablet 15.01 clotrimazole ( 1% 100 gm ) , powder [ 15.02 clotrimazole 1% w / v ( 15ml ) , mouth paint 15.03 clotrimazole ( 1% 15 ml ) , lotion 15.04 clotrimazole ( 1% w / w 30 gm ) , powder 15.05 clozapine ( 100 mg ) , tablet 15.06 cyclobenzaprine ( 5 mg ) , tablet [ 15.07 cyclopentolate 1% w / v ( 5 ml ) , eye drop 15.08 cyclosporine 50 mg 15.09 cyclosporine 25 mg 15.1 des venlafaxine ( 50 mg ) , tablet 15.11 des venlafaxine ( 100 mg ) , tablet 15.12 diacerein + glucosamine ( 50 mg + 750 mg ) , capsule 15.13 diazepam ( 10 mg ) , tablet 15.14 diclofenac sodium + paracetamol +serratiopeptidase ( 50 mg +325 mg + 10 mg ) , tablet 15.15 diclofenac+paracetamol+chlorzoxazoe ( 50 mg + 325 mg + 250 mg ) , tablet 15.16 dicyclomine 20mg+paracetamol 325mg ( tab ) , tablet 15.17 disodium acid phosphate + sodium phosphate 10 gm + 8 gm / 100 ml 100 ml ( ) , enema 15.18 divalproex sodium ( 500 mg tab ) , tablet 15.19 divalproex sodium ( 750 mg ) , tablet 15.2 divalproex sodium ( 250 mg ) , tablet 15.21 domperidone ( 1 mg / ml 10 ml with dropper ) , drop 15.22 doxophylline ( 400 mg ) , tablet 15.23 duloxetine ( 40 mg ) , tablet 15.24 duloxetine ( 20 mg ) , tablet 15.25 elemental iron 50 mg / ml 15 ml with dropper ( 15 ml with dropper ) , drop 15.26 elemental iron ( 50 mg / 5 ml ) , syrup 15.27 eltrombopag ( 25 mg ) , tablet 15.28 eplerenone ( 25 mg ) , tablet 15.29 escitalopram ( 5 mg ) , tablet 15.3 escitalopram ( 20 mg ) , tablet 15.31 escitalopram + clonazepam ( 10 mg + 0.5 mg ) , tablet 15.32 esmolol 100 mg / vial ( vial ) , injection 15.33 estradiol 1 mg / gm ( 15 gm tube ) , cream 15.34 estradiol 10 mg / vial ( vial ) , injection 15.35 fluvoxamine ( 50 mg ) , tablet 15.36 fluvoxamine ( 100 mg ) , tablet 15.37 flurbiprofen sodium 0.03% ( 5 ml ) , eye drop 15.38 gabapentine ( 100 mg ) , tablet 15.39 gentamicin + betamethasone 0.3% w / v + 0.1% w / v 5 ml ( ) , eye drop 15.4 gentamycin 40 mg / ml 10 ml vial ( 10 ml vial ) , injection 15.41 glimepiride + metformin hydrocloride sr ( 1 mg + mg ) , tablet 15.42 glycerine + sodium chloride enema ( 15% + 15% 20 30 ml / pack ) , enema 15.43 glycerine suppository usp ( 3 gm bottle / 10 ) , suppository 15.44 glycerine + mag sulphate crystal 250 ml jar 15.45 granisetron 1 mg / ml ( 1 ml amp ) , injection 15.46 haemocoagulase 1 iu / ml 10 ml 15.47 heparin 25000 iu ( 5 ml ) , injection 15.48 homatropine 2% ( 1 ml vial ) , eye drop 15.49 hyaluronidase 1500 iu / 2 ml ( 2 ml amp / vial ) , injection 15.5 ibuprofen ( 200 mg ) , tablet 15.51 icthyol glycerine 1% 30 ml 15.52 intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs ( ) , infusion 15.53 isoprenaline 2 mg / ml ( 1 ml ) , injection 15.54 lactobacillus 150 million spores ( 1 sachet ) , powder 15.55 lamotrigine dt tab ( 100 mg ) , tablet [ 15.56 lamotrigine dt ( 50 mg ) , tablet 15.57 levetiracetam 500 mg 15.58 levocetirizine + monteleukast ( 5 mg + 10 mg ) , tablet 15.59 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg / 5 ml 170 ml bottle ( syrup ) , syrup 15.6 mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet 15.61 mefenamic acid + drotaverine hcl ( 250 mg + 80 mg ) , tablet 15.62 metformin + glimepiride ( 500 mg + 2 mg tablet ( sr form also acceptable ) ) , tablet 15.63 methocarbamol 100 mg / ml ( 10ml ) , injection 15.64 methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg ) , capsule 15.65 methylcobalamine ( vitamin b12 ) 500 mcg / ml 3 ml 15.66 metoprolol + amlodipin ( 25 mg + 2.5 mg ) , tablet ] 15.67 metoprolol + ramipril ( 25 mg + 2.5 mg ) , tablet 15.68 micronised progesterone ( 400 mg ) , capsule 15.69 micronised progestrone ( 50 mg / ml 4 ml amp ) , injection 15.7 mirtazapine 15 mg ( tablet ) , tablet 15.71 mometasone 0.10% ointment / cream ( mometasone furoate also acceptable ) , ointment [ 15.72 moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 15.73 moxifloxacin + prednisolone 5 mg + 3 mg / 5 ml 5 ml ( ) , eye drop 15.74 moxifloxacine + dexamethasone 0.5% + 0.1% w / v 5 ml ( ) , eye drop 15.75 netilmycin 25 mg / ml 1 ml ( vial ) , injection 15.76 nicorandil ( 5 mg 10 x 10 ) , tablet 15.77 nicotine 2 mg ( 2 mg ) , gum 15.78 nicotine 4 mg ( 4 mg ) , gum 15.79 nicotine 14 mg ( 14 mg ) , transdermal patch 15.8 nicotine ( 2 mg ) , lozenges 15.81 nicotine transdermal patch ( 21 mg ) , transdermal patch 15.82 nicotine transdermal patch ( 7 mg ) , transdermal patch 15.83 nifedipine ( sublingual ) ( 10 mg ) , capsule 15.84 nimesulide +paracetamol ( 100 + 325 mg ) , tablet 15.85 nimesulide +paracetamol+serratiopetidase ( 100 + 325 + 10 mg ) , tablet 15.86 nitrazepam ( 5 mg ) , tablet 15.87 norethisterone enanthate 200 mg / ml ( 1 ml ) , injection 15.88 norfloxacin ( 200 mg ) , tablet [ 15.89 nortriptyline ( 10 mg ) , tablet 15.9 omeprazole + domperidone 20 mg + 10 mg ( capsule ) , capsule 15.91 paracetamol + chlorphenaramine+ phenylephrine ( 250 mg + 2.5 mg + 10 mg ) , tablet 15.92 paracetamol + phenylephrine + chlorpheniramine maleate ( 125mg+2.5 mg+1mg ) / ml ( 15 ml bottle with dropper ) , drop 15.93 paroxetine cr ( 25 mg ) , tablet 15.94 paroxetine cr ( 12.5 mg ) , tablet [ 15.95 petrollium jelly ip ( 500 gm ) , gel 15.96 phenylepherine hcl & tropicamide 5% + 1% 5 ml [ 120566 ] 15.97 piperacillin + tazobactam 2000 mg + 250 mg 20ml vial ( 2000 mg + 250 mg 20ml vial ) , injection 15.98 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial ( ) , injection 15.99 piracetam 200 mg / 15 ml ( 15 ml ) , injection [ 16 pregabalin + methylcobalamin ( 75 mg + 750 mcg ) , tablet or capsule [ 16.01 promethazine ( 50 mg ) , tablet 16.02 proparacaine 0.50% 5 ml / vial 16.03 propranolol ( tab 20 mg ) , tablet 16.04 povidone iodine + metronidazole ( 5 % + 1 % ) , ointment 16.05 providone iodine 1% ( 5 ml ) , eye drop 16.06 pyridostigmine ( 60 mg ) , tablet 16.07 quetiapine ( 200 mg ) , tablet 16.08 quetiapine ( 100 mg ) , tablet 16.09 quetiapine ( 50 mg ) , tablet 16.1 quinine dihydrochloride 150 mg / ml 2 ml ( amp ) , injection 16.11 rabeprazole ( 10 mg ) , capsule 16.12 ranitidine 15 mg / ml ( 100 ml bottle ) , syrup 16.13 risperidone + trihexiphenidyle ( 3 mg + 2 mg ) , tablet 16.14 risperidone + trihexiphenidyle ( 2 mg + 2 mg ) , tablet 16.15 risperidone + trihexiphenidyle ( 4 mg + 2 mg ) , tablet 16.16 rosuvastatin ( 10 mg ) , tablet 16.17 s adenosyl l methionine ( 400 mg ) , tablet 16.18 salbutamol 2.5 mg / 3 ml ( 3ml ) , injection 16.19 serratiopeptidase ( 10 mg ) , tablet 16.2 sertraline ( 100 mg ) , tablet 16.21 silver nitrate ( 500 ml each ) , liquid 16.22 sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop 16.23 sodium hyaluronate ( intraocular ) ( 10 mg / ml 2ml ) , injection 16.24 sodium valporate ( 300 mg ) , tablet 16.25 tamsulosin + dutasteride 0.4 mg + 0.5 mg ( tab ) , tablet 16.26 tannic acid with glycerine ( gum paint ) 80% + 20% 10 ml vial ( 10 ml ) , lotion 16.27 teicoplanin ( 200 mg / vial ) , injection 16.28 tetracycline eye ointment 1% 5 gm 16.29 thalidomide 100 mg 16.3 thiocholchecocide ( 8 mg ) , tablet 16.31 thiocholchecocide ( 4 mg ) , tablet 16.32 thyroxine sodium 25 mcg ( 100 per bottle ) , tablet 16.33 thyroxine sodium ( 75 mcg ) , tablet 16.34 tricholine citrate + sorbitol ( 550 mg + 7.15 g / 10 ml ) , syrup 16.35 trifluoperazine + trihexyphenidyle 5 mg + 2 mg ( tab ) , tablet 16.36 vitamin b12 500 mcg / ml 10 ml vial ( 10 ml vial ) , injection 16.37 vitamin d3 ( cholecalciferol ) ( 400 iu / ml ( 100 ml bottle ) ) , syrup 16.38 vitamin e 200 mg ( capsule 10 x 10 ) , capsule 16.39 vitamin e 50 iu / ml 10 ml ( bottle with dropper ) , drop 16.4 zinc sulphate / gluconate 10 mg elemental zinc / 5 ml ( 10 mg / 5 ml ) , syrup 16.41 zinc sulphate 10 mg elemental zinc / 5 ml ( 200 ml bottle ) , syrup 16.42 bleomycin ( 15 mg / vial vial ) , injection 16.43 hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop 16.44 diltiazem 5mg / 1ml ( 5 ml ) , injection 16.45 acamprosate ( 333 mg ) , tablet 16.46 agomelatine ( 25 mg ) , tablet 16.47 aripiprazole ( 30 mg ) , tablet 16.48 atomoxetine ( 10 mg ) , tablet 16.49 atomoxetine ( 25 mg ) , tablet 16.5 baclofen ( 20 mg ) , tablet 16.51 baclofen ( 30 mg tab ) , tablet 16.52 baclofen ( 40 mg tab ) , tablet 16.53 blonanserin ( 2 mg ) , tablet 16.54 blonanserin ( 4 mg ) , tablet 16.55 bupropion ( 150 mg ) , tablet 16.56 buspirone ( 10 mg ) , tablet 16.57 buspirone ( 5 mg ) , tablet 16.58 carbamazepine ( sr ) ( 100 mg ) , tablet 16.59 donepezil ( 10 mg ) , tablet 16.6 duloxetine ( 30 mg ) , tablet 16.61 fluoxetine ( 40 mg ) , capsule 16.62 flupenthixol ( 20 mg / ml 1 ml ) , injection 16.63 haloperidol ( 1.5 mg ) , tablet 16.64 imipramine ( 75 mg ) , tablet 16.65 lithium carbonate ( 400 mg ) , tablet 16.66 memantine ( 10 mg ) , tablet 16.67 methyl phenidate 10 mg ( tab ) , tablet 16.68 methyl phenidate ( 20 mg ) , tablet 16.69 mirtazapine ( 30 mg ) , tablet 16.7 modafinil ( 100 mg ) , tablet 16.71 naltrexone ( 50 mg ) , tablet 16.72 olanzapine ( 10 mg / vial vial ) , injection 16.73 paliperidone 1.5 mg ( tab ) , tablet 16.74 paliperidone ( 3 mg ) , tablet 16.75 procyclidine ( 5 mg ) , tablet 16.76 risperidone ( 4 mg ) , tablet 16.77 sodium valproate ( 100 mg / ml 5 ml ) , injection 16.78 tadalafil 10 mg 16.79 tianeptin 12.5 mg ( tab ) , tablet 16.8 topiramate 25 mg ( tab ) , tablet 16.81 topiramate 50 mg ( tab ) , tablet 16.82 topiramate 100 mg ( tab ) , tablet 16.83 trifluoperazine 5 mg 16.84 vitamin b1 ( thiamine ) 75 mg ( tab ) , tablet 16.85 zonisamide ( 50 mg ) , capsule 16.86 zonisamide 100 mg ( capsule ) , capsule 16.87 urine container 5ml disposable ( 50 per pkt ) 16.88 disposable syringe with needle ( 5ml each ) , needle 16.89 infant feeding tube ( catheter ) size: 3g ( no. ) , consumable 16.9 infant feeding tube ( catheter ) size: 4g 16.91 suction catheter assorted 9 no / each ( each ) , consumable 16.92 suction catheter assorted 10 no / each 16.93 dental x ray film size 31 x 41 mm ( 150 films / pkt ) ( size 31 x 41 mm ) , film 16.94 disposable syringe with needle ( 20ml each ) , needle 16.95 synthetic absorbable suture 3 / 0 with cd cutting needle size : 3 / 0 22mm length 45cm polyglycolic acid ( pga ) ( 12 foils per pkt ) ( needle circle size is 1 / circle ) , needle 16.96 infant feeding tube size: 5g 16.97 adhesive tape 7.5cm x10 ( mtr / roll ) , consumable 16.98 disposable plastic appron ( full size ) , consumable 16.99 hydralazine hydrochloride 20mg / ml injection ( 1 ml amp / vial ) [ 700449 ] 17 glycerine ip solution ( 100ml bottle ) , bottle 17.01 etiophylline +theophylline ( ( 46.5+14 ) mg / 5ml ( 100 ml bottle ) ) , syrup 17.02 disposable surgeon cap ( box of 100 caps ) , consumable 17.03 paediatric epidural set ( 19g needle, metal stylet, 22g catheter, 0.22micron epidural catheter lor syringe ) ( ) , consumable 17.04 oxygen nasal canula ( neonatal ) 7 white colour tubing and threaded nut ( 25 pcs / pkt ) , consumable 17.05 catgut chromic with 1 / 2 cir cutting needle 12mm ( length 70cm no.3 0, 12 foils per pakt ) , consumable 17.06 electrolyte e ( multiple electrolytes and dextrose inj type v ip ) i / v fluid ( each 100ml contains inj dextrose 5g, sod.acetate 0.64g, sod.chloride 0.50g, sodium citrate 0.075g, kcl 0.075g, ccl 0.035g, magnesium chloride 0.031g ) , infusion 17.07 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) intravenous fluid ( each 100ml contains: anhydrous dextrose 5 gm, sod.chloride 0.37g, potassium chloride 0.13g, ammonium chloride 0.37g ) , infusion 17.08 cetrimide 15% w / v + chlorhexidine 1.5% w / v ( 1 liter bottle ) , bottle 17.09 human albumin solution i.p. 20%w / v ( 100 ml ffs bottle / glass bottle ) , bottle 17.1 k3 blood vaccutainer ( edta 100 tubes / pkt ) , consumable 17.11 synthetic absorbable suture 2 / 0 with 1 / 2 cir rb needle size:2 / 0 30mm length 90cm polyglycolic acid ( pga ) 12 foils / pkt ( 12 foils per pkt ) , needle 17.12 synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ( size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) ) , needle 17.13 synthetic absorbable suture 3 / 0 with 1 / 2 cir cutting needle ( size:3 / 0 36mm length 70cm polyglycolic acid ( pga ) 12 foils / pkt ) , needle 17.14 b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm ( length at least 75 cm, 12 foils per packet ) , needle 17.15 prolene 1 0 rb 1 / 2 circle 30 mm, l 70 cm ( 12 foils / pkt ) , needle 17.16 prolene mesh ( 7.5 x 15 cm ) , needle 17.17 dengue ns 1 elisa ( antigen ) kit ( pack of 96 / as per attached specification in tender ) , consumable 17.18 blood bag 100ml 17.19 blood bag 350ml 17.2 insulin syringe / each ( graduation upto 100 units ) 30 g needle, 40 units / ml ( 30 g needle, 40 units / ml ) , syrings 17.21 silk no 1 cutting needle 1x12 ( 1x12 ) , consumable 17.22 neomycin and sulfacetamide sprinkling powder 5 gm ( each ) , consumable 17.23 distilled water 5 litre ( each ) , consumable 17.24 meropenem 250 mg / vial ( 250mg / vial ) , injection 17.25 ambu bag adult ( silicon ) ( each ) , consumable 17.26 ambu bag child ( silicon ) ( each ) , consumable 17.27 multivitamin with protein 200 ml ( 200 ml ) , syrup 17.28 aprin polyster ( std size ) , consumable 17.29 bed sheet white ( 60 inch x 90 inch ) , consumable 17.3 bed sheet cloured 50 inch x 80 inch 17.31 basta cloth ( 36 inch x 36 inch ) , consumable 17.32 compounder coat / lab tec / xry tec ( std size ) , consumable 17.33 curtain green redymade ( 45 inch x 60 inch ) , consumable 17.34 chair cushion box type ( 18 inch x 18 inch ) , consumable 17.35 chair cushion cover ( 19 inch x 19 inch ) , consumable 17.36 front aprin ( std size ) , consumable 17.37 livirise set female saree white polyster green / blue border [ saree + peticot + blouse ] 5 meter 17.38 livirise set male [ pent and shirt ] std size 17.39 mattress 5kg cotton ( 3 ft x 6 ft ) , consumable 17.4 napkin sup. quality std size 17.41 new born baby kit ( [ 4 piece set ] ) , consumable 17.42 whole sheet 35 inch x 35 inch 17.43 patient suit for male / female ( std size ) , consumable 17.44 pillow cover sup. quality ( 17 inch x 27 inch ) , consumable 17.45 pillow with 2kg cotton ( 16 inch x 26 inch ) , consumable 17.46 turkish towel sup. 25 inch x 50 inch 17.47 wollen saluka / coat for 4th class std size 17.48 chloramphenicol eye ointment 1% ( 4 gram ) , tube 17.49 ketoconazole tab 200mg ( ) , tablet 17.5 bupivacaine hydrochloride 0.25% ( 20 ml vial ) , injection 17.51 ondansetron inj ( 2 mg / ml ) , injection 17.52 vitamin b complex injection ( nfi formula 30ml / vial ) , injection 17.53 norfloxacin + metronidazole suspension 100mg+100mg / 5ml ( 30 ml bottle ) , bottle 17.54 temephos ( 50 % ec 5 litre pack ) , consumable 17.55 paper adhesive microporous surgical tape 3 inch m / roll ( 10 roll / pkt ) ( 3 inch x 5 m / roll ( 10 roll / pkt ) ) , consumable 17.56 hydroxypropyl methylcellulose eye drops ( 2% 5 ml vial ) , eye drop 17.57 alpha beta arteether inj 75 mg / ml 1ml 1ml amp ( ) , injection 17.58 metformin 500mg + gliclazide 80mg tablet ( 10x10 ) , tablet 17.59 aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( 10x10 ) , tablet 17.6 micronised progesterone ( 100 mg ) , tablet 17.61 disodium hydrogen citrate 1.25gm / 5ml 100 ml ( 100 ml ) , syrup 17.62 cefuroxime 750mg powder for solution for injection ( 750mg ) , injection powder for 17.63 gluteraldehyde solution 2% ( 5 litre can ) , solution 17.64 chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , solution 17.65 milk of magnesia + liquid paraffin ( 11.25ml+3.75ml ) / 15ml ( 200 ml bottle ) , syrup 17.66 catgut chromic with 1 / 2 cir rb needle 40 mm length 75cm no. 2 consumable ( each ) , consumable 17.67 multivitamine 100ml syrup ( 100 ml ) , syrup 17.68 multivitamin with zinc drop 15ml ( 15 ml ) , drop 17.69 drotaverine ( 80 mg ) , tablet 17.7 isotonic 18 ltr ( each ) , consumable 17.71 hemolynac 3n 2340 500ml ( each ) , consumable 17.72 split septum transparent closed needles connector with two 10 cm pur extension and one non return valve, consumable 17.73 pe arterial catheter with visualization chamber and anti kinking color 20 g, 8 cm length, consumable 17.74 electrolyte solution a 250ml ( 250ml ) , consumable 17.75 tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg pack of 200mdi, inhaler ( 200mdi ) , inhaler 17.76 spinal needle 26 g ( each ) , needle 17.77 cotton khadi dari 3x6 feet 1.4kg per piece 17.78 cotton khadi dari, 4x7 feet, 2.0 kg, per piece 17.79 cotton khadi dari, 4x7 feet, 4.0kg, per piece 17.8 cotton khadi dari, 9x10 feet, 5.0kg, per piece 17.81 cotton khadi dari, 9x12 feet, 6.0kg, per piece 17.82 cotton khadi dari, 10x1.5 feet, 1.2kg, per piece 17.83 cotton khadi dari floor mota per sq. ft 17.84 cotton khadi yoga dari , 2x6 feet, 800gm, per piece 17.85 cotton khadi asana dari, 24x24 inch, per piece 17.86 cotton khadi white bedsheet, 54x90 inch, 500gm, per piece [ kha010 ] 17.87 cotton khadi printed bedsheet, 54x90 inch, 500gm, per piece 17.88 cotton khadi printed bedsheet tiger print, 54x90 inch, 500gm, per piece 17.89 cotton khadi pillow cover, 16x26 inch, per piece 17.9 cotton khadi blanket cover, 54x90 inch, per piece 17.91 cotton khadi pillow, 15x24 inch, 1.0kg, per piece 17.92 cotton khadi matress, 3x6 feet, 5.0kg, per piece 17.93 cotton khadi matress, 3x6 feet, 10.0kg, per piece 17.94 cotton khadi curtain, 2.30mt, per piece 17.95 cotton khadi curtain, 1.75mt, per piece 17.96 cotton khadi bag, 36x36 inch, per piece 17.97 cotton khadi bag, 48x48 inch, per piece 17.98 polyvastra kapda coating, 28 inch, 2 suti, per meter 17.99 polyvastra kapda shirting, 36 inch, 1.5 suti, per meter 18 polyvastra uniform ( pent / shirt / topi ) , 2 suti, per set 18.01 polyvastra uniform ( kurta / payjama / topi ) , 1.5 suti, per set 18.02 polyvastra white sari, 5.50mtr, 1 suti, per piece [ kha026 ] 18.03 polyvastra plane sari colored , 5.50mtr, 1 suti, per piece 18.04 polyvastra blouse, 1.00mtr, 1.5 suti, per piece 18.05 polyvastra peticote, 2.00mtr, 1.5 suti, per piece 18.06 blanket jammu woolen plane, 54x90 inch, 2.200 kg, per piece 18.07 woolen shawl meriono ladies, 40x80 inch, per piece 18.08 woolen coating, 28 inch, per meter 18.09 woolen coating, 54 inch, per meter 18.1 woolen coat, per piece as per measurment 18.11 shoes uniform , per pair as per measurment 18.12 amunation boot, per pair as per measurment 18.13 ankle boot, per pair as per measurment 18.14 ladies sleeper, per pair as per measurment 18.15 leather belt without backaal, per piece as per measurment 18.16 leather belt with backaal , per piece as per measurment 18.17 cream sumag ( ) , cream 18.18 aceclofenac 100mg+paracetamol 325mg tab ( ) , tablet 18.19 h2so4 ( sulphuric acid ) ( 25% 500 ml bottle ) , consumable 18.2 plain vial ( 12 x 75 with screw cap each ) , consumable 18.21 abdominal belt ( 32 inch each ) , consumable 18.22 ecg paper ( chemical coated ) ( 80mmx 20 mtr each ) , consumable 18.23 x ray film fixer ( powder to make 13.5 liters pkt ) , consumable 18.24 x ray film fixer ( powder to make 9 liters pkt ) , consumable 18.25 potassium chloride syrup 200ml ( each ) , syrup 18.26 hematology cell counter reagents lysis solution 500ml ( each ) , solution 18.27 e z cleaner 100ml ( each ) , solution 18.28 rifampicin cap ( 300 mg ) , capsule 18.29 rifampicin cap ( 450 mg ) , capsule 18.3 rifampicin cap ( 600 mg ) , capsule 18.31 diproex er tablet 500mg ( 500mg ) , tablet 18.32 hyoscine butyl bromind 1 mg ( amp ) , injection 18.33 bone wax sterilised ( 2 gm / packet ) , consumable 18.34 i v cannula with inj.valve ( port ) ( size 26g each ) , consumable 18.35 surface and fogging disinfectant stabilised h202, 10 11%w / v with diluted silver nitrate sol. 0.01%w / v ( 5 litre can ) , each 18.36 liquid paraffin 50ml ( bottle ) , consumable 18.37 troponin 1 kit ( 10 test per pack ) , consumable 18.38 serum t3 kit, elisa ( 96 test kit each ) , consumable 18.39 serum t4 kit, elisa ( 96 test kit each ) , consumable 18.4 serum tsh kit, elisa ( 96 / pkt ) , consumable 18.41 silver sulphadiazine cream usp 1% ( 500 gm jar ) , cream 18.42 cannula fixer set ( piece ) , each 18.43 latex examination gloves ( large ) ( 100 / pkt ) ( packet ) , consumable 18.44 latex examination gloves ( medium ) ( 100 / pkt ) ( packet ) , consumable 18.45 latex examination gloves ( small ) ( 100 / pkt ) ( packet ) , consumable 18.46 chromic size 1, 12 foils / pkt ( 1 / 2 cir rb needle 45 mm, length 100 cm ) , needle 18.47 polyamide size 2 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.48 polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , consumable 18.49 chromic ( 12 foils / pkt ) ( 3 / 8 rb needle 30 mm, length 76 cm, size 2 / 0 ) , needle 18.5 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 90 cm size 2 / 0 ) , needle 18.51 polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 20 mm, length 70 cm size 3 / 0 ) , needle 18.52 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 7 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.53 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 8 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant, each ) , tube 18.54 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 4 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.55 tracheostomy tube ( pvc ) sterile single use ( adult ) ( size 5 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction nonirritant ) , tube 18.56 urinary drainage bag ( paediatric ) ( 100 ml / pc, each ) , consumable 18.57 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 16, each ) , consumable 18.58 close wound drainage device under negative pressure ( closed wound suction unit ) size 200 ml ( catheter size 18, each ) , consumable18.59 polyamide size 1 / 0, 12 foils / pkt ( 3 / 8 r cutting needle 45 mm, length 70 cm ) , needle 18.6 polypropylene size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 45 mm, length 90 cm ) , needle 18.61 chromic size 1 / 0 ( 12 foils / pkt ) ( 3 / 8 cir rb needle 40 mm, suture length 76 cm ) , needle 18.62 chromic size 1, ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm, length 76 cm ) , needle 18.63 human albumin 20% ( 50 ml vial ffs glass bottle ) , bottle 18.64 temozolomide ( 20 mg ) , capsule 18.65 ambu bag / resuscitator silicon 200 250 ml infant size each, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) should be multiple times autoclavable ) , consumable 18.66 ldh kit pack ( 50 ml bottle ) , consumable 18.67 neubauers chamber ( each ) , consumable 18.68 biomedical waste collection plastic bag ( yellow ) ( as per attached detail specifications ) ( 450x450 mm 55 micron 100 / pkt ) , consumable 18.69 aso kit ( 25 test / packet ) , consumable 18.7 ambu bag ( silicon type ) paediatrics each 1400 1700 ml with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.71 ambu bag / adult each 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( should have silicon rubber bellow to withstand autoclave at 134 deg.c ) , consumable 18.72 draw sheet ( each ) , consumable 18.73 urine ( multi stripe ) , consumable 18.74 voglibose ( 0.3mg ( mouth dissolving tablet also acceptable ) ) , tablet 18.75 clotrimazole + lignocaine ear drop 1% ( 5ml vial ) , drop 18.76 diphenhydramine syrup ( 12.5mg / 5ml ( 100 ml bottle ) ) , syrup 18.77 ondansetron ( drops ) syrup ( 2mg / 5ml ( 10 ml bottle ) ) , syrup 18.78 paracetamol oral drops ( 100 mg / ml ( 15 ml bottle with dropper ) ) , drop 18.79 gentamicin inj ( 80 mg / ml ( 2 ml amp ) ) , injection 18.8 multivitamin syrup 60 ml ( each 5ml contains vitamin a ( palmitate ) ip 1600 iu+vitamin d3 ip 200 iu ( +vitamin b2 ip 1.00mg+vitamin b6 ip 0.50mg+niacinamide ip 15.00mg+d panthenol ip 1.00mg ( 20% variability in strength or with additional contents acceptable ) ) , syrup 18.81 diclofenac + seratopeptidase ( 50mg + 10mg ) , tablet 18.82 vitamin d3 drop 10ml ( cholecalciferol 400 iu ) ( 10 ml drop ) , drop 18.83 aceclofenac 100mg+paracetamol 325mg+chlorzoxazone 250mg tab ( 250mg ) , tablet 18.84 glutaraldehyde solution 2% in 5 litre can ( 2 strips / vials per each can ) ( 5 litre can ) , consumable 18.85 acyclovir 5% ( 5gm ) , ointment or cream 18.86 biomedical waste collection plstic bag ( black 750 x 900 mm 55 micron 100 / pkt ) , bag 18.87 biomedical waste collection plstic bag ( black 900 x 900 mm 55 micron 100 / pkt ) , bag 18.88 biomedical waste collection plstic bag ( blue 750 x 900 mm 55 micron 100 / pkt ) , bag 18.89 biomedical waste collection plstic bag ( blue 900 x 900 mm 55 micron 100 / pkt ) , bag 18.9 biomedical waste collection plstic bag ( red 750 x 900 mm 55 micron 100 / pkt ) , bag 18.91 biomedical waste collection plstic bag ( red 900 x 900 mm 55 micron 100 / pkt ) , bag 18.92 biomedical waste collection plstic bag ( yellow 750 x 900 mm 55 micron 100 / pkt ) , bag 18.93 biomedical waste collection plstic bag ( yellow 900 x 900 mm 55 micron 100 / pkt ) , bag 18.94 glucometer strips 1 should be able to use capillary blood samples 2 should have expiry as printed on the label of the supplied box ( 3 all strips should have at least one year expiry date from the date of supply 1 glucometer free with each 1 thousand strips rate should be quoted for 50 strip / packet ) , consumable 18.95 endotracheal tubes size 5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.96 endotracheal tubes size 5.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , combi blister pack 18.97 endotracheal tubes size 6 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.98 endotracheal tubes size 6.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 18.99 endotracheal tubes size 7 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19 endotracheal tubes size 7.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.01 endotracheal tubes size 8 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.02 endotracheal tubes size 8.5 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable [ 700627 ] 19.03 endotracheal tubes size 9 cuffed should have low pressure high volume cuff and radio opaque blue ( 25 each ) , consumable 19.04 foleys catheter size 12 2 way ( 10 each ) , consumable 19.05 foleys catheter size 16 2 way ( 11 each ) , consumable 19.06 foleys catheter size 20 2 way ( 12 each ) , consumable 19.07 foleys catheter size 22 2 way ( 13 each ) , consumable 19.08 foleys catheter size 24 2 way ( 14 each ) , consumable [ 700633 ] 19.09 post operative bag with window size 70 mm ( 1 each ) , consumable [ 700634 ] 19.1 post operative bag with window size 100 mm ( 1 each ) , consumable 19.11 cresent knife ( 1 each ) , consumable 19.12 lenstip ( 1 each ) , consumable 19.13 sodium chloride 0.3% iv 100ml ( 1 each ) , injection 19.14 imipenem 250mg+cilastatin 250mg powder for solution ( 1 each ) , injection powder for 19.15 terlipressine inj. 1mg / 10ml vial ( 1 each ) , injection 19.16 clindamycin 300 mg / ml inj ( 1 each ) , injection 19.17 anti h sera 10 ml vial ( each ) , consumable 19.18 anti d sera igg+igm 10ml vial ( each ) , consumable 19.19 anti ab sera igm 5 ml vial ( each ) , consumable 19.2 anti a1 lection sera5 ml vial ( each ) , consumable 19.21 albumin 100 ml bottle ( each ) , consumable 19.22 coombs reagent 5 ml bottle ( each ) , consumable 19.23 hba ag elisa 96 kit 1x96 ( each ) , consumable 19.24 hba ag rapid card test ( each ) , consumable 19.25 microtips ( 2 200 ul ) 1x1000 ( each ) , consumable 19.26 test tube medium ( 12x100 ) 100eack / pkt ( each ) , consumable 19.27 dionised water 5 ltr cane ( each ) , consumable19.28 double blood bag 450 ml cpda ( each ) , consumable 19.29 quadraple blood bag 450 ml sagm ( each ) , consumable 19.3 triple blood bag 450 ml ( cpda ) ( each ) , consumable 19.31 transfer bag ( each ) , consumable 19.32 tissue paper roll ( each ) , consumable 19.33 plain disposable vial 3ml ( each ) , consumable 19.34 edta vaccutainer 3 ml + needle ( each ) , consumable 19.35 v.p shunt high pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.36 v.p shunt medium pressure ( venticular peritonial shunt, ( venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet ) ( each ) , consumable 19.37 balanced salt solution 500 ml bottle ( each ) , consumable 19.38 hydroethyl starch 6% solution with sodium chloride 0.9% 500 ml bottle ( each ) , consumable 19.39 pyrazinamide 750mg tablet ( 10x10 ) , tablet 19.4 folic acid tab ( 400 mcg ) , tablet 19.41 ofloxacin infusion ( 2mg / 1ml ( 100ml ffs bottle ) ) , bottle 19.42 ketamine hydrochloride ( 50mg / ml ( 10 ml vial ) ) , injection 19.43 chromic catgut suture ( 12 foils / pkt ) ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm size 4 / 0 ) , needle 19.44 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 4 , each ) , tube 19.45 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product ( size 3 ) , tube 19.46 b.b silk size 3 / 0 ( 12 foils / pkt ) ( 3 / 8cir rcut needle 26mm length 76 cm ) , needle 19.47 polypropylene size 2 / 0 ( 12 foils / pkt ) ( 1 / 2 cir rb needle 25mm, length 45 cm ) , needle 19.48 ampicillin syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.49 cefadroxil syrup ( 125 mg / 5 ml 30 ml bottle ) , syrup 19.5 methyline blue ( 100 ml ) , solution 19.51 pop bandage ( 6 inch ) , consumable 19.52 pop bandage ( 4 inch ) , consumable 19.53 x ray cassets ( 6.5x8.5 ) , consumable 19.54 x ray cassets ( 8x10 ) , consumable 19.55 x ray hangers ( 6.5x8.5 ) , consumable 19.56 x ray hangers ( 8x10 ) , consumable 19.57 x ray hangers ( 10x12 ) , consumable 19.58 x ray hangers ( 12x15 ) , consumable 19.59 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 100 ml ) , bag 19.6 blood bag with acd / cpd solution ( disposable sterilised ) with needle ( 350 ml ) , bag 19.61 foldable iol sterile lens pc+14d ( lens 2 ) , pc+16d ( lens 3 ) , pc+18d ( lens 5 ) , pc+19d ( lens 5 ) , pc+19.5d ( lens 5 ) , pc+20d ( lens 15 ) , pc+20.5 ( lens 15 ) , pc+21d ( lens 13 ) , pc+21.5d ( lens 10 ) , pc+22d ( lens 10 ) , pc+22.5d ( lens 5 ) , pc+23d ( lens 5 ) , pc+24d ( lens 3 ) , pc+26d ( lens 2 ) ( ( one box should contain 100 pieces as per specification of power given ) , lens ( attached specification ( 100 lens per box ) ) , consumable 19.62 erythromycin ( as estolate ) ( 125mg / 5ml, 60ml bottle ) , suspension 19.63 abdominal belt ( 36 inch each ) , consumable 19.64 abdominal belt ( 38 inch each ) , consumable 19.65 abdominal belt ( 34 inch each ) , consumable 19.66 dengu card antigen ( 25 card / pkt ) , consumable 19.67 povidone iodine solution 5% ( 500 ml ) , bottle 19.68 total parenteral nutrition ( including carbohydrate + proteins + fats solution 2000 ml ) , infusion 19.69 pregnancy test card ( 10 card pack ) , consumable 19.7 glucose pouch ( 100 gram pack ( mfg bhandari products ) ) , consumable 19.71 brain thromboplastin ( 5ml bottle ) , consumable 19.72 swab stick with tube sterile ( 70 80 mm length 10 15 mm diameter ) , unit 1 ( 100 / pkt , packet ) , consumable 19.73 blood grouping anti sera a monoclonal ( 10 ml vial ) , consumable 19.74 blood grouping anti sera b monoclonal ( 10 ml vial ) , consumable 19.75 blood grouping anti sera d monoclonal ( 10 ml vial ( mfg tulip diagnostics ) ) , consumable 19.76 safranine ( gram stain ) ( 500 ml bottle ( mfgsunlabs ) ) , consumable 19.77 anti a sera igm ( 10 vial ) , consumable 19.78 anti b sera igm ( 10 vial ) , consumable 19.79 bovine albumin ( each ) , consumable 19.8 coombs ahg sera 5ml ( each ) , consumable 19.81 flow regulator ( dial flow ) ( each ) , consumable 19.82 l alanyl l glutamine solution for infusion ( 20%w / v ) ( each ) , consumable 19.83 disinfectant with stabilizer by 0.01%w / v agn03 and h2p04 ( each ) , consumable 19.84 insulin syringe ( each ) , consumable 19.85 disposable sterile hypodermic syringe 10ml ( each ) , consumable 19.86 iv mannitol ( 100 ml ) , injection 19.87 human normal immunoglobin ( 5gm / 100ml ) , injection 19.88 iv cannula with inj valve ( 20g ) , consumable 19.89 iv cannula with inj valve ( 18g ) , consumable 19.9 sevoflurane 20cc ( each ) , consumable 19.91 patch buprenorphine ( 10mcg ) , consumable 19.92 patch buprenorphine ( 20mcg ) , consumable 19.93 propofol 1% ( 10ml / 5ml 20ml ) , injection 19.94 intravenous immuglobin ( ivig ) ( each ) , injection 19.95 sodium thiopentone ( 500mg ) , injection powder for 19.96 ranibizumab inj ( 10ml / mg ) , injection 19.97 trastuzumav inj ( 440mg ) , injection 19.98 ibandronic acid inj ( 6mg ) , injection 19.99 everolimus tab 10mg ( 4x7 ) , tablet 20 cell pack for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 20000 ml ) , consumable 20.01 stromatolyser 4dl for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.02 sstromatolyser 4ds for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 126 ml ) , consumable 20.03 sulfolyser for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 5000 ml ) , consumable 20.04 cell clean for 5 part hematology analyser ( model : sysmex xs 800i ( japan ) ) ( pack size 50 ml ) , consumable 20.05 isotonac 3000 pack size 18 l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.06 hemolynac 3n 2340 pack size 500 ml ( cell counter ( model no mek 6420p japan ) ) , consumable 20.07 cleanac 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.08 cleanac 3 4000 pack size 5l ( cell counter ( model no mek 6420p japan ) ) , consumable 20.09 albumin ( mfg pathogyme diagnostics ) ( 200 ml ( 4 x 50 ml ) ) , consumable 20.1 barium chloride 10% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.11 basic carbol fuchsin for afb staining ( mfg precious life care pvt ltd ) ( 25 gram / packet ) , consumable 20.12 crp test kit ( latex / card ) , kit of 25 tests ( 25 test / kit ) , consumable 20.13 field stain a ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.14 field stain b ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.15 fouchets reagent ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.16 g6pd deficiency test kit ( mfg pathogyme diagnostics ) ( 10 test / kit ) , consumable 20.17 gram iodine ( gram stain ) ( mfg precious life care pvt ltd ) ( 100 ml bottle ) , consumable 20.18 leishman stain ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable [ 700732 ] 20.19 methyl blue for ( z n ) ( mfg precious life care pvt ltd ) ( 125 ml bottle ) , consumable 20.2 platelet dilution fluid ( mfg precious life care pvt ltd ) ( 100 ml ) , consumable 20.21 rbc dialuation fluid ( 500 ml bottle ) , consumable [ mis98 ] 20.22 serum creatinine ( 100 ml bottle ( 2 x 50 ml ) ) ( consumable ) , consumable 20.23 sgot ( 25 ml ) , consumable 20.24 sodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.25 trisodium citrate 3.8% ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.26 uric acid ( mfg pathogyme diagnostics ) ( 50 ml ( 2 x 25 ml ) ) , consumable [ 700739 ] 20.27 usg gel ( 250 ml bottle ) , consumable 20.28 wbc dialuation fluid ( mfg precious life care pvt ltd ) ( 500 ml bottle ) , consumable 20.29 foleys urinary catheter 2 way ( size 22 each ) , consumable 20.3 suction catheter, sterile ( size fg 20 ( disposable, sterile each ) ) , consumable 20.31 suction catheter, sterile ( size fg 22 ( disposable, sterile each ) ) , consumable 20.32 suction catheter, sterile ( size fg 6 ( disposable, sterile each ) ) , consumable 20.33 corrugated drainage sheet, sterile, multichannel, single use ( 2 inch x 6 inch ( pvc ) piece ) , consumable 20.34 infant feeding tube ( 10 g each piece, each ) , consumable 20.35 infant feeding tube ( 7g each piece, each ) , consumable 20.36 ryles tube ( size 14 each piece ) , consumable 20.37 cyanemeth solution for hb ( mfg by beacon diagnostic ) ( 5 lit can ) , consumable 20.38 edta solutions k3 ( 500 ml bottle ) ( bottle ) , consumable 20.39 total protein ( mfg by beacon diagnostic ) ( 100 ml ) , consumable 20.4 vdrl kit ( strip ) ( mfg by alere ) ( 50 test / kit ) , consumable 20.41 serum amylase ( 100 ml ) , consumable 20.42 ra factor rapid kit 1 ) should be based on latex agglutination slide test 2 ) qualitative and semi quantative testing facility possible 3 ) test speed must be less than 2 minutes ( 25 test / kit ) , consumable 20.43 leuprolide depot inj ( 3.75mg ) , injection 20.44 linazolid ( 300ml ) , injection 20.45 moxifloxacin ( 100ml ) , injection 20.46 ofloxacin+ metronidazole ( 30ml ) , syrup 20.47 amphotericin b inj ip ( 50 mg ) , injection 20.48 colistinethate sodium inj bp ( 1 million iu ) , injection 20.49 permethrin 5% ( 30 gm ) , cream 20.5 n s 3% hypotonic ( 100ml ) , injection 20.51 pilocarpine nitrate inj. ip 0.5 % w / v ( 1 ml ) , injection 20.52 carboxymethyl cellulose 0.5% eye drop ( 5 ml ) , eye drop 20.53 hydroxyethylstarch 3% ( 500 ml ) , injection 20.54 dialysis starting kit disposable:a ) sterile tray with top ( disposable ) , size not less than 30x30cm b ) sterile drape size not less than 45x45 cm 1no c ) cotton ball 6 no d ) ( d ) cotton gauze pieces 1, e ) artery forceps 1 no ( disposable ) ) , consumable 20.55 tourniquet with belt ( mfg by precious life care pvt ltd ) ( good quality pairs ) , consumable 20.56 medical nitrous oxide gas in jambo size cylinder ( d type ) , miscellaneous 20.57 medical nitrous oxide gas in medium size cylinder ( b type ) , miscellaneous 20.58 medical nitrous oxide gas in small size cylinder ( a type ) , miscellaneous 20.59 medical oxygen gas ip in jambo size cylinder ( d type ) , consumable 20.6 medical oxygen gas ip in medium size cylinder ( b type ) , miscellaneous 20.61 medical oxygen gas ip in small size cylinder ( a type ) , miscellaneous 20.62 carbondioxide gas in medium size cylinder ( b type ) , miscellaneous 20.63 carbondioxide gas in small size cylinder ( a type ) , miscellaneous 20.64 amlodipine ( 10mg ) , tablet 20.65 erythomycin stearate ( 250mg ) , tablet 20.66 intravenous fat emulsion 20% w / v ( 20% w / v ) , bottle 20.67 sevoflurane usp inhalation anesthetic 250 ml ( 250 ml ) , bottle 20.68 dexmedetomidine hydrochloride injection 1ml amp ( 1 ml amp ) , ampule 20.69 co trimoxazole oral suspension ip ( 5 ml each trimethoprim 40 mg sulphamethoxazole 200 mg ) , bottle 20.7 fistula sterilized twin needle ( 16 g ( two needle pack ) ) , consumable 20.71 a v fistula sterilized twin needle ( 17 g ( two needle pack ) ) , consumable 20.72 a v blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzers ) with side tubing ( for heparinization and av pressure monitoring ) ce and iso certificate essential with protector for all machines types and dialysers ( post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality, each ) , consumable 20.73 protien ( total ) mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.74 protien ( urine ) ba 400 biosystems diagnostics pvt ltd ( 240 ml ) , consumable 20.75 creatinine mfg by ba 400 biosystems diagnostics pvt ltd ( 600 ml ) , consumable 20.76 protein ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.77 creatinine 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.78 glucose 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.79 cholesterol 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.8 bilirubin ( total ) 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.81 urea / bun � uv 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.82 uric acid 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.83 triglyceride 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.84 ast / got 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.85 alt / gpt 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.86 albumin 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.87 calcium arsenazo 600 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.88 cholesterol hdl direct 160 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.89 alkaline phosphatase ( alp ) dea 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.9 bilirubin ( direct ) as 300 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.91 conc washing solution 500 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.92 reaction rotor 10 pc ( model ba 400 system ( mfg bybio system ) ) , consumable 20.93 bilirubin standard 1x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.94 biochemistry calibrator 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.95 hdl / ldl standard 1x1 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.96 biochemistry control serum l1 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.97 biochemistry control serum l2 5x5 ml ( model ba 400 system ( mfg bybio system ) ) , consumable 20.98 sodium chloride 0.45% + dextrose 5% ( 500 ml ffs bottle ) , injection 20.99 femoral catheters single lumen set adult ( size 6f to 8f, length 13 cm to 15 cm, each ) , consumable 21 femoral catheters single lumen set pediatric ( size 3f to 4f, length 13 cm to 15 cm or less ) , consumable 21.01 calcium phosphate ( 2 : 1 ratio ( 100 ml bottle ) ) , syrup ( each 5 ml contains : calcium 82 mg + vitamin d3 ( cholecalciferol ) 200 iu + vitamin b12 ( cynocobalamin ) 2.5 mcg ) , syrup 21.02 imatinib cap / tab ( 100 mg ) , tablet or capsule 21.03 tamsulosin ( 0.4mg ) , tablet 21.04 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid ( 5 ltr can ) , consumable 21.05 sterilant hot disinfectant for dialysis containing 21% ( approx ) citric acid, malic acid, lactic acid ( 5 ltr can ) , consumable 21.06 hemodialysis powder for bicarb made ( part a powder to make 10 ltr + part b 500gm 2 / pkt ) , consumable 21.07 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( straight ) ) , consumable 21.08 adult double lumen catheter set ( size: 11.5 fr 12 fr, 13cm to 15cm ( curved ) ) , consumable 21.09 femoral guide wires : straight / j tip ( ( 0.325 mm size ) sterile: ce / iso13485 marked ) , consumable 21.1 electrolyte m ( multi electrolyte with 5% dextrose injection type iii ip ) i / v fluid each 100ml contains: ( anhydrous dextrose 5g; sodium acetate trihydrate ) ( 500 ml ffs bottle ) , injection 21.11 disposable pricking lancet ( mfg by precious life care ) ( pkt of 200 units ) , consumable 21.12 echo jelly 250 ml ( mfg by precious life care ) , bottle 21.13 hub cutter non electric lockable safety portable box for disposal of hypodermic needles ( cuts the needle from the hub of machine ) , each 21.14 disposable sharp collection containers ( 1.5 l mfg by precious life care ) , each 21.15 disposable sharp collection containers ( 5 l ( mfg by precious life care ) ) , each 21.16 ecg jelly 250 gms bottle ( mfg by precious life care ) , bottle 21.17 umbical cord clamps plastic material ( box of 100 clamps ) ( mfg by precious life care ) , consumable 21.18 rib belt large ( each ) , each 21.19 rib belt medium ( each ) , each 21.2 rib belt small ( each ) , each 21.21 diagnostic strips for urine sugar / albmin packing: amber colored, 100 strips / pkt ( packet ) , consumable 21.22 nitrofruantoin ( 100mg ) , tablet capsule 21.23 biphasic isophane insulin ( 30 / 70 100iu / ml ( 10 ml vial ) ) , injection 21.24 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder ( 5 kg packet ( mfg by zenith chemicals allied industries ) ) , consumable 21.25 iron ferrous sulphate folic acid 100ml ( each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg ) , syrup 21.26 hypodermic needles for single use bis gauze ( 23 length, 25 mm + 1 ) , needle 21.27 bcg ( 1 ml each ) , syrings 21.28 disposable ( 24 g each ) , needle 21.29 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized. ( 10 ml ) , syrings 21.3 disposable needles is 10654:2002 ( 23g ) , needle 21.31 short iv catheter with straight / j tip guidewire ( l 4, fr 2, g 22 ) , consumable [ mis109 ] 21.32 disposable syringe ( for vitamin k inj ) ( 1ml with needle 26g ) , consumable 21.33 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 5ml ) , syrings [ 700846 ] 21.34 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 3ml ) , syrings 21.35 reuse prevention syringe sterile single use reuse prevention syringe with fixed / detachable needles complaint to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , syrings 21.36 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 2 way each ) , consumable 21.37 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 18 2 way, each ) , consumable 21.38 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 16 2 way each ) , consumable 21.39 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( 2 way size 8, each ) , consumable 21.4 latex based baloon capacity ( 3ml ) foleys urinary catheter peadiatrics ( size 10 , each ) , consumable 21.41 sgpt100 ml ( 4 x 25 ) , consumable 21.42 alkaline phosphate ( 100 ml ( 5 x 20 ) ) , consumable 21.43 reagent for hdl cholestrol test ( 100 ml ( 4 x 25 ) ) , consumable 21.44 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce / iso13485:2003sterlised ) , consumable 21.45 clopidogrel + aspirin ( 75 mg + 150 mg ) , capsule 21.46 alphacypermetherin 5% wdp ( as per attached specifications in rc ( confirming to is 15603 standards to be supplied in in 25kg or 20kg pack . 1 metric ton ) ) , consumable 21.47 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ( 5 / 0 12 foils / pkt ) ) , sutures 21.48 testcha ( 23 ) , ampoule 21.49 black braided silk with 1 / 2 cir cutting needle 30mm length 75 cm ( 1 / 0 12 foils / pkt ) , consumable [ mis18 ] disposable syringes is 10258:2002 with needle is 10654:2002, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.51 sterile hypodermic syring with needle, mfg by ph health care pvt ltd ( 10ml ) , consumable 21.52 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd ( 20 ml ) , consumable [ 700863 ] 21.53 double lumen polyurethane cvp catheter 5 fr ( length 13 to 15 cm ) , consumable [ 700864 ] 21.54 double lumen polyurethane cvp catheter 4 to 5 fr ( length 8 to 13 cm, sample to be submitted by firm latest by 10 days from the date of bid opening , each ) , consumable [ 700865 ] 21.55 triple lumen polyurethane cvp catheter 7 to 7.5 fr ( g 14 16x18x18x18, length 15 16cm, each ) , consumable 21.56 triple lumen polyurethane cvp catheter 7 to 7.5fr ( g 14 16x18x18, length 16 20 cm, each ) , consumable 21.57 spinal needle ( g 22 l 120 mm ) , consumable 21.58 triple lumen jugular catheter kit, ( size 12f, 16+ / 1cm, kit ) , consumable 21.59 nylon suture spatulated micropoint reverse cutting needle, double armed suture size 9 0 ( 12 foils / pkt ) , sutures nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , sutures 21.61 endotracheal tube internal with radioopaque line ( dia 2.5 mm to 5 mm, each ) , consumable 21.62 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line ( size 9.5 , each ) , consumable 21.63 latex based baloon ( capacity 30 50 ml ) foleys urinary catheter ( 3 way size 20 ) , consumable 21.64 spinal needle with metal stylet, ( g 23 ) , needle [ 700875 ] 21.65 urinary drainage bag cap with non return valve ( eo sterile ) ( 2 litre, each ) , consumable 21.66 disposable spinal needle, mfg by alpha medicare & devices pvt. ltd. ( 18 no ) , needle 21.67 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 22 no ) , needle 21.68 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd. ( 23 no ) , needle 21.69 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 20 mtr roll ) , consumable 21.7 ecg paper ( chemical coated ) , mfg by life o line technologist ( 50mm x 30 mtr. roll ) , consumable 21.71 ecg paper ( wax coated ) ( 50mm x 30 mtr, roll ) , consumable 21.72 ecg roll three channel mfg by life o line technologist ( 50 mm x 20 mtr ) , consumable 21.73 egc roll, mfg by life o line technologist ( 66 mm x 15 mm roll ) , consumable 21.74 icd bag, mfg by life o line technologist ( 1000 ml ) , bag 21.75 nebulization mask kit, mfg by life o line technologist ( pediatrics ) , consumable 21.76 cloth based surgical adhesive tape roll ( 1 inch x 5 mtr / roll ) , consumable 21.77 mva kit ( mannual vaccum aspiration kit ) ( as per attached specification ) , consumable 21.78 latex based baloon capacity ( 30 50ml ) foleys catheter ( size 14 3 way ) , consumable 21.79 latex based baloon capacity ( 3 ml ) foleys catheter ( way, size 12 ) , consumable 21.8 scalp vein set ( size 24g, disposable , each ) , consumable 21.81 paracetamol + chlorpheniramine ( 100 ml syrup ) , syrup 21.82 calcium carbonate + vitamin d3 + zinc ( 200 ml syrup ) , syrup 21.83 size of film 14 inch x 17 inch ( dihl ) , consumable 21.84 size of film 10 inch x 12 inch ( dihl ) , consumable 21.85 size of film 8 inch x 10 inch ( dihl ) , consumable 21.86 size of cassette ( 14 inch x 17 inch ) , consumable 21.87 size of cassette ( 10 inch x 12 inch ) , consumable 21.88 size of cassette ( 8 inch x 10 inch ) , consumable 21.89 hiv elisa kit ( hiv micro elisa ag+ab 4th generation ) ( 96 test kit ) , consumable 21.9 hcv elisatest kit pack size: 96 well per kit ( rate should be quoted for 1 kit containing 96 wells ) , consumable 21.91 triple blood bag ( sagm ) ( 450 ml ) , consumable 21.92 size of film 10 inch x 12 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.93 size of film 14 inch x 17 inch digital x ray film ( dihl ( pack of 100 ) ) , film 21.94 size of film 8 inch x 10 inch digital x ray film ( dihl ( pack of 150 ) ) , film 21.95 mindray bc 5300, auto hematology analyzer part 5 ( m 53 diluent ) , consumable 21.96 mindray bc 5300, auto hematology analyzer part 5 ( m 53 lh lyes ) , consumable 21.97 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( i ) lyes ) , consumable 21.98 mindray bc 5300, auto hematology analyzer part 5 ( m 53 leo ( ii ) lyes ) , consumable 21.99 mindray bc 5300, auto hematology analyzer part 5 ( m 53 cleaner ) , consumable 22 mindray bc 5300, auto hematology analyzer part 5 ( m 53 probe cleaner ) , consumable 22.01 mindray bc 5300, auto hematology analyzer part 5 ( quality control ) , consumable 22.02 mindray bc 2800, auto hematology analyzer ( m 18 diluent ) , consumable 22.03 mindray bc 2800, auto hematology analyzer ( m 18 cfl lyes ) , consumable 22.04 mindray bc 2800, auto hematology analyzer ( m 18 rinse ) , consumable 22.05 mindray bc 2800, auto hematology analyzer ( m 18 cleanzer ) , consumable 22.06 mindray bc 2800, auto hematology analyzer ( m 18 probe cleanzer ) , consumable 22.07 mindray bc 2800, auto hematology analyzer ( paper roll ) , consumable 22.08 mindray bc 2800, auto hematology analyzer ( quality control ) , consumable 22.09 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( pt � sta neoplastin cl + 5 ) , consumable 22.1 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable 22.11 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( aptt sta cepha screen 4 ) , consumable [ 700045 ] 22.12 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( sta cacl2 ) , consumable 22.13 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stadesorb u ) , consumable 22.14 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacoagcontrol n+p ) , consumable 22.15 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stasatellite cuvette ) , consumable 22.16 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( stacleaner solution ) , consumable 22.17 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine ( white stirrer for pt test ) , consumable 22.18 carelyte 503 ( calibrator 1&2 ) , consumable 22.19 carelyte 503 ( enzyme cleaning solution ) , consumable 22.2 carelyte 503 ( thermal printer roll ) , consumable 22.21 carelyte 503 ( sodium electrode ) , consumable 22.22 carelyte 503 ( pottasium electrode ) , consumable 22.23 carelyte 503 ( refernce electrode ) , consumable 22.24 carelyte 503 ( pump tubing ) , consumable 22.25 carelyte 503 ( complete tubing set ) , consumable 22.26 blood gluose ( god / pod ) semi auto end point ( 1000 ml ) , consumable 22.27 blood urea ( bun ) uv ( 1000 ml ) , consumable 22.28 s direct billirubin ( 1000 ml ) , consumable 22.29 hba 1 c ( glycosylated hb ) ( 100 tests ) , consumable 22.3 microalbumin urine ( 100 tests ) , consumable 22.31 apo a ( 100 tests ) , consumable 22.32 apo b ( 100 tests ) , consumable 22.33 crp ( hs ) ( 100 tests ) , consumable 22.34 s. transferin ( 100 tests ) , consumable 22.35 s. tibc kit ( 100 tests ) , consumable 22.36 s. b12 ( 100 tests ) , consumable 22.37 s. folate ( 100 tests ) , consumable 22.38 s.vitamin d3 ( 100 tests ) , consumable 22.39 s. iron ( ferrozine ) ( 100 tests ) , consumable 22.4 hdl ( each ) , consumable 22.41 s. ferritin ( each ) , consumable 22.42 s.calcium ( each ) , consumable 22.43 s. phosphorus ( each ) , consumable 22.44 s. total protein ( each ) , consumable 22.45 s.albumin ( each ) , consumable 22.46 s.lipase ( each ) , consumable 22.47 pt kit ( time ) ( ist 1.00 1.20 ) ( 2x4 ml ) , consumable 22.48 apit ( 2x4 ml ) , consumable 22.49 fdp kit ( 4 ml ) , consumable 22.5 d dimer ( 10x3 ml ) , consumable 22.51 thrombin time kit ( 10x3 ml ) , consumable 22.52 factor vii deficient plasma ( less than 1% ) ( 10x30 ml ) , consumable 22.53 factor ix deficient plasma ( less than 1% ) ( 10x1 ml ) , consumable 22.54 staining kit reticulin ( 100 test ) , consumable 22.55 staining kits ( 100 test ) , consumable 22.56 ptah staining kits ( 100 test ) , consumable 22.57 masson trichrome staining kits ( 100 test ) , consumable 22.58 quick diff staining kits for pap smear ( 100 test ) , consumable 22.59 troponin t ( ctn t ) card test ( 50 test ) , consumable 22.6 coombs serum ( anti human globulin ) ( polyvalent ) ( 1x5=5 ml ) , consumable 22.61 bovine albumin ( 22% w / v ) ( 1x5=5 ml ) , consumable 22.62 anti d ( polyvalent ) ( 1x10 ml ) , consumable 22.63 benedicts qualitative reagent ( 1x5 lit ) , consumable 22.64 absolute alcohol ( ethanol ) ( 1x500 ml = 500 ml ) , consumable 22.65 isopropyl alcohol ( propanol ) ( 1 x 2.5 lit ) , consumable 22.66 xylene ( sulphur free ) ( 1 x 2.5 lit ) , consumable 22.67 clotrimazole 1%w / v +lignocaine 2%w / v ( 10ml ) , eye drop 22.68 aztreonam inj ( 500 mg ) , injection 22.69 glycopyrolate 0.5 mg + neostigmine 2.5 mg ( 5ml ) , injection 22.7 dexmedetomidine hydrochloride injection ( 100mg ) , injection 22.71 dextran iv 40% ( 500ml ) , injection 22.72 ampicilline + cloxacilline ( 250 mg + 250 mg ) , injection per vial 22.73 losartan ( 25 mg ) , tablet 22.74 hydroxyethyl starch 6% ( each ) , suspension 22.75 antacid ( 250mg ) , syrup 22.76 dinoprostone gel ( 0.5 mg ) , gel 22.77 insulin biphasic / premix 50:50 ( 40 iu / ml ( 10 ml vial ) ) , injection 22.78 insulin biphasic lispro 25:75 100 iu / ml ( 3 ml cartridge ) ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) , cartridges [ 120713 ] 22.79 dpx ( 1 x 250 lit ) , consumable 22.8 ea 50 ( modified ) ( for cytology ) ( 1x125 ml ) , consumable 22.81 og6 ( for cytology ) ( 1x125 ml ) , consumable 22.82 paraffin wax histology ( 58 60 ) ( 1x1 kg = 1 kg ) , consumable 22.83 polytaxine powder ( 1x5 gm ) , consumable 22.84 haematoxyline solution ( harris ) ( 1x125 ml ) , consumable 22.85 formaldehyde 40% ( conc. formaline ) ( 1 x 30 lit ) , consumable [ 710021 ] 22.86 filter paper sheet ( ( whatmann no 01 ) sheets ) , consumable 22.87 ( ss ) powder ( 1x25 gm = 25 gm ) , consumable 22.88 eosin 2% solution ( 1x250 ml ) , consumable 22.89 reticulocyte kit ( 100 tests ) , consumable 22.9 leishmann stain sol with buffer tablet ph ( 1x5 lit ) , consumable 22.91 giemsa stain ( merck / span ) ( 125 ml ) , consumable 22.92 stain ( 1x25 gm = 25 gm ) , consumable 22.93 cytochrome stain with buffer ( 500 ml ) , consumable 22.94 methanol ( acetone free ) for leishman staining ( 1x2.5 lit ) , consumable 22.95 fauchets reagents ( 125 ml ) , consumable 22.96 esbachs reagent ( 125 ml ) , consumable 22.97 sodium nitroprusside ( 100 gm ) , consumable 22.98 occult blood test kit ( haem test kit ) ( 1 x 100 strips ) , consumable 22.99 hydrogen peroxide ( conc. ) h2o2 ( 500 ml ) , consumable 23 ehrilichs aidehyde reagen ( 2x250 ml ) , consumable 23.01 conc hcl ( 1x500 ml = 500 ml ) , consumable 23.02 con. ( hno3 ) nitric acid ( 2.5 liter ) , consumable 23.03 glacial acetic acid ( 2.5 liter ) , consumable 23.04 liquor ammonia ( 500 ml ) , consumable 23.05 pandys reagent csf ( 125 ml ) , consumable 23.06 ammonium sulphate ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.07 sodium metabisuiphite ( na2s2o3 ) ( analar ( gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.08 sodium hydroxide ( naoh ) ( analar / gr / ar ) ( 1x500 gm = 500gm ) , consumable 23.09 citric acid analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.1 trisodium citrate analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.11 nah2 po4 ( anhydrous ) analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.12 poly l lysine sol ( for immunochisto chemistry ) ( 1x100 ml ) , consumable 23.13 poly l lysine coated slides ( 50 lidess x 1 ) , consumable 23.14 indicator sol, for ph ( litmus sol ) ( 1x500 ml = 500 ml ) , consumable 23.15 sodium chloride nacl analar / gr / ar ( 1x500 gm = 500gm ) , consumable 23.16 iron alum a ) ferric amino sulphate ( 1x500 ml = 500 ml ) , consumable 23.17 aluminium potassim sulphate ( each ) , consumable 23.18 mercuric oxide ( 25 gm ) , consumable 23.19 gold chloride ( 1x1 gm ) , consumable 23.2 sliver nitrate ( 1x25 gm = 25 gm ) , consumable 23.21 drabkin solution for hb ( 1x5 lit ) , consumable 23.22 distilled water ( 1x5 lit ) , consumable 23.23 centchroman ip ( 30 mg ) , tablet 23.24 non ionic contrast media ( 350 mg , 100ml ) , consumable 23.25 protein ( total ) ( 600 ml ) , consumable 23.26 hdl / ldl standard ( 1x1 ml ) , consumable 23.27 biochemistry control serum l1 ( 5x5 ml ) , consumable 23.28 biochemistry control serum l2 ( 5x5 ml ) , consumable 23.29 dexamethasone sodium inj 4mg / 2ml ( 2ml vial ) , injection 23.3 tablet domeperidone ( 10mg ) , tablet 23.31 pantaprazole ( 40mg ) , injection 23.32 ceftriaxone ( 1g ) , injection 23.33 human insulin regular / soluble ( 40iu / ml ( 10ml vial ) ) , injection 23.34 human insulin regular / soluble ( 100iu / ml ( 10ml vial ) ) , injection 23.35 basal insulin glargin ( 100iu / ml ( 10ml vial ) ) , injection 23.36 ultravist 300mg ( 50 ml / vial ) , injection 23.37 tab amitryptyline ( 25 mg ) , tablet 23.38 tab citalopram ( 20 mg ) , tablet 23.39 sics blade cresent ( 15 degree ) , consumable 23.4 sics blade sideport ( sideport entry knife ) , consumable 23.41 eye drape disposable towel ( size 70*70cm area 08*08 ) , consumable 23.42 id wrist band ( identification for mother / child specific colour ) ( wrist band / no ) , consumable 23.43 balance salt solution for irrigation 500 ml ffs bottle ( 500ml bottle ) , eye applicap 23.44 trypan blue dye ( 1ml ) , consumable 23.45 x ray developer powder ( 13.5 liter ) , consumable 23.46 surgical spirit ( 100ml ) , bottle 23.47 hemotocyto meter ( meter ) , consumable 23.48 haemoglobin tube ( tube ) , consumable 23.49 multivitamin without iron syrup ( 100ml ) , syrup 23.5 haemoglobi pippate ( pippate ) , consumable 23.51 bloting paper ( paper ) , consumable 23.52 blood cell counter key ( key ) , consumable 23.53 barium chloride powder ( powder ) , consumable ] 23.54 edta powder ( 250 gm ) , consumable [ ] 23.55 insulin biphasic / premix 50:50 ( 100 iu / ml ( 10 ml vial ) ) , injection 23.56 montex test 2tu ( 1 vial ) , consumable 23.57 stainic rack ( each ) , consumable 23.58 intra camral saline ( r.l ) sep ( eto sterelied, specialy ( manufactured for intra camral ) , consumable [ 23.59 plastic bottle ( 300ml ) , consumable 23.6 plastic bottle ( 500 ml ) , consumable 23.61 sics blade ( disposable ) cresent nife 2.8 ( specialy long matel handle, micro sharp edge, isi / iso ( manufaturer, eto stereliged ) , consumable 23.62 suter ( 8 / 0 ( 01 box ) ) , consumable 23.63 pistol grip curvedcoagulating shears ergonomic handle with att shaft lenght 36cm can seal blood vessel upto and inclding ( 5mm in diameter ) , consumable [ 23.64 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 14cm and should be both hand and ( foot activated ) , consumable ] 23.65 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 9cm can seal blood vessels upto and including 5 mm in diameter ) , each [ 710092 ] 23.66 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 25cm and should be both hand and ( foot activated ) , consumable [ 710095 ] 23.67 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft ( lengths 17 cm can seal blood vessels upto and including 5 mm in 23.68 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated ) , consumable 23.69 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 35cm and should be both hand and ( foot activated ) , consumable [ 710096 ] 23.7 pistol grip curved coagulating shears with ergonomic handle in the ( folloeing shaft lengths 36 cm can seal blood vessels upto and including 5 mm in diameter ) , consumable [ 710099 ] 23.71 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand ( foot activated with curved tip ) , consumable 23.72 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 45cm and should be both hand ( foot activated with curved tip ) , consumable 23.73 pistol grip curved coagulating shears with ergonomic handle shaft ( langths 36 cm can seal blood vessels upto and including 5 mm in diameter att ) , each 23.74 complete absorbable mesh fixation device with minimum strap length 7mm2point fixation to hold the mesh and device should be of ( 25 absorbable straps ) , consumable 23.75 handpiece ( transducer ) , each 23.76 handpiece ( blue ) , consumable 23.77 fistula and wound management system ( size 104 159 mm ) , consumable 23.78 fistula and wound management system ( size 156 228 mm ) , consumable 23.79 fistula and wound management system ( size 208 297 mm ) , consumable 23.8 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 1x2 approved by us fda ) , consumable 23.81 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 2 x 4 approved by us fda ) , consumable 23.82 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures ( size 4 ) , consumable 23.83 v.p.shunt ( medium pressur ) , consumable 23.84 v.p.shunt ( low pressur ) , consumable 23.85 pistol grip curved coagulating shears with ergonomic handle in the following shaft lengths 23 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable 23.86 pistol grip curved coagulating shears with ergonomic handle shaft lengths 45 cm. can seal blood vessels upto and including ( 5mm in diameter ) , consumable [ 720016 ] 23.87 dissecting hook having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.88 curved blade having telescoping shaft ( 10cm 14cm with integrated hand activation control buttons ) , consumable 23.89 5mm lap dissecting hook ( 32 cm long ) , consumable 23.9 blood culture media aerobic for adult ( bact / alert fa plus ) , each 23.91 blood culture media aerobic for pediatric ( bact / alert pf plus ) , each 23.92 advanced rf energy hand instruments of 5mm shaft diameter for open procedures with shaft ( lengths 14cm and should be both hand & foot activated with curved tip ) , consumable 23.93 blood culture media anaerobic for pediatric ( bact / alert pf plus ) , each 23.94 blood culture media anaerobic for adult ( bact / alert fa plus ) , each 23.95 blood culture media fungus bottles per year, fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.; fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested. ( ) , consumable 23.96 blood culture media mycobacterium spp ( bact / alert mp ( plastic ) ) , each 23.97 individual identification panel for aerobic gram positive organism ( gpid ) , each 23.98 individual identification panel for aerobic gram negative organism ( gnid ) , each 23.99 individual ast panel for gram positive organism ( gp p628 ) , each 24 advanced rf energy hand instruments of ( 5mm shaft diameter for open procedures with shaft lengths 25cm and should be both hand & foot activated with curved tip ) , consumable 24.01 individual ast panel for gram negative organism ( gn n280 ) , each 24.02 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 35cm and should be both hand & foot activated with curved tip ) , consumable 24.03 individual identification panel for anaerobic gram negative organism ( anc ) , each 24.04 individual identification panel for anaerobic gram positive organism ( anc ) , each 24.05 individual identification panel for fungus ( yst ) , each 24.06 individual ast panel for fungus ( ast ys07 ) , each 24.07 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths ( 45cm and should be both hand & foot activated ) , consumable 24.08 advanced rf energy hand instruments of 12mm shaft diameter for open procedures with shaft lengths ( 22cm and should be both hand & foot activated ) , consumable [ 720039 ] 24.09 diltiazem tablet ( 60 mg ) , tablet 24.1 altracurium ( 10mg / ml, 2.5ml vial ) , injection 24.11 heamoglobin colour scale book with special strip complete ( 1 x 200 ) , consumable 24.12 paracetamol 150 mg / ml ( 15 ml bottle with dropper ) , drop 24.13 ofloxacin + dexamethosone ( 0.3%+ 0.1% ( 10 ml ) ) , eye drop 24.14 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg ( folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more ) , tablet 24.15 spectra optia collection set, model : 10110 / 10120 ( packing size : 6 kits ) , consumable 24.16 spectra optia exchange set, model : 10220 ( packing size : 6 kits ) , consumable 24.17 optia granulocyte depletion set, model : 10300 ( packing size : 6 kits ) , consumable 24.18 spectra optia platelet kit, model : 10400 ( packing size : 6 kits ) , consumable 24.19 acd a solution 500ml, model : pb 1ac500j8b ( packing size : 2 bags / foil or 12 foils / box ) , consumable 24.2 hpmed solution consumable ( pack size: 16 bottles of 50 ml ) , make polti s.p.a. ; model sani system ( country of origin italy; ) , consumable 24.21 laser fiber for dental laser , make faith inovation ; model fd10b ; ( country of origin india ) , consumable 24.22 sterigen c electrolyte solution one pack of 10 ltr. for sterigen 400 daf , make faith inovation; model sterigen sg 400 daf ; ( country of origin india ) , consumable 24.23 tri iodothyronine ( t3 ) , consumable 24.24 thyroxine ( t4 ) , consumable 24.25 rhyroid stimulating hormone ( tsh ) , consumable 24.26 auto lyser solution for cbc machine ( 500ml ) , consumable 24.27 auto cleanser for cbc machine ( 2 liter ) , consumable 24.28 auto dill solution for cbc machine ( 20 liter ) , consumable 24.29 tranexamic acid ( 5ml ) , injection 24.3 tranexamic amp / vial ( 500mg ) , injection 24.31 serum electrolite na+ k+ kit analizer ( 50 test per kit ) , consumable 24.32 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ( ph neutral contact time 15 se 4. pack size 100 ml & 100 ml with dispensor ) , consumable 24.33 milkiwhite gel based sanitizer 1.ethinol ( cas 64 17 5 ) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ph neutral contact time 15 sec 4. ( pack size l& 500 ml with dispensor ) , consumable 24.34 aminoacid ( essential ) infusion ( 10% 100ml glass ffs ) , bottle ] 24.35 curved scissors laparoscopic 5mm size, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving jaws ) , consumable [ 720066 ] 24.36 maryland dissector laparoscopic 5mm curved maryland dissector with tapering end, 360 degree rotating with insulated shaft, non ratchet , plastic grip ( 36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving ) , consumable 24.37 grasper laparoscopic 5mm straight 360 degree rotating with insulated shaft, toothed a traumatic grasper with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable [ 24.38 babcock laparoscopic 5mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable 24.39 babcock laparoscopic 10mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip ( 36 cms length, independently moving jaws ) , consumable ] 24.4 sutureless dural graft substitute ( 1x3 ) , cons 24.41 sutureless dural graft substitute ( 2x2 ) , consumable ] 24.42 sutureless dural graft substitute ( 3x3 ) , consumable 24.43 sutureless dural graft substitute ( 4x5 ) , consumable 24.44 1%w / v available iodine in a non oxynol with soluble iodine suractant base with sodium iodide ( less than 1% w / v and surfactant less than 5% w / v 500 ml ) , consumable 24.45 sanitary napkins ( as per attached specification / pack of 6 pads ) , consumable [ mis106 ] 24.46 methyl prednisolone ( 8mg ) , tablet 24.47 gentamycin sulphate 0.1% ( 15gm tube ) , ointment or cream [ 120143 ] 24.48 bss solution for opthalmic use ( 500ml ) , sol 24.49 fat emulsion 20% 0.2 ( 250ml ) , injection 24.5 ivf glutamine dipeptide ( 100ml ) , injection 24.51 rangeen baag print kapda ( 60x115 tanaxbana 2 / 20sx10s reedxpeek 36x36 ) , 24.52 rangeen design weft stripe kapda ( 60x115 tanaxbana 2 / 40x 20s, 2 / 6s reedxpeek 52x52 / inch ) , 24.53 rangeen design towel beev kapda ( 1mtrx56 tanaxbana 2 / 20sx10s reedxpeek 36x40 ) , 24.54 baag print kapda fine ( 94x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ) , 24.55 baag print kapda fine 64x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x40 ( ) , 24.56 rangeen baag print kapda 60x115 tanaxbana 2 / 40x x 2 / 20s reedxpeek 52x52 ( ) , 24.57 tericat shirting cloth ( 1 m x 40 inch tana x bana ( 2 / 60s x 2 / 60 p.v.65:35 ) reed x pik ( 68 x 64 / inch ) ) , 24.58 levosalbutamol ( 1.25mg ) , ipratropium ( 500mcg ) respule ( 2.5ml ) , ampule 24.59 formoterol 6mcg + budesonide 200mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.6 salmeterol 50mcg +fluticasone 250 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.61 formoterol 6mcg + budesonide 400mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps 24.62 salmeterol 50mcg +fluticasone 500 mcg ( 30 cap x 6 pack with 1 dispensing device ) , rotacaps [ 120781 ] 24.63 blood urea ( arba ) , consumable 24.64 alkaline phosphate kinetic 2*25 ml ( semi auto end point ) , consumable 24.65 bilirubin caoillary heparinised vitrex ( one packet contain 100 capillary ) , consumable 24.66 clarithromycin ( 500mg ) , injection 24.67 i / v polysacchride or conjugate pneumococcal ( 0.5 ml ) , vaccine 24.68 imipenem 500 mg with cilastatin 500mg ( vial / amp ) , injection 24.69 ivf ( l alanine + l glutamine ) ( 50 ml ) , injection 24.7 surgical spirit ( 450 ml ( isopropyl rubbing alcohol ) ) , consumable 24.71 anti oxidant lycopen 200 ml syrup ( vitamins multi minerals ) , syrup 24.72 bupivacaine hcl for spinal ( inj 0.5%+8.25% dextrose ) , ampule 24.73 griseofulvin ( tablet 250 mg ) , tablet 24.74 budesonide ( inhalation 200 mcg per dose ) , inhaler 24.75 salbutamol nebulizing solution ( 5 mg / 2.5 ml ) , ampule 24.76 dextran 40 i / v 10% ( 500 ml ffs bottle ) , bottle 24.77 aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethecon ( tab 300 mg+50mg + 25 mg+25 mg ) , tablet 24.78 phenylephrin eye drop 2.5 % ( 5 ml vial ) , drop 24.79 calcium with vitamin d3 calcium equivalent to ( 500 mg ) , tablet 24.8 titenium chemo port with silicon catheter ( 8 9.6 fr ) length 60cm 80cm, guide wire, peel away desilet, hubsite needle ( 22 g * 20 25.4mm ) , consumable [ mis137 ] 24.81 single umbilical catheter with leur lock ( fr 3 to fr 3.5 , l 40 cm ) , consumable [ mis112 ] 24.82 alcohal based hand sanitizer ( 500ml bottle with dispenser ) , consumable 24.83 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x1 ( approved by us fda ) , consumable 24.84 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 1x3.5 ( approved by us fda ) , consumable 24.85 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 3x 4 ( approved by us fda ) , consumable 24.86 oxidized regenerated cellulose, thicker weave, can be sutured through, with bactericidal property. size 6x 9 ( approved by us fda ) , consumable 24.87 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 1x2 ( approved by us fda ) , consumable 24.88 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures size 2x4 ( approved by us fda ) , consumable 24.89 sutureless dural graft substitute ( 2x2 ) , consumable 24.9 sutureless dural graft substitute ( 3x3 ) , consumable 24.91 clip applier laparoscopic 10 mm reusable ligaclip medium / large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.92 clip applier laparoscopic 10 / 12 mm reusable ligaclip large size applier with clip retention grooves in the jaw with single arm movement ( 36cm metal shaft ) , consumable 24.93 needle holder laparoscopic 5mm straight reusable needle holder with ratchet mechanism with high quality tungsten plated jaws for enhanced needle grip ( 36 cms metal shaft ) , consumable 24.94 all human ( bovine aprotinin free ) fibrin sealant ( 1 ml ) , consumable 24.95 all human ( bovine aprotinin free ) fibrin sealant ( 2 ml ) , consumable 24.96 polyamide with cd cut needle ( 16 mm length 70 cm â� � 3 / 0 ) , consumable 24.97 polyamide with cd cut r cut extra penetrating needle ( 16 mm length 70cm â� � 4 / 0 ) , consumable 24.98 polyamide with cd reverse 5 / 0 cut needle ( 12 mm length 70cm â� � 5 / 0 ) , consumable 24.99 poly propylene with 1 / 2 circle rbd needle ( 13 mm length 60 cm â� � 5 / 0 ) , consumable 25 poly propylene with rbd needle ( 8 mm length 60 cm â� � 7 / 0 ) , consumable 25.01 poly propylene with 1 / 2 cir cc double needle ( 13 mm ( dential guage needle and suture ) length 75 cm 4 / 0 ) , consumable 25.02 poly propylene with 1 / 2 cir cc double needle ( indentical guage needle and suture ) ( 13 mm length 60 cm 5 / 0 ) , consumable 25.03 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 25 mm length 90 cm 2 / 0 ) , consumable 25.04 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 4 ) , consumable 25.05 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 6 ) , consumable 25.06 1 / 2 cir ccs cut needle ( 48 mm stainless steel length 45 cm 5 ) , consumable 25.07 polyglecaprone with 1 / 2 cir oval rb contrast needle ( 26 mm length 70 cm 3 / 0 ) , consumable 25.08 sterile raney scalp clips ( ) , consumable 25.09 raney scalp clip forceps ( ) , consumable 25.1 polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , consumable 25.11 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.12 patient drapes ( ) , nasal drop 25.13 bio membrane ( ) , consumable 25.14 polydioxanone with 1 / 2 cir reverse cutting orthopaedic surgery ( os ) nededle ( 40 mm length 90 cm 1 ) , consumable 25.15 collagen dry ( 6x6 cm ) , sheet 25.16 collagen dry ( 15 x 30 cm ) , sheet 25.17 polydioxanone with 1 / 2 cir round body heavy needle ( 40 mm length 90 cm 1 ) , consumable 25.18 collagen dry ( 20 x 40 cm ) , sheet 25.19 collagen wet ( 6x6 cm ) , sheet 25.2 collagen wet ( 10 x 10 cm ) , sheet 25.21 collagen wet ( 15 x 30 cm ) , sheet 25.22 collagen wet ( 20 x 40 cm ) , sheet 25.23 collagen granules ( ) , consumable 25.24 coated polyster braided with cd white d needle ( 25 mm ( curved reverse cutting round body or taper cut ) length 90 cm 2 / 0 ) , consumable 25.25 polybutylate coated with polyster braided ( green ) with 1 / 2 cir taper cut v 5 double armed needle ( 17 mm length 90 cm 25.26 polyglecaprone with 1 / 2 cir oval rb jb needle ( 26 mm length 70 cm 2 / 0 ) , consumable 25.27 polydioxanone with 3 / 8 cir round body needle ( 11 mm length 45 cm 6 / 0 ) , consumable 25.28 coated braided fast absorbing polyglactin 910 sut. ) with 3 / 8 cir cutting needle ( 16 mm length 45 cm size 4 / 0 undyed ) , consumable 25.29 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir round body and 1 / 2 cir reverse cutting double needle ( 36 mm length 140 cm size 2 / 0 undyed ) , consumable 25.3 coated braided fast absorbing polyglactin 910 sut. ) with 1 / 2 cir taper cut needle ( 36 mm length 100 cm size 2 / 0 undyed ) , consumable 25.31 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 75 cm size 3 / 0 ) , consumable 25.32 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 2 / 0 ) , consumable 25.33 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 30 mm length 100 cm size 1 / 0 ) , consumable 25.34 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 ) , consumable 25.35 sabourauds dextrose agar powder ( 100gms ) , consumable [ mis104 ] 25.36 nutrient agar ( 500 grm ) , consumable [ mis88 ] 25.37 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 36 mm length 90 cm size 3 / 0 ) , consumable 25.38 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 20 mm length 70 cm size 4 / 0 ) , consumable 25.39 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 90 cm size 2 / 0 ) , consumable 25.4 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle ( 40 mm length 100 cm size 1 / 0 ) , consumable 25.41 coated braided polyglactin 910 with triclosan coating sut. ) with cd cutting needle ( 22 mm length 45 cm size 3 / 0 ) , consumable 25.42 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 36 mm length 90 cm size 1 / 0 ) , consumable 25.43 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 40 mm length 100 cm size 1 ) , consumable 25.44 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle reverse cutting needle ( 23 mm length 35 cm size 1 ) , consumable 25.45 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 2 / 0 ) , consumable 25.46 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 / 0 ) , consumable 25.47 coated braided polyglactin 910 with triclosan coating sut. ) with 1 / 2 circle round body taper point needle ( 36.4 mm length 90 cm undyed size 1 ) , consumable 25.48 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 15 x 15 cm ) , consumable 25.49 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10x 15 cm ) , consumable 25.5 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.51 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 x 15 cm ) , consumable 25.52 disposable intraluminal stapler curved circular stapler ( 21 mm with controlled tissue compression ) , consumable 25.53 curved circular stapler ( 25 mm with controlled tissue compression ) , cons ] 25.54 curved circular stapler ( 29 mm with controlled tissue compression ) , consumable [ ] 25.55 curved circular stapler ( 33 mm with controlled tissue compression ) , consumable [ 25.56 hemmorhoidal circular stapler 33mm with controlled tissue compression ( leg length of 4mm ) , consumable [ 7 ] 25.57 linear cutter ( of 55 mm with inbuilt selectable staple height ) , consumable 25.58 universal black reload compatible with the ( 55mm linear cutter with inbuilt selectable staple height ) , consumable 25.59 linear cutter of ( 75 mm with inbuilt selectable staple height ) , consumable 25.6 universal black reload compatible with the ( 75mm linear cutter with inbuilt selectable staple height ) , consumable 25.61 5 mm optic view bladeless trocar ( with bilateral tissue separator ) , consumable 25.62 optic view bladeless trocar with bilateral tissue separator ( 11 mm ) , consumable 25.63 optic view bladeless trocar with bilateral tissue separator ( 12 mm ) , consumable 25.64 optic view bladeless trocar with bilateral tissue separator ( 15 mm ) , consumable 25.65 polyglactin 910 with triclosan coating 2 0, 1 / 2 circle round body ( 30 mm, 100 cm ) , consumable 25.66 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle round body ( 40 mm, 100cm ) , consumable 25.67 polyglactin 910 with triclosan coating 1, 1 / 2 circle round body ( 40 mm, 100 cm ) , consumabl 25.68 polyglactin 910 with triclosan coating 1, 1 / 2 circle reverse cutting o.s ( 40 mm, 100cm ) , consumable 25.69 polyglactin 910 with triclosan coating 1 0, 1 / 2 circle reverse cutting o.s ( 40 mm, 100 cm ) , consumable 25.7 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 25.71 polydioxanone irgacare mp 90cm m4 usp1 sgle armed ctx, i / 2 circle ( 48 mm ) , consumable 25.72 polydioxanone irgacare mp 70cm m3 usp2 / 0 sgle armed ( sh, 1 / 2 circle , round body, 26mm ) , consumable 25.73 polydioxanoneirgacare mp 70cm m2 usp3 / 0 sgle armed ( rb 1, 1 / 2 circle , round 25.74 polydioxanoneirgacare mp coated ( 150cm usp1 0 rb ctx, i / 2 circle, 48mm ) , consumable 25.75 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.76 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400080 ] 25.77 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400081 ] 25.78 polyglactin 910 with triclosan coating ( 4 0, 1 / 2 circle round body, 20 mm, 70 cm ) , consumable [ 7400082 ] 25.79 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh ( size 15 x 15 cm ) , consumable [ 7400083 ] 25.8 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 10 x 15 cm ) , consumable 25.81 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 6 x 11 cm ) , consumable 25.82 polypropylene and polyglecaprone 25 composite partialy absorbable monofilament mesh of ( size 7.6 15 cm ) , consumable ] 25.83 2 octyl cynoacrylate propen, topical skin adhesive ( 0.5ml ) , consumable 25.84 non absorbable ( 10 0 ) monofilament polymide black 6mm 3 / 8 circle spatulated micro point doublw arm ( 38 cm ) , consumable 25.85 absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 cm ) , consumable 25.86 non absorbable braided silk black 10mm 3 / 8 circle reverse cutting micro point ( 38 cm ) , consumable 25.87 absorbable surgical suture braided polyglycolic acid 3 / 8 circle reverse cuttingg ( 12mm 45 cm spatulated needle ) , consumable 25.88 non absorbable braided silk black ( 12 mm 3 / 8 circle reverse cutting micropoint 38 cm ) , consumable 25.89 suture copolymer of glycolide and ecaprolactone ( 3 0, 30cm, 3 / 8 circle rc 24mm needle, 20 anchors / inch unidirectional ) , consumable 25.9 suture copolymer of glycolide and ecaprolactone ( 2 0, , 20cm, 26mm, 20 anchors / inch unidirectional ) , consumable 25.91 suture dyed polyester poly ( p dioxanone ) ( 2 0, 30cm, 1 / 2 circle 36mm rb, 20 anchors / inch unidirctional ) , consumable [ 7400095 ] 25.92 suture dyed polyester poly ( p dioxanone ) ( 1, 36x36 cm, 1 / 2 circle cutting 40mm, 20 anchors / inch biderctional ) , consumable [ 7400096 ] 25.93 composite mesh polypropylene and polyglactine 910 ( 6x11 cm ) , consumable 25.94 composite mesh polypropylene and polyglactine 910 ( 10x15 cm ) , consumable 25.95 blood agar powder ( 500 grm ) , consumable [ mis19 ] 25.96 composite mesh polypropylene and polyglactine 910 ( 15x15 cm ) , consumable 25.97 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 24x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.98 suture dyed polyester poly ( p dioxxanone ) ( 1 0, 14x4 cm, 1 / 2 circle 36mm rb, 20 anchors / inch bidirctional ) , consumable 25.99 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 15 cm ) , consumable 26 macro porous tissue separating multi layered partially absorbable mesh with oxidized regenerated cellulose, polydioxanone and soft polypropylene mesh ( size 15 cm x 20 cm ) , consumable [ 26.01 polyglactin 910 with triclosan ( irgacre mp ) coating 2 0, 1 / 2 circle round body ( 30 mm 90 cm ) , consumable 26.02 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.03 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle round body ( 40 mm 90 cm ) , consumable 26.04 polyglactin 910 with triclosan ( irgacre mp ) coating 1, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.05 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 1 / 2 circle round body ( 20 mm 90 cm ) , consumable 26.06 polyglactin 910 with triclosan ( irgacre mp ) coating 1 0, 1 / 2 circle reserve cutting o.s ( 40 mm 90 cm ) , consumable 26.07 polyglactin 910 with triclosan ( irgacre mp ) coating 3 0, 3 / 8 circle reserve cutting ( 26 mm 70 cm ) , consumable 26.08 8 0 double arm nylon monofilament with ( 3 / 8circle taper point needle ) , consumable 26.09 polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , consumable [ 7410013 ] 26.1 polyglactin 8mm 1 / 4 , circle spatulated micro point double needle ( length 45 cm size 6 0 ) , consumable 26.11 10 0 double arm nylon monofilament with ( 3 / 8 circle taper point needle ) , consumable 26.12 opsite dressing ( 15x28 ) , consumable 26.13 collagen dry sheet ( 10x10 cm sheet ) , consumable 26.14 collagen dry sheet ( 15x30 cm sheet ) , consumable 26.15 collagen dry sheet ( 20x40 cm sheet ) , consumable 26.16 oxidised cellulose absorbable hemostate ( 2x3 ) , consumable 26.17 oxidised cellulose absorbable hemostate ( 4x8 ) , consumable 26.18 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.19 oxidised cellulose absorbable hemostate ( 2x14 ) , consumable 26.2 oxidised regenerated cellulose absorbable hemostate ( 1x2 ) , consumable 26.21 oxidised regenerated cellulose absorbable hemostate ( 2x4 ) , consumable 26.22 oxidised regenerated cellulose absorbable hemostate ( 4*4 ) , consumable 26.23 dura patch ( g.patch ) ( 8x10 ) , consumable 26.24 dura patch ( g.patch ) ( 10x12 ) , consumable 26.25 incise drape mini ( 10x10 cm ) , consumable 26.26 opsite dressing ( 30x28 ) , consumable 26.27 tube ex changer and insertion aid in one size ( 2.5, 6.0 ) , consumable 26.28 soft and gentle adhesive for sealing area around stoma ( 60 gm ) , consumable 26.29 absorbent powder for covering excoriated / damaged skin around stoma ( size 25 gm ) , consumable 26.3 1 pc self adhesive drainable stoma bag for colostomy & illeostomy swiss roll self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 75mm ) , consumable 26.31 1 pc self adhesive drainable stoma bag for colostomy & illeostomy double layered self adhesive with flex patern, transparent drainable stoma bag with built in filter and velcro outlet ( size 76 mm ) , consumable 26.32 1 pc self adhesive drainable stoma bag for urostomy with no return valve and easy flexible outlet ( 15 45mm ) , consumable 26.33 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 40 mm ) , consumable 26.34 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 50 mm ) , consumable 26.35 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 60 mm ) , consumable [ 7410038 ] 26.36 2 pc base plate / flange for colostomy / illeostomy / urostomy, self adhesive base plate custom cut with belt tabs, double layer of adhesive ( 70 mm ) , consumable 26.37 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 40 mm ) , consumable 26.38 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 50 mm ) , consumable 26.39 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 60 mm ) , consumable 26.4 tooke corneal knife ( num ) , consumable 26.41 2 pc pouches with free rotating lockring mechanism with filter and velcro clamp integrated in the bag ( 70mm ) , consumable 26.42 flexible self adhesive protective sheet to prevent excoriation ( 20x20 cm ) , consumable 26.43 polydioxanone irgacare mp coated ( 122cm , 1 loop sgle armed , 65mm ) , consumable 26.44 e.d.t.a. vacunater with needle ( 3 ml ) , consumable 26.45 plain vial with screw cap ( 12x75 ) , consumable 26.46 barraquer wire speculum, large ( num ) , consumable 26.47 disposable cresent knife ( 2.2mm ) , consumable 26.48 disposable keratom knife ( 2.8mm ) , consumable [ mis40 ] 26.49 disposable keratom knife ( 3.2mm ) , consumable [ mis41 ] 26.5 disposable sideport knife ( num ) , consumable 26.51 k wire ( length 375mm size:1.6mm roll ) , consumable 26.52 k wire ( length 375mm size:1.8mm roll ) , consumable 26.53 simcoe i / a cannula, direct, ( num ) , consumable [ mis110 ] 26.54 blood urea reagent kit ( 200ml ( 2x100ml ) ) , consumable [ mis20 ] 26.55 malaria bivalent antigen detecting rapid diagonstic tests ( rdts ) for p.f and pv ( 10 card, 10 apillary, 1 buffer solution, 10 alcohol swab, 10 sterile lancet for pricking, ( as per attached specification ) ) ( pack of 10 test.total tests:1cr, rate shall be quoted for pack of 10 ) , consumable [ 7004051 ] 26.56 rpr test kit ( 100 test ) , kit [ mis103 ] 26.57 set of phaco tip and test chamber ( phacoemulsification machine ) , consumable 26.58 test chamber sleeves ( 1 set consist of 2 pieces ) ( phacoemulsification machine ) , consumable 26.59 sets of i a system ( phacoemulsification machine ) , consumable 26.6 disposable cassette ( phacoemulsification machine ) , consumable 26.61 hb electrophoresis ( 200 test ) , consumable 26.62 protein electrophorosis in blood ( serum ) , urine , csf ( 200 test ) , consumable 26.63 conventional medical x ray film polyster based imaging film 35.6cmx43.2cm ( 14x17 ) ( size 50 sheet in one packet ) , consumable 26.64 conventional medical x ray film polyster based imaging film 35.6cmx35.6cm ( 14x14 ) ( size 50 sheet in one packet ) , consumable 26.65 conventional medical x ray film polyster based imaging film 30.5cmx30.5cm ( 12x12 ) ( size 50 sheet in one packet ) , consumable [ 7004063 ] 26.66 conventional x ray film 12x15 ( 50 sheet / pack ) , consumable 26.67 conventional x ray film 10x12 ( 50 sheet / pack ) , consumable 26.68 conventional x ray film 8x10 ( 50 sheet / pack ) , consumable [ 7004066 ] 26.69 urine container size of the container shall be 30ml disposable ( 50 per pkt ) , consumable 26.7 anastrozole tablet ( 1 mg ) , tablet 26.71 ppe kit ( as per attached specification ) , consumable 26.72 chewable antacid containing magnesium hydroxide minimum 250mg to 500mg+aluminimum hydroxide minimum 250mg to 500mg +simethecon / dimethicon minimum 25mg to 50mg tab ( additional component will also be accept ) , tablet 26.73 etanercept 25mg / vial ( pack of 2 vials ) , injection 26.74 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 26.75 oxygen cylinder with instrument set for oxygen delivery b type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.76 oxygen cylinder with instrument set for oxygen delivery d type, make everest kanto cylinder limited; ( model everest;country of origin india ) , consumable 26.77 m 30 d diluent ( 20ltr ) , consumable 26.78 m 30 r rinse ( 20ltr ) , consumable 26.79 filter for complete pulmonary function testing ( including dlco ) with body box ( 100 filters per pack, make medisoft sa ) , consumable 26.8 needle no 2 ( 1.5 ) , consumable 26.81 ophthalmic needles ( ) , consumable 26.82 silk suture ( 9 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.83 silk suture ( 10 0 ( spatulated micropoint reverse cutting needle double armed suture ) ) , consumable 26.84 chloranphenicol + dexamethasone ( 5ml ) , ointment 26.85 chloranphenicol 1% + dexamethasone 0.1% ( 5ml vial ) , eye drop 26.86 prednisolone acetate ( 1% 5ml / 10ml ) , eye drop 26.87 nepafenac ( 1mg / ml ) , eye drop 26.88 artificial tear ( 5ml ) , eye drop 26.89 sprit ( 450ml ) , solution 26.9 sensoracaine injection 0.25% ( 30ml ) , injection 26.91 hylase inj ( 1500iu ) , consumable 26.92 hpmc ( hydroxy propylmetty cellulose ) ( 5ml ) , injection 26.93 sinskey ii lens manipulating hook ( angled ) , consumable 26.94 nightingale capsule polisher ( posterior ) , consumable 26.95 castroviejo caliper ( straight ) , consumable 26.96 colibri forceps 1x2 teeth ( 0.12 mm ) , consumable 26.97 mc pherson tying forceps ( long handle ) , consumable 26.98 mc pherson forceps ( 11 mm angled ) , consumable 26.99 vannas capsulotomy scissors ( angled forward 11 mm blade ) , consumable 27 bard parker handle ( handle ) , consumable 27.01 anterior chamber washout cannula ( 16 g ) , consumable 27.02 pearce hydrosdissection cannula ( 35 inc ang 25 g ) , consumable 27.03 kellan hydrodelineation ( curved bevel tip 25g ) , consumable [ 750018 ] 27.04 jensen capsule polisher ( sand blast olive tip 23g ) , consumable 27.05 knolle pearce irrigating vectis ( ) , consumable 27.06 sterlization box with two sillicon mats ( ) , consumable 27.07 kratz barraquer wire speculum ( big ) , consumable 27.08 castoviejo cyclodialysis spatula ( 0.50 mm wide ) , consumable [ 750023 ] 27.09 utrata capsulorhexis forceps ( flat handle ) , consumable 27.1 eye scissors straight ( 4 1 / 2 lenth ) , consumable 27.11 kramer corneal fixation forceps ( ) , consumable 27.12 air injection canula ( 27g ) , consumable 27.13 desmarres lid retractor ( size 0 ) , consumable [ 750028 ] 27.14 ranibizumab 10mg / ml injection ( intenvitral 0.25ml ) , injection 27.15 prochlorperazine tab ( 5mg ) , tablet 27.16 bed sheet colored 60x90 ( 60x90 ) , consumable 27.17 blanket cover 54x90 ( for cover of above size blanket ) , consumable 27.18 blanket cover 60x90 ( for cover of above size blanket ) , consumable 27.19 mattress cover 3x6 ( for cover of above size mattress ) , consumable 27.2 livery set pants and shirt without stitching ( 3 meter cloth ) , consumable 27.21 ladies livery set saree white polyester green / blue border with blouse ( 6.50 mtr ) , consumable 27.22 surgeon gown ( std size ) , consumable 27.23 micro pipette tips 5 300ul ( 100 per pack ) , consumable 27.24 collection tube polystrene ( 100 per pack ) , consumable 27.25 baby suit plain phalalane suit ( 5 peace ) , consumable 27.26 gram staining kit ( crystal ) ( 125ml x 4 ) , consumable 27.27 acid fast staining kit ( carbol ) ( 125ml x 3 ) , consumable 27.28 widal slide test ( 4x5ml with control ) , consumable 27.29 hbv elisa test kit pack size : 96 wells per kit ( rate should be quoted for 1kit containing 96 27.3 hbv rapid test kit quantity is in no. of test card only ( and rate should be quoted for one test card ) , consumable 27.31 torsemide ( 20mg ) , tablet 27.32 temephose 50% ec ( 5 litre ) , chemical 27.33 bti 5% as ( biolarvicide ) , consumable 27.34 diflubenzuron 25% wp ( chemical larvicide ) , consumable 27.35 cyphenothrin 5% ec ( spray ) , consumable 27.36 technical malathion ( spray ) , consumable 27.37 triple sugar iron agar ( 100gm pack ) , consumable 27.38 selenite f broth ( 100gm pack ) , consumable 27.39 nutrient broth ( 500 gm ) , consumable 27.4 muller hinton agar ( 500 gm ) , consumable 27.41 sabroud dextrose agar with chlorophenicol ( 100 gm ) , consumable 27.42 simmons citrate agar ( 100 gm ) , consumable 27.43 brain heart infusion broth ( 500 gm ) , consumable 27.44 columbia blood agar base ( 500 gm ) , consumable 27.45 cled agar ( 500 gm ) , consumable 27.46 glucose phosphate broth ( 100 gm ) , consumable 27.47 cristensens urea agar base ( 100 gm ) , consumable 27.48 salmonella shigella agar ( 100 gm ) , consumable 27.49 cary blair medium base ( 100 gm ) , consumable 27.5 tcbs agar ( 100 gm ) , consumable 27.51 bile salt agar ( 100 gm ) , consumable 27.52 bile esculin agar ( 100 gm ) , consumable 27.53 cetrimide agar ( 100 gm ) , consumable 27.54 cedar wood oil ( 125 ml ) , consumable 27.55 amikacin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.56 imipenem 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.57 co trimoxazole ( sulpha / trimethoprim ) 25 mcg ( 23.75 / 1.25 ) ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.58 nitrofurantion 300 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.59 nalidixic acid 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.6 amoxyclav ( amoxycillin / clavulanic acid ) 20 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.61 gentamicin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.62 ciprofloxacin 5mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.63 ceftriaxone 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.64 cefuroxime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.65 teicoplanin 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.66 piperacillin 100 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.67 norfloxacin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.68 colistin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.69 cefoperazone 75 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.7 piperacillin / tazobactam 100 / 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.71 ceftazidime 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.72 cefazoline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.73 ampicillin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.74 tobramycin 10 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.75 polymyxin b ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.76 doxycycline hydrochloride 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.77 chloramphenicol 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.78 tetracycline 30 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.79 azithromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.8 levofloxacin 5 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.81 erythromycin 15 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable 27.82 clindamycin 2 mcg ( 1 packet of 5 vial ( each vial of 100 disc ) ) , consumable [ 121051 ] 27.83 penicillin 10 units ( 50 100 disc per pack ) , consumable 27.84 vancomycin 30 mcg ( 50 100 disc per pack ) , consumable 27.85 cisplatin 0.5 mg / ml injection ( 20 ml vial ) , injection 27.86 clonidine 150 mcg / ml ( injection 1 ml amp ) , injection 27.87 clonidine hydrochloride ( 500 mcg injection vial / amp ) , injection 27.88 dextrose d 50 0.5 infusion ( 500 ml ffs bottle ) , infusion 27.89 dicyclomine hydrochloride 10 mg / ml ( injection 2 ml vial ) , injection 27.9 electrolyte e ( multiple electrolytes and dextrose injection type v ip ) type v ip infusion ( 500 ml ffs bottle ) , infusion 27.91 electrolyte g ( multi electrolyte with 5% dextrose iv injection type iv ip ) type iv ip infusion ( 500 ml ffs bottle ) , infusion 27.92 etophylline + theophylline ( 46.5 + 40 ) ( mg / 5 ml syrup 100 ml bottle ) , syrup 27.93 heparin 25000 iu injection ( 5 ml ) , injection 27.94 formoterol + fluticasone 250 mg + 500 mg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 27.95 heparin sodium + benzyl nicotinate 50 iu + 2 mg ( ointment 20 gm ) , ointment 27.96 homatropine 2 % ( eye drops 5 ml ) , eye drop 27.97 hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion i / v hydroxyethylstarch 6% solution with sodium chloride 0.9% ( infusion 500 ml ffs bottle ) , infusion 27.98 iron & folic acid 20 mg / ml + 100 mcg / ml syrup ( 50 ml with dropper ) , syrup 27.99 ivf hydroxy ethyl starch 3% injection ( 500 ml ) , injection 28 levobupivacaine 0.01 injection ( vial ) , injection 28.01 levosalbutamol + ipratropium 100 mcg + 40mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.02 levosalbutamol 1 mg / 5 ml ( syrup 100 ml ) , syrup [ 121081 ] 28.03 levosalbutamol 100 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.04 lignocaine spray 0.1 spray ( 100 ml ) , miscellaneous 28.05 lignocaine spray 2 % spray ( 30 ml ) , spray 28.06 linazolid 200 mg / 100 ml infusion ( 300 ml ) , infusion 28.07 liposomal doxorubicin ( 20 mg injection vial ) , injection 28.08 liquid fluoxetine ( 20 mg / 5 ml liquid 30 ml ) , liquid 28.09 liquid risperidone ( 1 mg / ml liquid 60 ml ) , liquid 28.1 morphine sulphate ( 30 mg ) , tablet 28.11 afatinib ( 40 mg ) , tablet 28.12 albendazole + ivermectin ( 400mg + 6mg ) , tablet 28.13 chymotrypsin + trypsin ( 20000 iu + 100000 iu ) , tablet 28.14 artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ( 50 mg ( 3 tab ) � � � � � � + 500 mg ( 2 tab ) + 25 mg ( 2 tab ) tablet 1 combi pack ) , tablet 28.15 artesunate + sulphadoxine + pyrimethamine ( age group of less than 1year ) ( 25 mg ( 3 tab ) + 250 mg ( 1 tab ) + 12.5 mg ( 1 tab ) tablet 1 combi pack ) , tablet 28.16 rifampicin + ethambutol + isoniazid pyrazinamide ( 150 mg + 225 mg + 400 mg + 750 mg ) , tablet [ 120801 ] 28.17 lactic acid bacillus ( 5 mg ) , tablet [ 120805 ] 28.18 chloramphenicol + dexamethasne ( 1% + 0.1% ) ( 5 ml ) , eye ointment [ 120682 ] 28.19 chlorpheniramine melate + phenylephrine ( 5 mg + 2 mg each 5ml infusion 100 ml bottle ) , infusion 28.2 isoniazid ( 100mg ( as per attached specification ) ) , tablet 28.21 isoniazid ( 300 mg ( as per attached specification ) ) , tablet 28.22 adenosine ( 2 ml amp ) ( 3 mg / ml ) , injection 28.23 disposable needle 20 g no ( isi marked needle ) , consumable 28.24 polyester braided coated with cd white dn 17 mm taped cut 90 cm 2 / 0 ( 12 foils / pkt ) ( surgical suture ) , consumable 28.25 gauge than ( 91cm x 20 mtr ) , consumable 28.26 chlorhexidine gluconate ( antiseptic ) ( 0.004 solution 500 ml bottle ) , solution 28.27 lmwh low molecular weight heparin inj ( 4000iu / ml. injection 4000iu / ml injection solution for ) , injection solution for 28.28 lmwh low molecular weight heparin inj. 6000 x 000d iu / ml, injection ( injection solution for 6000 x 000d iu / ml ) , injection solution for 28.29 lysol ip ( cresol with soap solution ) 5ltr jar ( medicine 5ltr jar ) , liquid 28.3 lysol ( cresol with soap solution ) 53% + 47% ( solution 5 ltr ) , liquid 28.31 magnesium hydroxide ( syrup 400 ml ) , syrup 28.32 meropenem + sulbactum ( 1 gm + 500 mg ) ( 1.5 gm injection vial ) , injection 28.33 micronised progestrone 50 mg / ml ( injection 2 ml amp ) , injection 28.34 milk of magnesia + liquid paraffin + phenolphthalein ( cremaffin pink formula ) ( ( 11.25 ml + 3.75 ml + 50 mg ) / 15 ml syrup 170 ml bottle ) , syrup 28.35 multi vitamin each ml containvit a 3000 iu vit b1 1mg riboflavin phosphate sodium 2mg, panthenol 2.5mg niacinamide 10mg pyridoxin 1 mg cynacobalamine 1mcg lysine 10 mg ( 15ml oral drop 15ml ( with dropper, which should be able to screw & cap the bottle ) in unit carton ) , drop 28.36 neomycin + bacitracin zinc + sulphacetamide sodium ( 5 mg + 250 unit + 60 mg powder 10 gm ) , powder 28.37 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) powder 10 gm ) , powder 28.38 neomycin + polymyxin b sulphate + zinc bacitracin ( neosperine ) ( ( 3400 iu ) + ( 5000 iu ) + ( 400 iu ) ointment 28.3 gm ) , ointment 28.39 neomycin sulphate + bacitracin zinc ( 5 mg + 500 iu / gm ointment 15 gm ) , ointment 28.4 nicotinamide + folic acid + cyanocobalamin 200 mg + 15 mg + 500 mcg ( injection 10 ml ) , injection 28.41 nicotine 14 mg transdermal patch ( strip ) , transdermal patch 28.42 nicotine 2 mg gum ( strip ) , gum 28.43 nicotine 2 mg lozenges ( strip ) , lozenges 28.44 nicotine 4 mg gum ( strip ) , gum 28.45 nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml injection ( 5 ml amp ) , injection 28.46 paracetamol for iv 10 mg / ml infusion ( 100 ml ffs bottle ) , infusion 28.47 pilocarpine 0.02 eye drops ( 5 ml vial ) , eye drop 28.48 cyproheptadine hcl ( 200ml syrup ) , syrup 28.49 bisacodyl ( 10 mg ) , suppository 28.5 basal insulin glargin ( 40 iu / ml vial / cartridge ) , injection 28.51 basal insulin glargin 300 iu injection penfill 300 iu with free permanent pens one pen for ( each five cartridge and 10 needles per pen ) , injection 28.52 biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin 70% isophane insulin ) ( 40 iu / ml 10ml vial ) , injection 28.53 bethanechol ( 25mg ) , tablet [ 120806 ] 28.54 ciprofloxacin 0.003 ( 3 / 3.5 gm ) , eye ointment 28.55 alkaline citrate with potassium ( sodium citrate 1gm + potassium citrate 0.65gm +citric acid 1gm ) / ) ( 10ml oral solution 100ml bottle ) , solution 28.56 benzyl nicotinate topical + heparin topical ( 2mg + 50iu ( 20gm ) ) , ointment 28.57 calcium dobusulate calcium dobesilate + lignocaine + hydrocortisone + zinc oxide ( 0.25% + 3% + 0.25% + 5% w / w ( 30 gm ) ) , cream 28.58 calcium dobusulate ( 500 mg ) , capsule 28.59 folic acid + l glutamic acid + pyridoxin + thiamine ( 1.5mg + 45mg + 5mg + 5mg ) , tablet 28.6 iron and folic acid sugar coated pink ( as per nipi guidelines ) ( 45mg + 0.4mg ) , tablet 28.61 surgical suture ( ) , consumable 28.62 premixed insulin biphasic analogue 30 / 70 in penfill 300iu permanent pens ( one pen per five cartridges and ten needles per pen 300iu injection vial / amp ) , injection 28.63 povidone iodine vaginal ( 200 mg ) , pessary 28.64 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , suspension 28.65 salmetrol + fluticasone 250 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.66 salmetrol + fluticasone 500 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.67 terbutaline suplhate 0.5 mg / ml ( injection 1 ml amp ) , injection 28.68 tiotropium 9 mcg rotacaps ( 30 capsul pack with rothelar ) , rotahaler 28.69 torasemide 10 mg / ( vial injection vial ) , injection 28.7 vitamin k 1 mg / 1 ml injection ( 1ml amp ) , injection 28.71 acetaminophen + tramadol hydrocloride 325 mg + 37.5 mg ( tablet 10 x 10 ) , tablet 28.72 frusemide + amiloride 40 mg + 5 mg ( tablet 10 x 10 ) , tablet 28.73 potassium chloride 175 mg tablet ( strip ) , tablet 28.74 prazosin 1 mg ( tablet 10 x 10 ) , tablet 28.75 rifampicin + isoniazid 450 mg + 300 mg capsule ( 750 mg ) , capsule 28.76 theophylline + etophylline ( 35mg ) + ( 115mg ) ( 150mg tablet strip ) , tablet 28.77 dextrose, d 50 0.5 infusion ( 100 ml ffs bottle ) , infusion 28.78 dextrose, d 50 50% injection ( 10 ml amp ) , injection 28.79 isoxsuprine hcl 40 mg injection ( vial / amp ) , injection 28.8 liquid piracetam 500 mg / 5 ml ( liquid 100 ml ) , liquid 28.81 nacl drip 3 % infusion ( 100 ml ffs bottle ) , infusion 28.82 saline ( nacl ) 0.9 % nasal drops ( 10 ml ) , nasal drop 28.83 theophylline + etophylline ( 25.3mg ) + ( 84.7mg ) injection ( 2 ml ) , injection 28.84 synthetic pyrethrum ( 5% ) , solution 28.85 temephos ( 5% ) , solution 28.86 dextran 40 0.4 injection ( 500 ml ) , injection 28.87 dextran 70 0.06 infusion ( 500 ml ffs bottle ) , infusion 28.88 tinidazole i.v. 2 mg / 1ml infusion ( 400 ml ) , infusion 28.89 ambu bag / adult each 1000 1700ml, with oxygen connecting tube , should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories, ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c ) should be multiple times autoclavable ) , consumable 28.9 tranexamic acid 500 mg / 5ml injection ( 5 ml amp ) , injection [ 121094 ] 28.91 blood bag double 350ml ( as per attached specification ) , each [ 121210a ] 28.92 blood bag triple 350ml as per attached specification ( each ) , bag 28.93 blood bag triple sagam 450ml ( as per attached specification ) , each 28.94 blood bag triple sagam 350ml ( each ) , bag [ 121212 ] 28.95 single blood bag ( as per attached specification ) , each 28.96 i.v cannula for single use ( intravascular catheters ) bis ( gauze 22, length 25 ) consumable ( each ) , consumable 28.97 i.v cannula ( two way ) size ( 16 nos ) , consumable 28.98 i.v cannula size with inj. valve ( port ) ( 22g ) , consumable 28.99 quadruple blood bags as per attached specification ( each ) , consumable 29 placenta extracts ( 0.1gm vial / amp ) , injection 29.01 ambu bag ( silicon type ) paediatrics each 300 500 ml with oxygen connecting tube, should be supplied with a carry pouch, ambu bag should be complete with required autoclavable valves and other accessories ( ( should have silicon rubber bellow to withstand autoclave at 134 degree c, should be multiple times autoclavable ) , consumable 29.02 b.b silk ( 12 foils / pkt ) ( 3 / 8rcut needle 45mm length 76cm, size 2 / 0 ) ( consumable ) , consumable 29.03 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6 inch / pair ( pair ) , consumable 29.04 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 6.5 inch / pair ( pair ) , consumable [ 13002 ] 29.05 polyamide mono filament ( nylon ) with cd cut needle 20 / 16 mm length 70 cm size 2 / 0 ( 12 foils / pkt ) , consumable [ 121206 ] 29.06 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7 inch / pair ( pair ) , consumable [ 13003 ] 29.07 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100% , electronically tested sterilized by gamma irradiation / eto is no:13422:1992 as amended upto, powder free 7.5 inch / pair ( pair ) , consumable [ 13004 ] 29.08 black braided silk with 1 / 2 cir cutting needle 16mm length 75cm size 3 / 0 ( 12 foils / pkt ) , consumable [ 121207 ] 29.09 draw sheet ( each ) one side linen and one side autoclavable water proof sheet size 58x36 ( each ) , consumable [ 13005 ] 29.1 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } with 31g needle ( single unit pack ) is marked, 40 iu ( each ) , consumable [ 13006 ] 29.11 insulin syringe with 31g needle ( single unit pack ) is marked, 100iu, { auto disabled ( ad ) / re use prevantion ( rup ) syringe ( each ) , consumable 29.12 insulin syringe { auto disabled ( ad ) / reuse prevantion ( rup ) syringe } / each ( graduation upto 100 units ) 30g needle, 40 units / ml ( 30 g needle, 40units / ml ) syringe ( each ) , consumable 29.13 mackintosh ( as per attached specification ) , quantity amended as 300000 meter i.e 15000 roll of 20 meter roll, rate should be quoted for 20 meter, is 8164 1976 or conforming to is 8164 1976 ( roll ) , consumable 29.14 vial 5ml, vial test tube, leak proof, ungraduated, polypropylene / polyethylene capacity 5ml each ( each ) , consumable 29.15 solubility test kit ( for sickle cell ) , 50 test / kit, as per attached specification, control sample is not mandatory acessories required 1. dropper 2.test tube ( standard size ) / vial 3. reading stand 4.micropipette with tip / capillary tube 5.lancet ( 6.alcohol swab , kit ) , kit 29.16 nestroft test kit ( for thalasemia traits ) , 50 test / kit, as per attached specification ( kit ) , kit 29.17 screw cap vial with o ring ( 2ml ) , screw cap, leak proof self standing / flat bottom with o ring, un graduated, polypropylene / polyethylene, 2ml capacity each ( each ) , consumable 29.18 steralised and autoclavable culture tube flat bottom, 5ml ( plastic ) ( each ) , consumable 29.19 recombiant fviii ( 1000 iu / vial ) , vial 29.2 bone wax sterilised ( 2.5 gm / packet ) ( consumable ) , consumable 29.21 formaline 37% ( 500 ml bottle ) , consumable 29.22 iv cannula with inj.valve ( port ) ( size 26g each consumable ) , consumable 29.23 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 18 ) ) , consumable 29.24 radio opaque catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 20 ) ) , consumable 29.25 radio opague catheter with ptfe / polyurethine / fep / volex material ( iv safety cannula with luer lock ( g 22 ) ) , consumable 29.26 safe delivery kit 1 plastic desposable gown ( non woven plastic laminated, leak proof ) 2 ( 4*4 ) , ( 2 ) disposable goggles for protection of eyes 2 ( free size ) , ( 3 ) face mask 2 free size ( 4 ) plastic disposable cap ( non woven plastic laminated, leak proof ) ( ( 1pair, ( 5 ) long gloves elbow length 2pairs ( 6 1 / 2 and 7 ) ( 6 ) disposable shoe covers till calf ( plastic ) 2pair umbical cord clamps plastic material ( 1pair ) ( free size ) ( as per attached specification ) ) ) , consumable 29.27 potassium free, hemodialysis fluid for bicarb made ( ( part a 10 ltr +part b 500gm2 / pkt ) ) , consumable 29.28 potassium free, hemodialysis powder for bicarb made ( ( part a powder to make 10 ltr +part b 500gm 2 / pkt ) ) , consumable 29.29 uric acid ( 50 ml ( 2 x 25 ml ) , consumable 29.3 disposable syringe { auto disabled ( ad ) / re use prevantion ( rup ) syringe } ( ( for vitamin k inj ) ( 1ml with needle 26g ) ) , consumable 29.31 albumin reagent kit, 200ml ( 4*50 ml ) , consumable 29.32 electric cautery lead / each disposable electro surgical pencil 4cm ( each ) , each 29.33 glycrine i.p. ( 400 gm ) , solution 29.34 glycrine i.p. ( 50 gm ) , solution 29.35 polybutester with polytribolate coating 7 0 60 cm, blue 8 mm 3 / 8 circle ( taper point double arm ) , surgical material 29.36 long term absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry 0, 30 cm ( green 37 mm 1 / 2 circle taper point ) , sutures 29.37 monofilament glycomer 1 , 90 cm ( violet 40mm 1 / 2 circle taper point ) , sutures 29.38 hemorrhoid stapler 33 mm diameter with detachable anvil ( staple height 3.5 mm ) , sutures 29.39 reusable gastro intestinal anastomotic stapler 60 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.4 reusable gastro intestinal anastomotic stapler 80 mm with dual firing knob ( inbuilt knife in every cartridge ) , sutures 29.41 medium wound protector ( 5 9 cm ) , sutures 29.42 3 dimensional polyester mesh with micro porosity ( x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15 cm circular with nylon prefixed sutures ) , consumable 29.43 polyester self gripping mesh with poly lactic acid for open incisional hernia repair ( size 15 x 15 cm ) , consumable 29.44 titanium non absorbable 5 mm ( helical tacker for mesh fixation with 30 tacks ) , consumable 29.45 ag ion impregnated central venous triple lumen polyurethane catheter ( 7.5 fr, g 14x18x18 length 16 cm ) , consumable 29.46 therma coal box ( box ) , consumable 29.47 potassium di chromate ( chornicals formula:k2cr207, formula wt:294.2, minimum assay 99.5% 1kg ) , consumable 29.48 phenolic compounds containing disinfectants ( houschold disinfectant, containing ohcnolic compounds such as monochlorophenol, coal tar acid, oils and mulsifiers etc.the approx content of phenolic compounds should be at least 40% 5 ltrs ) , consumable 29.49 basie fuchsin chemical name:pararosaniline hydrochloride, chemical structure c20h20cin3 mol wt:337.86 dye content: approx 85% 88% dye content must be mentioned color: metalic green ( 25 gms glass bottle ) , consumable 29.5 sulphuric acid ( chemicals name sulphuric acid formula wt:98.08, specific gravity 1.84 minimum assay 98% 500ml ) , consumable 29.51 malachit green ( malachit green hydro chloride, chemical structure:c23h25ctn2 molecular wt 364.9 colour green dye co ) , consumable 29.52 methylene blue ( methylene thionine chloride, chemical structure:c23h25cin3s molecular wt:319.9 dye content:approx 82% ( dye content must be mentioned ) ) , consumable 29.53 hydrochloric acid ( concentrated hydro chloric acid molecular wt;36 46 specific gravity 1.18 1ltr ) , consumable 29.54 porassium permanganate ( kmno4 formula wt;158 500gms ) , consumable 29.55 auramine ( c17h22cin3 mol wt:303.84 25 gms ) , consumable 29.56 liquid paraffin ( heavy grade ) ( refractive index of 1.48 it should be colourless odurless transparent free from fluorescene in day light with relative density of 0.5 50 ml ) , consumable 29.57 sodium citrate ( trisodium citrate dihydrate, ar grade chemical structure na3c6h5o7.2ho molecular wt ( fw ) 294.10purity 500 gms ) , consumable 29.58 potassium phosphate ( potassium di hydrogen ortho phosphate kh2po4 molecular wt:136.1 minimum assay 99% 1kg ) , consumable 29.59 magnesium sulphate ( mgso4 7h2o;mol wt 246.48;purity 99.5% 1kg ) , consumable 29.6 magnesium citrate ( tribasic; c12h10mg3o14.9 h2o mol wt:613.28 500 gms ) , consumable 29.61 l asparagine monohydrate ( c4h8n23.h2o mol wt: 150.14 25 gms ) , consumable 29.62 glycerol ( ch2ohchohch2oh mol wt:92.1 purity 99.5% 1 ltr ) , consumable 29.63 sodium hydroxide pellets ( naoh formula wt:40 minimum assay:98% 500gm ) , consumable 29.64 cetyl pyridinium chloride ( chemical structure: c21h38cin.h2o / 358 500gms ) , consumable 29.65 sodium chloride ( chemical structure: nac1 molecular weight:58.44 minimum assay:99.9% 1 kg ) , consumable 29.66 dihydrostreptomycin sedquisulphate ( sigma d 7253 25 gms ) , consumable 29.67 isonicotinic acid hydarazide ( sigma i 3377 25 gms ) , consumable 29.68 rifampicin ( sigma r 3501 25 gms ) , consumable 29.69 ethambutol dlhydrochloride ( sigma e 4630 25 gms ) , consumable 29.7 pnb ( para nitro benzonic acid formula wt: 167.12 min assay 99% c6h4coohno2 100 gms ) , consumable 29.71 cyanogen bromide ( cnbr cisco research lab:mol wt:105.9 100 gms ) , consumable 29.72 o tolidine a.r ( dimethyl benzidine: c14h16n2 from wt 212.3 ) , consumable 29.73 hydrogen peroxide ( ar or gr grade assay 29 32% solution fw 34.01 1 ltr ) , consumable 29.74 tween 80 ( polyoxyethylenesorbitanmoonooleate ar or gr grade density 1.06 1.09g / ml 500 ml ) , consumable 29.75 oxalic acid ( pure ) ( coohcooh.2h2 mol wt:126.07 purity 99.8% 500gms ) , consumable 29.76 absolute alcohol ( ethanol 1 ltr ) , consumable 29.77 liquor ammonia ( lr / gr grade 1ltr ) , consumable 29.78 sodium carbonate ( na2co3 wt: 106 minimum asay 99% 500 gms ) , consumable 29.79 n n dimethyl formamide ( hcon ( ch3 ) 2 mol wt:73.09 500 ml ) , consumable 29.8 formaldehyde ( hcho mol wt 30.03 wt per ml at 20oc 1.075 1.095g; methanol contant 10 15% assay ( acidimetric ) as hcho 37 11% 1 ltr ) , consumable 29.81 spare caps for universal containers ( spare caps with liner for universal containers 28 ml wide neck pack of 100 nos ) , consumable 29.82 diamond marker pencil ( 6 holder with artificial diamond ( hard stone ) embedded at one end with screw cap to mark on microscope glass slides 6 nos ) , consumable 29.83 grease marking pencil ( mps, blue or red coloured, length to write on glass ware / metal surfaces 8 nos ) , consumable 29.84 cotten ( absorbent, each roll of 0.5 kg 10 rolls ) , consumable 29.85 filter paper ( filter paper no 1, 12.5 cms diameter for filtering carbot fuchsin using a small funnel of 10cm maximum diameter smooth on one 120 packs ) , consumable 29.86 brown paper for packing ( 115 cm.x 75 cm size sheets 75 sheets ) , consumable 29.87 non absorbent cotton ( non absorbent cotten rolls of 1 / 2 kg cach surgical grade 4kg ) , consumable 29.88 lens paper ( soft microsope lens cleaning tissue, 4x6 booklet each booklet containning 100 sheets 50 booklets ) , consumable 29.89 slides ( glass microscope slides 76mm x 26mm x 1.3mm, plain one pack of 50 slides 50 packs ) , consumable [ 121178 ] 29.9 test tubes ( glass autoclavable and heat resistant standerd rimless 150 x 16mm with screw caps 1 ) , consumable 29.91 loop wire ( nichrome wire 24 standard wire gauge ( swg ) or 0.002 inches or 0.559 mm thickness swg 10 metres ) , consumable 29.92 glass beads ( acid washed 3mm diameter round transpatent for dispersing the clumps of microorganisms by vortexing or blending 500 29.93 bijou bottles ( borosilicate or corning glass of 5 ml capacity witj screw caps of aluminium with rubber liners suitable for bijou bottles, leak proof 250 ) , consumable 29.94 spare caps for bijou bottles ( screw caps of aluminium with rubber liners suitable for bijou bottles 500 ) , consumable 29.95 alcohol ( 500ml ) , consumable 29.96 basie fuchsin ( 25 gm glass bottle ) , consumable 29.97 carbolic acid phenol ( 500ml ) , consumable 29.98 falcon tube ( conical bottom ) ( 50ml each plastic containers with air tight screw cap printed graduation ) , consumable 29.99 artificial immersion oil refractive index of 1.48 it should be colorless, odorless, transparent and free from fluorescence in day light eith relative density of 0.827 to 0.890, viscosity of 110 to 230 m pa s; specific gravity of 0.76 0.78 at 15.5 c ( 50 ml bottle ) , consumable 30 methylated spirit ( 500 ml bottle ) , consumable 30.01 phenolic compound / phenol crystal chemical name: phenol, chemical structure: c6h5oh, molecular wt: 94.11, melting point:40 c+2 purity: 99.5% ( 500 gm glass bottle ) , consumable 30.02 sputum container ( 100 per box ) , consumable 30.03 sulphuric acid ( 500ml glass bottle ) , consumable 30.04 ice pack ( pack ) , consumable 30.05 para film sealing film ( film ) , consumable 30.06 therma coal box ( box ) , consumable 30.07 hydroxy propyl methyl cellulose injection 2% ( 3ml prefilled syringe ) , syrings 30.08 diflubenzuron 25% wp ( 1kg ) , consumable 30.09 cepodoxamine 200 mg + clavulanic acid 125mg tab ( 200mg + 125 mg ) , tablet 30.1 hiv ( rapid ) ( whole blood finger prick test kit ) , consumable 30.11 pre & pro biotic sachet each sachet ( 0.5 gm ) contain: streptococcus faecalis t 110 30 million clostridium butyricum toa 2million bacillus mesentericus to a 1 million lactic acid bacillus 50 million ( lactobacillus sporogenes ) ( 0.5 gm sachet ) , sachet 30.12 disposable under pad dimention of sheet 60*90 cm ( inside ) ( weight 80 gm unit ) , consumable 30.13 tetrastarch 6% infusion ( 500 ml bottle ) , infusion 30.14 milk of magnesia+liquid paraffin 11.25ml+3.75ml ) 15ml ) , syrup ( 200ml bottle ) , syrup 30.15 clindamycin 300mg capsule / tab ( 10x10 ) , tablet capsule 30.16 amoxycillin 250 mg + cloxacillin 250 mg cap ( 10x10 ) , capsule 30.17 each uncoated chewable tablet contains dride aluminium hydroxide i.p 240 mg magnesium ( hydroxide i.p 100mg activated dimethicone i.p 25mg light magnesium carbonate ip 60mg ) , tablet 30.18 promethazine 25 mg / ml ( 1ml amp ) , ampule 30.19 heamocoagulase 1 iu / ml ( 1ml amp ) , ampule 30.2 vancomycine eye drop 2.5% , 5ml ( 2.5% , 5ml ) , drop 30.21 chloranphenicol eye ointment 0.5% ( 0.5% ) , ointment 30.22 chloranphenicol + polymycin b eye drop, 4mg / ml, 5ml ( 4mg / ml, 5ml ) , eye drop 30.23 gancyclovir eye ointment 0.15%, 3gm tube ( 0.15%, 3gm tube ) , ointment 30.24 amphotericin b ointment 2.5%, 5gm ( 2.5%, 5gm ) , ointment 30.25 variconazole eye drop ( power form soulation ) 1%, 5gm ( ( power form soulation ) 1%, 5gm ) , eye drop 30.26 fluoro metholone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.27 dexamethalone 0.1%, 5ml ( 0.1%, 5ml ) , ampule 30.28 betamethasone 0.1%, 5ml ( 5ml ) , drop 30.29 surgical blade 15 no ( 100 / pkt ) , surgical material 30.3 defluprednate eye drop, 5ml ( 5ml ) , drop 30.31 lotepredrrelol eye drop, 5ml ( 5ml ) , eye drop 30.32 indomethacin eye drop 0.5%& 1% ( 5ml ) , eye drop 30.33 ketorolac eye drop 0.4% ( 5ml ) , eye drop 30.34 diclofenac eye drop 0.1% ( 5ml ) , eye drop 30.35 tropicamide eye drop 0.5% ( 5ml ) , eye drop 30.36 tropicamide + phenylephirne eye drop 1% ( 5ml ) , eye drop 30.37 cmc + sodiumhyaluronate eye drop ( 5ml ) , eye drop 30.38 carboxymethye cellulose 1% eye drop ( 5ml ) , eye drop 30.39 phenylephrine eye drop 5% ( 5ml ) , eye drop 30.4 phenylephrine eye drop 10% ( 5ml ) , eye drop 30.41 timolol eye drop 0.25% ( 5ml ) , eye drop 30.42 betaxolol eye drop 0.25% ( 5ml ) , eye drop 30.43 betaxolol eye drop 0.5% ( 5ml ) , eye drop 30.44 dipverfrine eye drop 0.1% ( 5ml ) , eye drop 30.45 brimonidine eye drop 0.1% and 0.15% ( 5ml ) , eye drop 30.46 lantanoprost eye drop 0.005% ( 2.5ml ) , eye drop 30.47 bimatoprost eye drop 0.1% ( 5ml ) , eye drop 30.48 dorzolamide eye drop 2% ( 5ml ) , eye drop 30.49 bronlolamide eye drop, 0.2% ( 5ml ) , eye drop 30.5 xycocain preservative free 2% injection ( 2% ) , injection 30.51 xylocain injection 2%, 20mg / ml ( 30ml ) , injection 30.52 ophthalmic needles ( round body ) , needle 30.53 ophthalmic needles ( cutting ) , needle 30.54 keratom knife ( 2.8 mm ) , blade 30.55 vicryl 60 suture micropoint sparalated reverse cutting double armed ( reverse cutting double armed ) , blade 30.56 nvr blade ( 20 g ) , blade 30.57 wills hospital utility forceps ( na ) , sutures 30.58 castroviejo suturing forceps 0.12 mm ( 1x2 teeth ) , sutures 30.59 dastoor superior rectus forceps ( 1x2 teeth ) , sutures 30.6 hartman mosquito forceps, straight ( na ) , surgical material 30.61 hartman mosquito forceps, curved ( na ) , surgical material 30.62 baby jones towel clamp ( na ) , consumable 30.63 barraquer iris scissors ( na ) , surgical material 30.64 westcott tenotomy scissors ( na ) , surgical material 30.65 iris scissors, straight ( na ) , surgical material 30.66 kalt needle holder, straight ( na ) , surgical material 30.67 barraquer n holder, shirt model, m. jaws, curved jaws, w / o lock ( na ) , surgical material 30.68 barraquer n holder, standard jaws, curved jaws, w / o lock ( na ) , surgical material 30.69 rycroft air injection cannula, ( 23 g ) , consumable 30.7 lewicky anterior chamber maintainer cannula ( na ) , consumable 30.71 infusion cannula ( size 25.mm ) , consumable 30.72 keener arlt lens loop ( na ) , consumable 30.73 agarwal s phaco chopper ( 1mm fully cutting edge ) , consumable 30.74 beer cilia forceps ( na ) , consumable 30.75 harms traveculotomy probe, right ( na ) , consumable 30.76 harms traveculotomy probe, left ( na ) , consumable 30.77 castroviejo corneal trephine ( size 7.5mm dia ) , consumable 30.78 dastoor corneal graft holding forceps ( na ) , consumable 30.79 osher neumann radial marker ( 8 blades ) , consumable 30.8 tudor thomas corneal graft stand ( na ) , consumable 30.81 lieberman teflon block ( na ) , consumable 30.82 sterilization box ( na ) , consumable 30.83 barraquer solid wire speculum ( large ) , consumable 30.84 hoffer optic zone marker ( 3mm dia ) , consumable 30.85 osher neumann radial marker ( 4 blades ) , consumable 30.86 osher neumann radial marker ( 6 blades ) , blade 30.87 grene visual axis marker ( na ) , consumable 30.88 thornton fixation ring ( na ) , consumable 30.89 bores corneal fixation forceps, ( straight ) , consumable 30.9 bores incision spreading forceps ( na ) , consumable 30.91 lancaster eye speculum ( na ) , consumable 30.92 jaeger lid plate ( na ) , consumable 30.93 graefe muscle hook ( size 3 ) , consumable 30.94 berke ptosis forceps ( 20 mm ) , consumable 30.95 snellen entropium forceps, ( left small ) , consumable 30.96 snellen entropium forceps, ( right small ) , consumable 30.97 ayer chalazion forceps ( na ) , consumable 30.98 lambert chalazion forceps ( na ) , consumable 30.99 stevens tenotomy scissors, curved ( na ) , consumable 31 meyerhoefer chalazion curette ( size 1, 1.75 mm dia ) , consumable 31.01 jameson muscle hook, ( large ) , consumable 31.02 jameson muscle forceps, left, ( child 4 teeth ) , consumable 31.03 jameson muscle forceps, right, ( child 4 teeth ) , consumable [ 201269 ] 31.04 charles flute needle ( na ) , consumable 31.05 infusion cannula, ( size 2.5mm ) , consumable 31.06 schepens forked orbital retractor ( na ) , consumable 31.07 cefixime 200 mg + clavulanic acid 125 mg ( tab ) , tablet 31.08 natamycin eye drop 5%, ( 5ml ) , eye drop 31.09 hpmc ( hydroxy propylmetty cellulose ) eye drop, ( 5ml ) , eye drop 31.1 sodium hyaluronate injection ( pfs ) ( na ) , injection 31.11 45 diaptor irrigating contact lens ( 45 deg ) , consumable 31.12 90 diaptor irrgating contact lens ( 90 deg ) , consumable 31.13 scleral plugs ( sets of 3 ) , consumable 31.14 vitreous forceps, ( 20 g smooth jaws, straight ) , consumable 31.15 buprenorphine 20 mg patch ( each patch ) , each 31.16 vinorelbine ( 50mg inj ) , injection 31.17 linagliptin ( 5mg tab ) , tablet 31.18 tenecteplase ( 40mg ) , injection 31.19 levocetirizine 5mg ( mouth dissolving tablet also acceptable ) , tablet 31.2 cefixime + ofloxacin ( 200 mg + 200 mg ) , tablet 31.21 endotracheal tube no 5.5 ( uncuffed ) , each 31.22 endotracheal tube no 6.0 ( uncuffed ) , each 31.23 pressure monitor ( line ) , each 31.24 follyscathetor 8 no ( pediatrics ) , consumable 31.25 follyscathetor 10 no ( pediatrics ) , consumable 31.26 diclofenec sodium 75mg / ml injection, surfactant & transcutol p free. iv bolus ( 75mg / ml, amp of 1 ml ) , ampule 31.27 disposable eye dressing with adhesive pad ( each unit ) , consumable [ 201391 ] 31.28 vecuronium bromide injection ( 10mg / vial ) , injection 31.29 liposomal doxorubicin 20 mg or pegylated liposomal doxorubicin ( 2 mg / ml 10ml vial ) , injection 31.3 cefpodoxamine ( 200 mg tab ) , tablet 31.31 blood transfusion set ( each ) , consumable 31.32 insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges 31.33 surgical spirit ip ( 500 ml ) , bottle 31.34 flurbinprofen eye drop 0.03% ( 5 ml vial ) , eye drop 31.35 tropicamide + phenylephime eye drop 0.8% and 5% ( 5 ml vial ) , eye drop 31.36 amoxicillin + cloxacillin ( 250mg + 250mg ) , capsule 31.37 amoxicillin + cloxacilline ( 500 mg+500 mg cap ) , capsule 31.38 carboxymethyl cellulose ( 1% eye drop, 5ml ) , eye drop 31.39 cephalexine cap ( 125mg ) , capsule 31.4 chloramphenicol ( 250mg ) , capsule 31.41 clindamycin ( 150 mg ) , capsule 31.42 clindamycin ( 300 mg ) , capsule 31.43 clomipramine ( 25 mg ) , capsule 31.44 halothane ( ) , inhalation 31.45 medical oxygen ( ) , inhalation 31.46 iron sucrose ( 50mg ) , injection 31.47 alcohol ( absolute ) ( 500 ml ) , consumable 31.48 ulinastatin ( 1 lac iu ) , vial 31.49 cefuroxime ( 1.5 gm ) , injection 31.5 sitagliptin + metformin ( 50mg + 500mg ) , tablet 31.51 teneligliptin ( 20mg ) , tablet 31.52 telmisatran ( 80mg ) , tablet 31.53 ammonium chloride+diphenhydramine+sodium citrate+menthol ( 138mg+14.08mg+57.03mg+2.5mg each 5ml cough syrup ) , syrup 31.54 vildagliptin + metformin ( 50mg + 1000mg ) , tablet 31.55 etoricoxib ( 90mg ) , tablet 31.56 saxagliptin ( 5 mg ) , tablet 31.57 saxagliptin ( 2.5mg ) , tablet 31.58 ticagrelor ( 90mg ) , tablet 31.59 mycophenolate ( 360mg ) , tablet 31.6 sodium valporate + valproic acid cr ( 300mg ) , tablet 31.61 poc kit for syphilis ( as per attached specification ) ( 10 test per pack ) , consumable 31.62 sterlize single use lancing device ( penitration depth 1.5 and 28 guage ) , each 31.63 glargine 100 iu / ml, 3ml cartridge inj. ( firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost ) ( 100 iu / ml ) , cartridges 31.64 disposable bed sheet ( each ) , consumable [ mis1002 ] 31.65 sterile disposable bed sheet ( each ) , consumable 31.66 viral transport media with swabs ( vtm detail specifications ) : vtm ( 3ml vial with 2 regular swabs i.e. one nasal swab and one throat swab ) 1.viral transport medium ( vtm ) with swab with complete directions for collection, storage, transport and carrying. 2.sterile dacron, polyester or rayon sterile swabs with plastic shafts for sa ) , consumable 31.67 anticold ( drop ) , drop 31.68 sevelamer carbonate ( 800mg ) , tablet 31.69 iron & folic acid with vitamin b12 capsules ( time released ) each timed release capsule contains: ( ferrous fumarate ( in sr form ) ip 200mg eq. to 64mg elemental iron cyanocobalamine ip 15mcg folic acid ip 1.5mg ) , capsule 31.7 degludec 100 iu / ml ( 3ml cartridge with pen inj. ) , injection 31.71 lactobacillus tab ( 60 million spores ) , tablet 31.72 phenytoin sodium ( 250 mg / 5 ml inj ) , injection 31.73 elemental calcium 150mg cap ( ( in the form of calcium hydroxide & calcium oxide pretreated with heated algae ) termed as lonic calcium ) , capsule 31.74 each 5ml contains aluminium hydroxide paste equilvalent to dired alluminium hydroxide i.p. 250mg magnesium hydroxide i.p. 250mg activated dimethicone i.p. 50mg sorbitol solution ( 70% ) ip.. 1.25mg ( non cristallising 170 ml bottle ) , bottle 31.75 sodium dichloroisocynaurate 35 mg tablet ( turnover criteria amended as average annual turnover 2cr. only gmp certified companies also eligible for this consumable item ) , tablet [ 121002a ] 31.76 febuxostat ( 40 mg tab ) , tablet 31.77 glimepride 2 mg + metformin 1000 mg ( tab ) , tablet 31.78 fluocinolone acetonide ip ( 0.1% w / w 30 gm cream ) , tube 31.79 darbepoetin ( 25mcg ) , injection 31.8 darbepoetin ( 40mcg ) , injection 31.81 racecadotril ( 100mg ) , capsule 31.82 methyl prednisolone ( 500mg ) , injection 31.83 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i, b, flow wrap / blister pack using medical grade breathable paper, eto sterilized ( 2ml ) , consumable 31.84 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles compliance to iso 7886:4 type i and b, flow wrap / blister pkg using medical grade breathable paper, eto sterilized ( 10ml ) , consumable 31.85 garam coat / woolan saluka sup.quality ( std.size ) , consumable 31.86 duster ( 39x39 ) , consumable 31.87 ladies livirise set redymade saree whote polyster green / blue border ( saree + blouse + peticot ) ( std.size ) , consumable 31.88 pillow 1 kg. cotton ( 14x21 ) , consumable 31.89 mattress 10 kg. cotton ( 3x6 ) , consumable 31.9 dohar redymade ( 54x90 ) , consumable 31.91 table cloth ( 45x60 ) , consumable 31.92 hole sheet ( 39x39 ) , consumable 31.93 gents livirise set redymade ( pent + shirt + topi ) ( std.size ) , consumable 31.94 airway, nasopharyngeal, sterile, single use, set with 6.5mm external diameter ( make medisafe international, model:msi 1220 6.5 ) , consumable [ 20200835 ] 31.95 airway, nasopharyngeal, sterile, single use, set with 7.5 mm external diameter ( make medisafe international, model:msi 1220 7 ) , consumable 31.96 atorvastatin + asprin ( 10mg + 75mg ) , tablet or capsule 31.97 intravenous set with airway and needle ( children ) ( surgical material ) , consumable 31.98 ice pack ( 8 length x 6 widgth ) ( 200gm ) , consumable 31.99 serum electrolyte kit ( 50test per kit ) , consumable 32 filter paper ( 12.5 cm, 0.1 micron, 50 / pkt ) , consumable 32.01 spectacles for school children: durable non allergic plastic ( frame with english lenses in case ) , consumable 32.02 spectacles for old person: durable non allergic plastic ( frame with english lenses in case ( as per tender specification ) ) , consumable 32.03 cotton khadi dari pattil ( 10x1.5 feet, 800gram per piece ) , consumable 32.04 cotton khadi dari pattil ( 10x1.5 feet, 1kg per piece ) , consumable 32.05 cotton khadi white bedsheet ( 54x90 inch per piece ( by weaving the name of the concerned department ) ) , consumable 32.06 cotton khadi white bedsheet ( 54x90 inch per piece ( by printing the short name of the concerned department ) ) , consumable 32.07 polyvastra cloth coating white ( 36 inch per meter ) , consumable 32.08 polyvastra cloth shirting colour ( 36 inch per meter ) , consumable 32.09 polyvastra uniform colour ( pent / shirt / topi ) ( per set ( accourding to measure ) ) , consumable 32.1 polyvastra uniform ( kurta / payjama / topi ) ( per set ( accourding to measure ) ) , consumable 32.11 woolen coatin mix ( 54 inch per meter ) , consumable [ kha058 ] 32.12 woolen shawl mix ladies standard ( per piece ) , consumable [ kha059 ] 32.13 ammunition boot ( according to measure ) , consumable 32.14 ackle boot ( according to measure ) , consumable 32.15 alcohol based hand sanitizer liquid spray ( 500 ml bottle ) , consumable 32.16 alcohol based hand sanitizer ( 50 ml bottle ) , consumable 32.17 plastic gloves ( large size ) , consumable 32.18 alcohol based hand sanitizer ( 1 ltr. bottle ) , consumable 32.19 sodium hypochlorite solution 5% ( 500 ml bottle ) , consumable 32.2 alcohol based hand sanitizer ( 500 ml bottle ) , consumable 32.21 codeine opiod analgesic 15 mg tab ( 15 mg ) , tablet 32.22 pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg ( tab ) ( tablet ( with additional content acceptable ) ) , tablet each 5ml contain potassium citrate i.p. 1100 mgmagnesium citrate u.s.p. 375 mg pyridoxine hydrochloride i.p 20 mg colour caramel ( each contains approx.l meq, magnesium ion, 2meq. potassium ion, 3meq. citrate ion and 4mg of pyridoxine hydrochloride ) , bottle 32.24 afatinib ( 20 mg ) , tablet 32.25 alteplase ( 50 mg ) , injection 32.26 probiotic capsule each capusle contains lactobacillus ( rhamunousus gr 1 & lactobacillus reuteri rc 14 1 billion ) , capsule 32.27 doxketoprofen trometamol ( equivalent to dexketoprofen 25mg + paracitamol 325 mg ) , tablet 32.28 brimonidine eye drop 0.2% ( 5ml ) , vial 32.29 golimumab ( r dna origin ) solution for injection in prefilled syringe for single use 50 mg / 0.5 ml50mg / 0.5ml ( pre filled syringe in autoinjector ) , syrings 32.3 calcitriol 0.25 mcg + calcium 500mg+ mecobalamin 1500mcg+ omega 3 acid ethyl esters 60 bp+ folic acid 400mcg + elemental boron 1.5mg ( capsule / soft gelatin capsule ) , capsule 32.31 pembrolizumab inj ( 100mg / 4ml ( 25mg / mi ) solution in single dose ) , vial 32.32 peptonised iron 176.5 mg ( equivalent to 30 mg of elemental iron, protein ( as peptone ) 100 mg, folic acid 200 mcg, vitamin b12 2.5 mcg 100ml ) , bottle 32.33 feracrylum 1% gel ( 15gm ) , tube 32.34 disodium hydrogen citrate ( 1.4gm / 5ml ) ( 200ml ) , syrup 32.35 cost of reagent per test ( for blood cell counter 3 part ) ( blood cell counter 3 part ) , consumable 32.36 blood cell counter 3 part ( mek6510k ) ( blood cell counter 3 part ) , consumable 32.37 electrolyte solution for disinfectant generation system ( 10 lt. per pack ) , consumable 32.38 canagliflozin ( 100 mg ) , tablet 32.39 gabapantin300 mg + methylcobalamin 500 mcg ( 300 mg + 500 mcg ) , tablet 32.4 minicap ( capd ) with povidon iodine ( each ) , consumable [ 202106004 ] 32.41 serum amylase ( 2x25 ml ) , consumable 32.42 mackintosh ( as per attached specification ) , quantity amended as 136940 meter i.e. 6847 roll of 20 meter roll, rate should be quoted for 20 meter ( is 8164 1976 or conforming to is 8164 1976 ) , consumable 32.43 chromic with 1 / 2 cir rb needle absorbable surgical suture ( 12 foils / pkt ) ( 40 mm length 76 cm size:1 / 0 , surgical material ) , consumable 32.44 aceclofenac +thiocolchicoside ( 100mg+8mg ) , tablet 32.45 beclomethasone 0.025 % + fusidic acid 2.0 % cream ( 10 gm ) , tube 32.46 deflazacort ( 6mg ) , tablet 32.47 etizolam ( 0.25mg ) , tablet 32.48 etizolam ( 0.5mg ) , tablet 32.49 etoricoxib ( 60mg ) , tablet 32.5 febuxostat ( 80mg ) , tablet 32.51 itraconazole ( 200mg ) , capsule 32.52 levocetrizine ( 10mg ) , tablet 32.53 cefopodoxime 50 mg / 5 ml suspension ( 30ml ) , bottle 32.54 chlorpheniramine 2mg+ dextromethorphan 10mg / 5ml ( 100ml ) , syrup 32.55 trypsin chymotrypsin ( 1 lac iu ) , tablet 32.56 cisplatin ( 10 mg ) , injection 32.57 clindamycin 600mg ( 150mg / ml ) , injection 32.58 nebivolol ( 2.5mg ) , tablet 32.59 octriotide ( 50 mcg / ml ) , injection 32.6 rabeprazole + levosulpiride ( 20mg +75mg ) , tablet or capsule 32.61 rifaximin ( 400mg ) , tablet 32.62 rosuvastatin ( 20 mg ) , tablet 32.63 vitamin d3 ( 800iu / ml ) , drop 32.64 diclofenac sodium 75mg intended to use iv aqueous formulation ( 1ml amp ) , injection 32.65 gabapentin ( 300mg ) , tablet 32.66 fexofenadine + montelukast ( 120mg / 10 mg ) , tablet 32.67 fluticasone 50mcg / spray ( 70 120 meter dose nasal ) , spray 32.68 cr system film ( size 8x10 ) , consumable 32.69 cr system film ( size 10x12 ) , consumable 32.7 cr system film ( size 14x17 ) , consumable 32.71 films of size 14x17 inches compatible films to dr system ( 14x17 inches ) , film 32.72 films of size 11x14 inches compatible films to dr system ( 11x14 inches ) , film 32.73 films of size 10x12 inches compatible films to dr system ( 10x12 inches ) , film 32.74 films of size 8x10 inches compatible films to dr system ( 8x10 inches ) , film 32.75 alfacalcidol 0.25mcg, calcium 200mg ( 0.25mcg+200mg ) , capsule levetiracetam 100mg / ml syrup / solution ( 100ml bottle ) , syrup 32.77 paracetamol 500mg + chlorpheniramine 2mg+ phenylephrine 10mg ( 500mg+2mg+10mg ) , tablet 32.78 acenocoumarol ( 1 mg ) , tablet 32.79 alendronate ( 70 mg ) , tablet 32.8 methylcobalamin 1500mcg + pregabalin 75mg ( 1500mcg+75mg ) , tablet 32.81 alfuzosin ( 10mg ) , tablet capsule 32.82 amantadine ( 100mg ) , tablet 32.83 bosentan ( 62.5 mg ) , tablet 32.84 bisoprolol ( 5 mg ) , tablet 32.85 levetiracetam ( 100mg / ml ) , injection 32.86 sucralfate 500mg + oxetacaine 10 mg / 5ml syrup / suspension, 200ml bottle ( 500mg+10 / 5ml ) , bottle 32.87 pregabalin 75 mg + nortriptyline 10 mg ( 75mg+10mg ) , tab 32.88 adapalene ( 0.1%w / w ) , gel 32.89 oxymetazoline hydrochloride 0.05% w / v nasal spray, 10ml bottle ( 0.05% w / v ) , spray 32.9 disposable surgeon cap with cable tie ( each ) , consumable 32.91 weith machine mini ( 1gm to 5kg ) 32.92 heating mantle 32.93 inj multivitamine 32.94 onit eberconazole cream 1% w / w 32.95 cassette ( 10 x 12 ) , consumable fujji 32.96 cassette ( 8 x 10 ) , consumable fujji 32.97 cassette ( 14 x17 ) , consumable fujji 32.98 centrifuse machine 32.99 blood presure machine digital 33 codon set 33.01 acyclovir tab. ip 200mg ( dt tablets also acceptable ) , tablet 33.02 albendazole ip ( 400mg ) , tablet 33.03 alprazolam ( tab 0.25mg ) , tablet 33.04 amiodarone 50mg / ml ( 3ml vial / amp ) , injection 33.05 amiodarone ( 100mg tab ) , tablet 33.06 amlodipin tab ( 5mg ) , tablet 33.07 amoxycillin +clavulanic acid ( ( amoxycillin 500 + clavulanic acid 100 mg ) / vial ) , injection 33.08 amoxicillin ( 125 mg / 5ml ( 30 ml bottle ) ) , suspension [ 110074 ] 33.09 amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) ) , syrup 33.1 amoxycilline ( 500mg ) , capsule 33.11 ampicillin ( 500 mg / vial ) , injection 33.12 ampicillin trihydrate capsules ( 500mg 33.13 anti d immunoglobulin for iv / im use ( monoclonal ) ( 150mcg ( 1ml vial ) ) , injection 33.14 anti snake venom polyvalent inj 10ml ( lyophilized ) ( 10 ml vial ) , injection 33.15 artemether + lumefantrine ( 20mg+120mg ) , tablet 33.16 artesunate ( 60 mg / vial ) , injection 33.17 artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg + pyrimethamine 37.5 mg ip ( 2 tab ) ( age group 15 or above ) , combi blister pack 33.18 aspirin low dose ( 75mg tab ) , tablet 33.19 atenolol ( 50mg tab ) , tablet 33.2 atenolol ( 100mg ) , tablet 33.21 atorvastatin ( ip 10 mg ) , tablet 33.22 atracurium ( 10mg / ml ( 2.5ml vial / amp ) ) , injection 33.23 atropine sulphate 1% ( 5 ml vial ) , eye drop 33.24 atropine sulphate eye ointment ( 1% ) , ointment 33.25 atropine sulphate 0.6 mg / ml sc / im / iv ( 2ml amp ) , injection 33.26 azithromycin ( 500mg tab ) , tablet 33.27 azithromycin ( 200mg / 5ml ( 15 ml bottle ) ) , syrup 33.28 azithromycin ( 250mg ) , tablet 33.29 betahistine ( 8 mg tab ) , tablet 33.3 betamethasone sodium phosphate ( ml contain betamethasone sodium phosphate equal to 4mg of betamethasone ( 1ml amp ) ) , injection 33.31 biphasic isophane insulin ( 30 / 70 40iu / ml ( 10 ml vial ) ) , injection 33.32 bisacodyl ( 5 mg ) , suppository 33.33 bisacodyl ( 5mg tab ) , tablet 33.34 bromhexine hydrochloride ( 4mg / 5ml syrup ( 50ml bottle ) ) , syrup 33.35 bupivacaine hydrochloride ( 0.5% ( 20 ml vial ) ) , injection 33.36 calcium gluconate ( 10% ( 10 ml vial ) ) , injection 33.37 calcium gluconate 10% ( 10ml amp ) , injection 33.38 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental ( calcium 500mg and cholecalciferol ip 250 iu ) , tablet 33.39 carbamazepine ( 200 mg ) , tablet 33.4 carboplatin ( 450mg 45ml multidose vial ) , injection 33.41 carboxymethylcellulose sodium eye drop 0.5% ( 10ml ) , eye drop 33.42 cefixime ( 200 mg tab ( dt tablet also acceptable ) ) , tablet 33.43 cefotaxime sodium ( 250 mg vial ) , injection 33.44 cefotaxime sodium ( 1 gm vial ) , injection 33.45 ceftazidime 1gm / vial inj ( 1 gm / vial ) , injection 33.46 ceftrioxone usp ( 1gm / vial ) , injection 33.47 ceftriaxone ( 250mg vial ) , injection 33.48 ceftriaxone ( 500mg vial ) , injection 33.49 cephalexine ( each 5ml contains 125mg ( 30ml bottle ) ) , syrup 33.5 cetirizine ( 10 mg ) , tablet 33.51 chloroquine phosphate suspension equivalent to chloroquine ( 50mg / 5ml ( 60 ml bottle ) ) , suspension 33.52 chloroquine phosphate tab. ( 250mg ) , tablet 33.53 chlorpheniramine maleate ( 10mg / ml inj 10 ml ) , 33.54 ciprofloxacin eye ointment 0.3% ( 3gm tube ) 33.55 ciprofloxacin ( 500mg ) , tablet 33.56 clomiphene citrate ( 50 mg tab ) , tablet 33.57 clonazepam ( 0.5mg ) , tablet 33.58 clopidogrel ( 75 mg ) , tablet 33.59 clotrimazole i.p. 2%w / w ( 15gm tube ) , cream or 33.6 deferasirox dispersible ( 250mg ) , tablet 33.61 deferasirox dispersible ( 500mg ) , tablet 33.62 dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) ) , injection 33.63 dextromethorphan 10mg / 5ml ( 100ml bottle ) , syrup 33.64 dextrose 25% ( 500ml ffs bottle ) , injection 33.65 dextrose 5% ( 500ml ffs bottle ) , injection 33.66 dextrose with saline ( 5% + 0.9% ( 500ml ffs bottle ) ) , injection 33.67 diazepam ( 5 mg / ml ( 2 ml amp ) ) , injection 33.68 diclofenac ( 1% ) , gel 33.69 diclofenac sodium 25 mg / ml ( 3ml amp ) , injection 33.7 diclofenac sodium ( 50 mg ) , tablet 33.71 dicyclomine ( 10mg / ml ( 2 ml amp ) ) , injection 33.72 dicyclomine tab. 10mg 33.73 diethylcarbamazine tab ( 100mg ) , tablet 33.74 digoxin tab ( 0.25mg ) , tablet 33.75 zinc dispersible ( 20mg ) , tablet 33.76 docetaxel ( 120mg vial ) , injection 33.77 domperidone suspension 1mg / ml ( 30ml bottle ) , suspension 33.78 domperidone ( 10mg ) , tablet 33.79 dopamine hcl 40 mg / ml ( 5ml amp ) , injection 33.8 doxorubicin ( lypholozed ) ( 50mg vial ) , injection 33.81 doxycycline ( 100 mg ) , capsule 33.82 drotaverine ( 40mg / 2ml ( 2ml amp ) ) , injection 33.83 enoxaparin ( 40mg equivalent to 4000 iu vial / pfs ) , injection 33.84 erythropoietin ( 10000iu inj ) , injection 33.85 escitalopram 10 mg tab ( 10 mg ) , tablet 33.86 etophylline ( 77 mg ) + theophylline ( 23 mg ) tab ( tablet ) , tablet 33.87 etiophylline and theophylline ( 220 mg / 2ml ) , injection 33.88 fentanyl citrate inj 50 mcg / ml ( 2ml ampoule ) , ampule 33.89 fluconazole ( 150 mg ) , tablet 33.9 flunarizine ( 5 mg ) , tablet 33.91 fluoxetine cap ( 20 mg ) , capsule 33.92 folic acid ip ( 5 mg ) , tablet 33.93 framycetin sulphate 1% cream ( 30 gm tube ) , cream 33.94 frusemide ( 10 mg / ml ( 2 ml amp ) ) , injection 33.95 furosemide tab ( 40mg ) , tablet [ 110265 ] 33.96 furazolidone ( 100mg ) , tablet 33.97 gamma benzene hexachloride solution / lotion 1% ( ( 100 ml ) ) , bottle 33.98 gentamicin inj ( 40 mg / ml 2 ml amp ) , injection 33.99 gentamicin 0.3% eye / ear drops ( 5ml ffs squeeze vial ) , eye drop 34 glibenclamide ( 5 mg ) , tablet 34.01 gliclazide ( 80 mg ) , tablet 34.02 glimepiride ( 1 mg ) , tablet 34.03 nitroglycerine ( glyceryl trinitrate ) ( sublingual tab mg ) , tablet 34.04 glycopyrrolate inj. 0.2 mg / ml ( 1 ml amp ) , injection 34.05 haloperidol inj ( 5mg / ml ( 1 ml amp ) ) , injection 34.06 haloperidol ( 5mg ) , tablet 34.07 halothane bp 250ml 34.08 heparin ( 1000iu / ml 5ml vial ) , injection 34.09 hepatitis b immunoglobulin ( 100 iu / vial ) , vial 34.1 human anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , injection 34.11 hydrochlorothiazide tab ( 25 mg ) , tablet 34.12 hydrocortisone sodium succinate ( 100 mg / vial ) , injection 34.13 hydrogen peroxide 6% solution ( who gmp certification exempted for this item ) ( 400 ml ) , bottle 34.14 hydroxy urea ( 500mg ) , capsule 34.15 hyoscine butylbromide 20mg / ml ( 1ml vial / amp ) , injection 34.16 ibuprofen ( 400mg ) , tablet 34.17 insulin soluble inj. 40 iu / ml 34.18 ipratropium bromide inhaler 20mcg per puff ( 200 metered dose container ) , inhaler 34.19 iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to 60 mg elemental iron 500 mcg folic acid ip ( 60 mg + 500 mcg ) , tablet 34.2 isosorbide dinitrate tab ip ( 5mg ) , tablet 34.21 isoxsuprine ( 10mg ) , tablet [ 34.22 ketamine hydrochloride ( 10mg / ml ( 10ml vial ) ) , injection 34.23 labetalol ( 100 mg ) , tablet 34.24 levofloxacin ( 500mg ) , tablet 34.25 lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) ) , gel 34.26 lignocaine 2 % ( 21.3 mg / ml ( 30 ml vial ) ) , injection 34.27 lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial 34.28 mannitol ( 20% 100 ml ffs bottle ) , injection 34.29 mephentermine inj 30mg / ml ( 10 ml vial ) , injection 34.3 metformin ( 500 mg ) , tablet 34.31 methyl ergometrine inj meleate ( 0.2 mg / ml ( 1ml amp ) ) , injection 34.32 methyl ergometrine maleate tab ( 0.125mg ) , tablet 34.33 methyl prednisolone sodium succinate inj.1000mg vial ( 1000mg vial ) , injection solution for 34.34 methyl prednisolone tab ( 16 mg ) , tablet 34.35 methyl prednisolone ( 4mg ) , tablet 34.36 methyldopa tab. 250mg 34.37 metoclopramide 5mg / ml ( 2 ml amp ) , injection 34.38 metoclopramide ( 10mg ) , 34.39 metoprolol ( 50mg ) , tablet 34.4 metronidazole tab ( 400mg ) , tablet 34.41 midazolam ( 1mg / ml ( 10ml vial ) ) , inje 34.42 midazolam ( 1mg / ml ( 5ml amp ) ) , injection 34.43 mifepristone ( 200 mg ) , tablet 34.44 misoprostol ( 200mcg ) , tablet 34.45 morphine sulphate inj. ip 10mg / ml ( 1ml ampoule ) , injection 34.46 naloxone inj. 0.4 mg / ml ( 1ml ampoule ) , injection solution for 34.47 neostigmine ( 0.5mg / ml ( 1ml amp ) ) , injection 34.48 nifedipine capsule ( 5mg cap ) , capsule 34.49 nifedipine ( 10mg tab ) , tablet 34.5 nitroglycerine inj. 25 mg / 5ml ( 5ml ) , ampule 34.51 norfloxacin tab. 400mg 34.52 ofloxacin tab 200mg 34.53 olanzapine ( 10mg tab ) , tablet 34.54 ondansetron ( 2 mg / ml ( 2 ml amp ) ) , injection 34.55 ondansetron ( 2mg / 5ml 30ml bottle ) , syrup or solution 34.56 ondansetron tab 4 mg 34.57 ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l ( as per attached pack specification ) , powder 34.58 oxaliplatin ( 100mg ) , injection 34.59 paracetamol inj ( 150mg / ml 2ml amp ( 2ml amp ) ) , injection 34.6 paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) ( syrup ) , syrup 34.61 paracetamol ( 500mg ) , tablet 34.62 pemetrexed ( 500mg ) , injection 34.63 pentaprazole inj vial ( 40 mg ) , injection 34.64 pentazocine lactate ( 30mg / ml ( 1 ml amp ) ) , injection 34.65 pheniramine maleate ( 22.75 mg / ml ( 2 ml amp ) ) , injection 34.66 phenobarbitone ( 200 mg / ml ) , injection [ 34.67 phenobarbitone ( 30 mg ) , tablet 34.68 phenobarbitone ( 60 mg tab ) , tablet [ 34.69 phenytoin sodium ( 50 mg / ml ( 2ml amp ) ) , injection [ 34.7 phenytoin sodium ( 100mg ) , tablet [ 34.71 pioglitazone ( 15 mg ) , tablet 34.72 piperacillin + tazobactum ( 4.5 g ) , injection 34.73 potassium chloride oral solution 100mg / ml ( 200ml bottle ) , bottle 34.74 povidone iodine ointment 5% ( 15gm tube ) , tube 34.75 povidone iodine ( 5% 100 ml ) , solution 34.76 povidone iodine vaginal ( 200 mg ) , pessary 34.77 pralidoxime ( pam ) inj ( 25 mg / ml ) , injection 34.78 primaquin ( 2.5mg ) , tablet 34.79 primaquine ( 15mg ) , tablet 34.8 primaquin ( 7.5mg ) , tablet 34.81 promethazine 5 mg / 5ml ( 60 ml bottle ) , syrup 34.82 pyridoxine tab 10mg 34.83 quinine dihydrochloride ( 300mg / ml ( 2ml amp ) ) , injection 34.84 quinine sulphate ( 300mg ) , tablet 34.85 rabeprazole ( 20 mg ) , tablet 34.86 ramipril ( 2.5 mg ) , tablet 34.87 ranitidine ( 50mg / 2ml , 2ml amp ) , injection 34.88 ranitidine ( 150mg ) , tablet 34.89 recombiant fviia ( 1mg / vial ) , vial 34.9 ringer lactate ip i / v 0.24 % w / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 % w / v potassium chloride and 0.027 % w / v calcium chloride ( 500ml ffs bottle ) , infusion 34.91 rituximab ( 500mg ) , injection 34.92 salbutamol inhalation ip 100mcg / dose ( 200 metered dose container ) , inhaler 34.93 salbutamol sulphate ( 4mg ) , 34.94 silver sulphadiazine cream ( usp 1% w / w 25gm ) , tube 34.95 sodium bicarbonate inj. 7.5% w / v ( 10ml ) , ampoule 34.96 sodium thiopentone 0.5 gm powder / vial ( 20ml vial ) , injection 34.97 succinyl choline ( 50mg / ml ( 10 ml vial ) ) , injection 34.98 sulfamethoxazole and trimethoprim ( 400mg + 80mg ) , tablet 34.99 sulfamethoxazole and trimethoprim ( 800mg + 160mg ) , tablet 35 tamoxifen tab. ( 10 mg ) , tablet 35.01 telmisartan ( 40 mg ) , tablet 35.02 tetanus immunoglobulin ( usp / ip 250 iu / vial ) , injection 35.03 tramadol ( 50mg / ml ( 2ml amp ) ) , injection 35.04 tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , injection 35.05 tropicamide ( 1% 5ml vial ) , eye drop 35.06 vancomycin hydrochloride ( 1000mg vial ) , injection 35.07 vancomycin hydrochloride ( 500mg ) , injection 35.08 vitamin a syrup ( 100000 iu / ml with market spoon for 1ml and 2 ml ( 100 ml bottle ) ) , syrup or solution 35.09 xylometazoline nasal ( 0.1%w / v ( 10 ml vial ) ) , drop 35.1 iron sucrose usp ( 100 mg / 5 ml ( 5 ml amp ) ) , injection 35.11 acyclovir ( 800mg ) , tablet 35.12 tramadol ( 50mg ) , tablet 35.13 amoxicillin cap. 250 mg. 35.14 amoxycillin and clavulanic acid i.p. ( 500mg + 125mg ) , tablet 35.15 ciprofloxacin ( 250mg ) , tablet 35.16 ethamsylate tab ( 250 mg ) , tablet 35.17 permethrin lotion 5% w / v ( 60 ml bottle ) , lotion 35.18 streptokinase inj 15 lac iu ( vial / amp ) , injection 35.19 zoledronic acid ( 4mg vial ) , injection 35.2 benzathine penicillin ( 6 lakh iu / vial ) , vial 35.21 dextrose ( 10% inj 500 ml ffs btl ) , injection 35.22 trihexyphenidyl ( 2mg ) , tablet 35.23 dicyclomine hydrochloride ( 20 mg ) , tablet 35.24 levofloxacin ( 250mg ) , tablet 35.25 cephalexine ( 250mg ) , capsule 35.26 caffeine citrate inj. 20mg / ml ( 3 ml vial ) ( 20mg / ml 3 ml vial ) , injection 35.27 ibuprofen syrup 100mg / 5ml ( 60 ml bottle ) ( 60 ml bottle ) , syrup 35.28 calcium carbonate ( 500 mg ) , tablet 35.29 diazepam ( 5 mg ) , tablet 35.3 glimepiride ( 2 mg ) , tablet 35.31 tranexamic acid ( 500 mg tab ) , tablet 35.32 miconazole cream i.p. 2% w / w ( 15 gm tube ) , cream or ointment ] 35.33 timolol maleate eye drop i.p. 0.5 %w / v ( 5 ml vial ) ( 5 ml ) , solution 35.34 clotrimazole ( vaginal tab ) 500 mg ( with applicator ) , tablet 35.35 cefotaxime sodium ( 500 mg / vial ) , injection [ 35.36 dextrose ( 25% 100 ml ffs bottle ) , injection 35.37 mannitol inj. 20% 350ml ffs bottle 35.38 sodium chloride n / 2 injection ip ( 0.45% ) ( 500ml ffs bottle ) , injection 35.39 sodium chloride normal saline ( 100ml ffs bottle ) , infusion 35.4 capecitabine ( 500mg ) , tablet 35.41 sorafenib ( 200mg ) , tablet 35.42 artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg + pyrimethamine 25 mg ( 1 tab ) ( age group between 1 4 year ) , combi blister pack 35.43 sitagliptin ( 50 mg ) , tablet 35.44 cloxacillin ( 500mg ) , capsule 35.45 vincristine sulphate ( 1mg / ml ( cytocristin inj ) 1 ml vial ) , injection 35.46 irinotecan hydrochloride ( 100 mg ) , injection 35.47 bicalutamide ( 50mg ) , tablet 35.48 gemcitabine ( 1.4 gm vial ) , injection 35.49 artesunate 150mg ( 3tab ) + sulphadoxine 500mg + pyrimethamine 25mg ( 2 tab ) ( age group 9 to 14 years combi ) , tablet combi red colour blister pack 35.5 letrozole ( 2.5 mg ) , tablet 35.51 mupirocin ( 2% w / w ( 5 gm tube ) ) , ointment 35.52 normal saline ( 0.9% ( 500ml ffs bottle ) ) , infusion 35.53 ofloxacin tab 400 mg ( ofloxacin tab 400 mg ) , tablet 35.54 betamethasone dipropionate ( 0.05% ( 15gm ) tube ) , ointment or cream 35.55 dextromethorphan syrup ( 60ml bottle ) ( 10mg / 5ml ) , syr 35.56 vecuronium bromide inj 2mg / ml ( 2ml amp ) 35.57 dobutamine hcl 50 mg / ml ( 5ml amp ) , injection 35.58 chloroquine phosphate ( 40mg / ml ( 5 ml amp ) ) , injection 35.59 tinidazole ( 300 mg ) , tablet 35.6 betamethasone ( 0.5 mg ) , tablet 35.61 labetalol ( 20 mg / 4 ml ( 4ml amp ) ) , injection 35.62 cefpodoxime ( 200 mg ( dispersible tab also accepted ) ) , tablet 35.63 rh erythropoetin ( 2000 i.u ) , injection 35.64 isoflurane ( ) , inhalation 35.65 prednisolone tab 20 mg ( dispersible tablet also acceptable ) , tablet 35.66 charcoal activated ( powder ) ( 100 gm box / pouch ) , oral powder 35.67 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 35.68 cefixime ( 50 mg dt ) , tablet 35.69 meropenem ( 500 mg / vial ) , injection 35.7 benzathine penicilline 12 lac iu / vial ( vial ) , injection 35.71 sulfamethoxazole +trimethoprim tab ( 200 mg + 40 mg ) , tablet 35.72 metronidazole oral suspension ( 200 mg / 5ml ( 60 ml bottle ) ) , suspension 35.73 itraconazole cap ( 100 mg ) , capsule 35.74 imatinib ( 400 mg tab ) , tablet 35.75 warfarin sodium ( 5 mg ) , tablet 35.76 propranolol tab ( 10 mg ) , tablet 35.77 drotaverine ( 40 mg ) , tablet [ 35.78 lithium carbonate ( 300 mg ) , tablet 35.79 risperidone ( 2 mg ) , tablet 35.8 imipramine ( 25 mg ) , tablet 35.81 lorazepam 2 mg / ml 1 ml vial 35.82 cinnarizine ( 25 mg ) , tablet 35.83 water for injection ip ( 2 ml amp ) , injection 35.84 water for injection 5 ml amp 35.85 carbimazole ( 10 mg ) , tablet 35.86 fluphenazine 1 ml amp ( 25 mg / ml ) , injection 35.87 sodium valproate ( 500 mg ) , tablet [ 35.88 clozapine ( 25 mg ) , tablet 35.89 clozapine ( 50 mg ) , tablet [ 35.9 medroxy progesterone acetate ( 10 mg ) , tablet 35.91 olanzapine ( 5 mg ) , tab 35.92 vitamin b1 ( thiamine 100 mg ) , tablet 35.93 misoprostol ( 100 mcg 4 tables / pack ) , tablet 35.94 disulfiram ( 250 mg ) , tablet 35.95 donepezil ( 5 mg ) , tablet [ 35.96 levetiracetam ( 250 mg ) , tablet [ 35.97 lorazepam ( 1 mg ) , tablet [ 35.98 lorazepam ( 2 mg / ml 2 ml vial ) , injection 35.99 zolpidem 10 mg ( tablet ) , tablet 36 vitamin k1 ( 1mg / 0.5ml ( 0.5 ml amp ) ) , injection 36.01 chlorpromazine ( 100 mg ) , tablet [ 36.02 rabies immunoglobulin inj 300 iu ( ( 2ml vial pfs ) ) , injection 36.03 ferrous ascorbate 100mg ( elemental iron ) +folic acid 1.5mg ( tablet ) , tablet 36.04 noraderanaline bitartrate ( 2 mg base / 2ml ( 2ml amp ) ) , injection 36.05 salbutamol sulphate ( 2mg / 5ml 60ml ) ( 60ml bottle ) , syrup 36.06 promethazine 25 mg / ml ( 2 ml amp ) , injection 36.07 etophylline + theophylline sr tablet 231mg + 69mg ( ) , tablet 36.08 oxytocin inj ( 5 iu / ml ( 1ml amp ) ) , injectio 36.09 cetirizine syrup ( 5mg / 5ml 30 ml bottle ) ( 30ml bottle ) , syrup 36.1 verapamil ( 40 mg ip ) , tablet 36.11 fusidic acid cream / sodium fusidic ointment 2% 5gm tube ( 5 gm ) , tube 36.12 metronidazole 500mg / 100 ml ( 100 ml ffs bottle ) , injection 36.13 isosorbide 5 mononitrate ( tab.20 mg ) , tablet 36.14 dexamethasone ( 0.5mg ) , tablet 36.15 iv human immunoglobin 5% iv ig ( 5gm / 100ml each ) , infusion 36.16 cefixime oral suspension ( 100 mg / 5 ml ( 30 ml bottle ) ) , suspension 36.17 paracetamol tab ( 650 mg ) , tablet 36.18 linezolid tab ( 600 mg ) , tablet 36.19 albendazole suspension 200mg / 5ml ( 10 ml bottle ) , syrup 36.2 electrolyte p ( multi electrolytes and dextrose injection type i ip ) i / v fluid ( each 100ml contains: anhydrous dextrose 5gm potassium chloride 0.13gm, sodium acetate 0.32gm, dibasic potassium phosphate 0.026gm ) ( 500 ml ffs bottle ) , injection 36.21 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable antioxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals ( if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. ( as per attached specification ) ( 50ml bottle with auto dispenser ) ) , syrup 36.22 carboprost ( 250 mcg ( 1 ml amp / vial ) ) , injection 36.23 lactulose ( 10gm / 15ml ( 100 ml bottle ) ) , solution 36.24 zinc sulphate dispersible ( 10mg ) , tab 36.25 atorvastatin ( 40mg ) , tablet 36.26 ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml ( ( additional composition of menthol also acceptable ) 100ml bottle ) , syrup 36.27 deferiprone ( 500 mg ) , capsule 36.28 spironolactone ( 25mg ) , tablet 36.29 budesonide nebulising suspension containing budesonide ( 0.5 mg / 2 ml, 2ml amp ) , suspension 36.3 ferric carboxymaltose 50mg / ml ( 10ml vial ) , injection 36.31 paclitaxel 260mg ( 43.34ml vial ) , injection 36.32 mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tablet 36.33 morphine sulphate ( 10 mg ) , tablet 36.34 erlotinib ( 150 mg ) , tablet 36.35 diltiazem ( 30 mg ) , tablet [ 110217 ] 36.36 noradrenaline bitartrate 2 mg base / 2 ml amp injection ( 2 ml amp ) , inj 36.37 amlodipine ( 10 mg ) , tablet 36.38 pyridoxine ( 100 mg ) , tablet 36.39 sulfamethoxazole +trimethoprim suspension ( 200 mg + 40 mg ) / 5 ml suspension ( 50 ml bottle ) , suspension 36.4 trastuzumab 440 mg injection ( vial ) , injection 36.41 glucose pouch ( 75 gm ) ( powder ( product copp exempted for this item ) ) , powder 36.42 multivitamin sugar coated tab nfi formula multivitamin sugar ( item with additional vitamin will also be considered ) , tablet 36.43 levocetirizine + monteleukast 2.5 mg + 4 mg / 5 ml ( 60 ml bottle, suspension ) , suspension 36.44 empagliflozin ( 25mg tab ) , tablet 36.45 amphotericin b inj ip 50 mg ( liposomal amphotericin b also acceptable ) , injection 36.46 lenalidomide ( 25mg ) , capsule 36.47 tiotropium 18mcg ( 30cap. x 6 pack with 1 dispensing device ) , rotacaps 36.48 tiotropium 9mcg 180 doses inhaler ( 180 or more doses acceptable ) , inhaler 36.49 ciprofloxacin inj 200 mg / 100 ml ( 100 ml ffs bottle ) , infusion 36.5 lantanoprost eye drop 0.005% ( 5ml ) , eye drop 36.51 dexamethasone eye drop ( 0.1%, 5ml ) , eye drop 36.52 urokinase ( 5 lac iu ) , vial 36.53 metoprolol ( 25mg, sustained release ) , tablet or capsule 36.54 metformin ( 1000mg ) , sr tablet 36.55 allopurinol ( 100mg ) , tablet 36.56 paracetamol ( 125 mg / ml ) , drop 36.57 vitamin. b complex nfi ( prophylactic ) ( b12 mg, b22mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg ) , tablet 36.58 levothyroxine ( 100 mcg ) , tablet 36.59 levothyroxine ( 50 mcg ) , tablet 36.6 pilocarpine eye drops 2% ( 5ml ) , vial 36.61 cisplatin ( 50 mg ) , injection 36.62 sodium valproate oral solution ( 200 mg / 5 ml ) , solution 36.63 xylometazoline 0.05% nasal 10ml ( 0.05% 10ml ) , drop 36.64 glycopyrolate ( inj 0.2 mg / ml 1 ml vial ) , injection 36.65 promethazine ( injection 10 mg / ml 2ml vial ) , injection 36.66 propofal ( injection 10 mg / ml 1 ml / vial ) , injection 36.67 acetylsalicylic acid ( tablet 150 mg ) , tablet 36.68 acetylsalicylic acid ( aspirin ) * ( tablet 25 mg ) , tablet 36.69 allopurinol ( tablet 300 mg ) , tablet 36.7 pregabalin ( tablet 150 mg ) , tab 36.71 tapentadol ( tablet 100 mg ) , tablet 36.72 chlorpheniramine ( oral liquid 2 mg / 5 ml 30 ml bottel ) , liquid 36.73 hydrocortisone ( ointment 0.5% 15 gm ) , ointment or cream 36.74 hydrocortisone ( ointment 1% 15 gm ) , ointment or cream 36.75 hydroxyzine ( tablet 25 mg ) , tablet 36.76 diphenylhydantoin ( tab 30 mg 10x10 ) , tablet 36.77 abacavir ( tablet 300 mg ) , tablet 36.78 artesunate ( powder for injection 120 mg vial of 1 powder injection with appropriate diluents ) , injection powder for 36.79 ceftazidime ( powder for injection 250 mg vial of 1 powder injection with appropriate diluents ) , injection 36.8 ceftriaxone ( inj 1 gm / vial vial of 1 inection ) , inj 36.81 clarithromycin ( tablet 250 mg ) , tablet 36.82 clindamycin ( capsule 150 mg ) , capsule 36.83 cloxacillin ( capsule 125 mg ) , capsule 36.84 cycloserine ( capsule 125 mg ) , capsule 36.85 clofazimine ( tablet 50 mg 4 ) , tablet 36.86 diethylcarbamazine ( oral liquid 120 mg / 5 ml 100 ml bottel ) , liquid 36.87 diloxanide furoate ( tablet 500 mg ) , tablet 36.88 doxycycline ( dry syrup 50 mg / 5 ml ) , syrup 36.89 ivermectin ( tab 12 mg ) , tablet 36.9 norfloxacin ( dispersible tablet 100 mg ) , tablet 36.91 sodium aminosalicylate granules ( 10 gm bottel of 100 gm ) , powder 36.92 fulvestrant ( inj 500 mg vial of 10 ml ) , injection 36.93 fulvestrant ( inj 500 mg vial of 10 ml ) , injection 36.94 pomalidomide ( cap 2 mg ) , capsule 36.95 topotecan ( inj 4 mg 4 ml vial ) , injection 36.96 levodopa ( a ) + carbidopa ( b ) ( tablet 100 mg ( a ) + 10 mg ( b ) cr ) , tablet 36.97 levodopa ( a ) + carbidopa ( b ) ( tablet 100 mg ( a ) + 25 mg ( b ) cr ) , tablet 36.98 levodopa ( a ) + carbidopa ( b ) ( tablet 250 mg ( a ) + 25 mg ( b ) ) , tablet 36.99 chlorthalidone ( 12.5mg ) , tablet 37 chlorthalidone ( 25mg ) , tablet 37.01 diltiazem ( sr tablet 90 mg 10x10 ) , tablet 37.02 enalapril maleate ( tab 10 mg ) , tablet 37.03 finofibrate ( tablet 160 mg ) , tablet 37.04 finofibrate ( tablet 40 mg ) , tablet 37.05 labetalol ( injection 5 mg / ml 4ml ampl ) , injection 37.06 protamine ( injection 50 mg / 5 ml 5 ml vial ) , injection 37.07 verapamil ( injection 5 mg / 2 ml 2 ml vial ) , injection 37.08 gum paint ( tannic acid ) ( 2% w / v 15 ml bottle ) , bottle 37.09 povidine iodine germicide ( gargle 20% w / v 100 ml bottel ) , bottle 37.1 benzoyl peroxide ( gel 5% 15 gm tube ) , tube 37.11 glycerin ( oral liquid 30 ml bottel ) , liquid 37.12 intraperitoneal dialysis solution ( 0.015 1.5% 500 ml ) , solution 37.13 intraperitoneal dialysis solution ( 0.025 2.5% 500 ml ) , solution 37.14 boro spirit ear drops ( 0.183 gm boric acid in 2.08 ml of alcohol 10 ml vial ) , drop 37.15 normal saline ( nasal drops: sodium chloride drops 0.05% w / v 10 ml vial ) , drop 37.16 wax solvent ear drops: benzocaine ( 2.7% w / v 10 ml bottel drop ) , drop 37.17 wax solvent ear drops:paradichlorobenzene ( 2 % w / v 10 ml bottel ) , drop 37.18 tab mebeverine ( tab 200 mg 10 x 15 ) , tablet 37.19 losartan ( 10 mg tablet ) , tablet 37.2 sucralfate ( 20 mg tablet 10 x 10 ) , tablet 37.21 ethinylestradiol ( tablet 0.05 mg 10x10 ) , tablet 37.22 ethinylestradiol ( tablet 0.01 mg ) , tablet 37.23 ethinylestradiol ( a ) + levonorgestrel ( b ) ( tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10x10 ) , tablet 37.24 human chorionic gonadotropin ( injection 10000 iu vial of 1 ml injection ) , injection 37.25 human chorionic gonadotropin ( injection 5000 iu vial of 2 ml injection ) , injection 37.26 medroxyprogesterone acetate ( injection 150 mg 1 ml / vial ) , injection 37.27 ormeloxifene ( tablet 30 mg 10x10 ) , tablet 37.28 premix insulin ( 30:70 injection ( regular: nph ) 2 vial of 100 ml ) , injection 37.29 iv human immunoglobin 5% iv ig ( ( 5mg / 100ml each ) , injection 100ml injection ) , injection 37.3 rabies vaccine human ( tissue culture ) id / im ( inj 2.5 iu / ml 1 vial with 1 ml diluents ) , injection 37.31 levosulbutamol ( 100 mcg 30 capsule in 6 pack with 1 dispecing device ) , capsule 37.32 levosalbutamol ( 50mcg / dose 30 capsule in 6 pack with 1 dispecing device ) , capsule 37.33 montelukast ( tablet 5 mg 10 x 10 ) , tablet 37.34 human albumin solution ( 0.05 bottel 250 ml ) , injection 37.35 dispersable tablet hydroxyurea ( 100 mg 10x10 ) , tablet 37.36 rh erythropoietin ( injection 2000 iu / ml prefilled syringe of 1 ml injection ) , injection 37.37 warfarin ( tablet 1 mg 10x10 ) , tablet 37.38 warfarin ( tablet 2 mg 10x10 ) , tablet 37.39 surfactant suspension ( inj 25 mg / ml ) , injection [ 37.4 fluconazole ( eye drop 3 mg / ml ( 10 ml vial ) , eye drop 5 ml eye drop ) , drop 37.41 prednisolone ( drops 1% eye 5 ml drop ) , drop 37.42 codeine ( oral solution 15 mg / 5 ml 60 ml bottle ) , solution 37.43 morphine ( injection 15 mg / ml 1 ml ampule ) , injection 37.44 risperidone ( 50 mg injection vial of 2 ml ) , injection 37.45 hydroxyethyl ( 6% saline solution for infusion ) ( starch 6%ip 500 ml bottel ) , infusion 37.46 nicotinamide ( tablet 50 mg ) , tablet 37.47 pyridoxine ( tablet 40 mg 10 x 10 ) , tab 37.48 riboflavin ( tablet 5 mg 10 x 10 ) , tablet 37.49 thiamine ( injection 100 mg / ml 1 ml / vial ) , injection ] 37.5 boot no 8, 9, 10. 37.51 sleeper no 6, 7, 8, 9, 10 37.52 weith machine mini ( 1gm to 5kg ) 37.53 heating mantle 37.54 inj multivitamine 37.55 onit eberconazlole cream 1% w / w 37.56 cassette ( 10 x 12 ) , consumable fujji 37.57 cassette ( 8 x 10 ) , consumable fujji 37.58 cassette ( 14 x17 ) , consumable fujji 37.59 centrifuse machine 37.6 blood presure machine digital 37.61 cassette ( 10 x 12 ) , consumable cr system 37.62 cassette ( 8 x 10 ) , consumable fujji cr sysyem 37.63 cassette ( 14 x17 ) , consumable cr system 37.64 lectolose 37.65 inj multivitamine 10ml 37.66 inj insulin 40 iu 37.67 inj capnea 37.68 inj fluorouracil 5 37.69 coden set...

Defence Research And Development Organisation - Madhya Pradesh

35013782 bids are invited for chemical ammonium persulfate , lysozyme , triton x 100 , urea , ammonium bicarbonate , bca protein assay kit , formic acid , tween 20 , 2 b mercaptoethanol , edta , acrylamide suitable for electrophoresis , bis acrylamide , trizma base , glycine , dithiothretol , iodoacetamide , glycerol , nacl , isopropanol , agarose for molecular biology , sodium dodecyl sulphate , 1x pbs powder , potassium chloride , sodium phosphate , sodium phosphate monobasic reagent plus , potassium phosphate, monobasic , bsa 10 gm , sodium bicarbonate , tween 80 , temed , etbr , bromophenol blue , coomassie blue dye r 250 , ponceau suitable for electrophoresis , imidazole , cyrstal violet , iptg , guanidine hydrochloride , nickel sulphate , peg 8000 1g , mgso4 , mncl2 , ca no3 2 , xylene cyanol , cacl2 molecular grade , pmsf , tmb total quantity : 324...

Indian Army - Madhya Pradesh

34879880 supply of expendable medical stores dopamine hcl40 mg / ml, 5ml inj 3 benzoyl peroxide 5% tube of 20 gms 4 framycetin sulphate cream bp 1% cream 15 gms 5 glycerin ( glycerol ) 6 hydroquinone 2% tube of 50 gm 7 ketoconazole lotion 2% bott of 75 ml 8 silver sulphadiazine 1% cream w / v jar of 500 gms 9 tretinoin 0.025% tube of 15gm 10 liquid antiseptic ( chlorhexidine solution ) with activator containing chlorhexidine gluconate bp 7.5% v / v cetrimide bp 15% w / v sufficient quantity of tab sodium nitrite 1g to make 0.4% soln with each 1 litre cont in air tight pack 11 dicyclomine hcl 20mg inj 12 insulin highly purified human neutral40iu / ml, 10 ml inj 13 insulin highly purified isophane ( human nph ) 40iu / ml, 10 ml inj 14 nourish renal ( 100 gm , providing 486 kcal , proteins 11.5g , carb 60.4g, fats 22.7g, ( min & vit ) 15 acyclovir ophth oint 3% w / v ( 175mg ) bott of 30 opticaps 16 ciprofloxacin hcl 0.3% + dexamethasone 0.1% bott of 17 gentamicin sulphate 0.3% w / v gentamicin base with hydrocortisone acetate ip 1% w / v eye & ear drops ott of 5 18 homatropine hydrochloride, sol 2% 19 ofloxacin 0.3% bott of 5 ml eye drop 20 sulphacetamide drops 20% ml ( sod ) in 10ml / 14ml amber 21 cetrizine syp 5mg / 5ml bott of 60 ml 22 vitamin e 200 mg cap 23 azelastine nasal spray 0.10% w / v 24 fluticasone propionate inhaler 50mcg / dose 25 ofloxacin 400 mg tab 26 fexofenadine hydrochloride tab 120 mg 27 inj gentamycin sulphate 40 mg 28 cream miconazole 29 glass, cover microscopic rectangular, 22 x 30mm made of usp no1 glass 30 micropipettes, tips for 500 1000 ul 31 alcohol methyl 32 sodium hypochlorite solution 10% 33 xylene ( xylol pure ) 34 arm sling strap 35 eye sodium chloride 36 eye drop systane 37 eye drop tear plus 38 capd fluid minicap 39 dettol hand wash 40 ear drop waxole 41 eye drop bepostatin 1.5 42 eye drop betaxolol 43 inj insulin humalog 50 / 50 prefilled syringe 44 inj leuprolide 22.5 mg 45 mometasone nasal spray 46 novo fine needle 47 cream melaglow 48 lactobacillus sachet 49 rotacaps levosalbutamol 50 syp aristozyme 51 tab atorvastatin 40 mg 52 tab bosentan 125mg 53 tab telmisartan + amlodipin 54 ointment heparin + benzylnicotine 55 ointment suncross 56 tab brivaricetam 25mg 57 inh buenocide 58 tab hydroxyzine 10mg 59 tab quitiapine 300mg 60 inj romiplastim 250mcg / 0.5ml 61 tab thyroxine 88mg 62 hydrocortisone acetate 25mg / ml, 5ml inj 63 adrenaline tartrate ( 1:1000 ) , 1ml inj 64 tramadol hc 50mg / ml inj 65 atropine sulphate 0.6mg, 1ml inj 66 lignocaine hci 2% ( without adrenaline ) 30ml in 67 ether solvent 68 tab vilazodone ( vilamide 20mg ) 69 eye drop sustane ultra 70 tab strocit 500mg 71 inj ree 10 72 tab olmetime amh 20mg 73 tab tinicar 74 tab platewell 75 tab macplate 76 tab serobid 50mg 77 tab triniclam forte 78 diclofenac sodium 50mg + paracetamol + serratopeptidase tab 79 lancet 80 tab glucosamine + diacerine 81 tab flupentixol + melitracen 82 tab nimodipine 30mg 83 tab perampenel 2mg 84 neomycin, beclomethasone, clotrimazole & lignbocaine ear drops ( 5ml ) 85 nasal spray mometasone furoate 50mcg 100mdi 86 inj omnipaque 350mg / 100ml 87 tab nifedipine retard 30mg 88 inj dexamethasone ( 2ml / 8 mg ) 89 tacrolimus ointment 0.03% tube of 10mg ( like hhmus ) 90 tacrolimus ointment 0.01% tube of 10mg ( like hhmus ) 91 oint fluticasone propionate 0.05% w / v 10gm 92 lotion mometasone furoate0.1% 10gm ( like hhsone ) 93 cream clobetasole 0.05% + salicylic acid 3.5%, 30gms ( like cream dipsalic ) 94 cream luliconazole 1, tube of 10gm 95 tab / cap zeaxanthing+ lutein + astaxanthin + zinc + beta carotene+ carotenoids 96 hydroxy propyl methyl cellulose ( hpmc ) eye drops 0.3%, 0.5%, 0.7% 97 syp disodium citrate 100ml 98 gargel povidone iodine 2% 100ml bott 99 rotacap tiova 100 syp polybion...

Directorate Of Medical Education - Madhya Pradesh

34429793 tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 20 ?l tips , tips ii. 20 200 ?l tips , tips iii. 200 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 20 ?l filter barrier tips , ii. 20 200 ?l filter barrier tips , iii. 200 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 200?l tubes , ii. 200 600 ?l tubes , iii. 500 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 200?l tubes stand , ii. 200 600 ?l tubes stand , iii. 500 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 20 ?l filter barrier tip box , ii. 20 200 ?l filter barrier tip box , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1 2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58 600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol bio grade ) 100 ml / 250 ml , 4’, 6 diamidino 2 phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme hinf i , restriction enzyme hpych4 , restriction enzyme mboii , restriction enzyme bstui , restriction enzyme mvai , primers , fmr1 set 1 –f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ , exon 3 set 1 –f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g 3 , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’r5 tgattcc catggtctgtagcac 3’pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’r 5’ tctgcattttaactatggctc 3’bat 26 set 1 f5’ tgactacttttgacttcagcc 3’r5’ aaccattcaacatttttaaccc 3’ , d2s123 set 1 f5’ aaacaggatgcctgccttta 3’ r5’ ggactttccacctatgggac 3’ , d5s346 set 1 f 5’ actcactctagtgataaatcggg 3’ r5 agcagataagacagtattactagtt 3 , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ , r5’ aggctctgctg agctcctac 3’ , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ , hsp 70 primer sequence5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. , mthfr f:5 tgtggtctcttcatccctcgc 3;r: 5 ccttttggtgatgcttgttggc 3. , dpyd f:5 actcaatatctttactctttcatcaggac 3. r: 5 acattcaccaacttatgccaattct 3. , tyms f:5’ ggtacaatccgcatccaactatta 3’ r:5’ ctgataggtcacggacagattt 3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg 3’and reverse:5’cctcctcccttctggtcagtt 3’ , cox 2 forward: 5 cagccatacagcaaatcc 3; reverse: 5 tcgcacttatactggtcaa 3 , hmlh1f 5 ttt tga tgt aga tgt ttt att agg gtt gt 3r 5 acc acc tcatcataa cta ccc aca 3 , ppar g ( pro12ala ) , f5gcc aat tcaagc cca gtc 3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 , methylated ( hmlh1 ) f 5 acg tagacg ttt tat tag ggt cgc 3 r 5 cct catcgtaac tac ccg cg 3 , hmsh2 f 5 ggt tgt tgt ggt tgg atg ttg ttt 3 r 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) f 5 tcg tgg tcg gac gtc gtt c 3 r 5 caa cgt ctc ctt cga cta cac cg 3 , ? actin: forward: 5’ ctacgtcgccctggacttcgagc 3’ ß actin: reverse: 5’ gatggagccgccgatccacacgg 3’ , kras forward: 5 gactgaatataaacttgtggtagttggacct 3.reverse: 5 ctattgttggatcatattcgtcc 3. , braf forward: 5 tcataatgcttgctgatagga 3. reverse: 5 ggccaaaaatttaatcagtgga 3. , mthfr ( c677t ) ‘‘5 gcacttgaaggagaaggtgtc 3” and reverse primer ‘‘5 aggacggtgcggtgagagtg 3” , mthfr ( a1298c ) forward ‘‘5 ctt tgg gga gct gaa gga cta cta c 3” and reverse ‘‘5 cac ttt gtg acc att ccg gtt tg 3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai 1 elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’ methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2 mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size ) ...

Directorate Of Medical Education - Madhya Pradesh

34145016 supply of medicine / surgical / iv fluid / surgical suture / surgical stapler / chemical kits aceborophylline 100 mg amantadine 100mg capsule apripitant capsule 125mg & 80mg calcitrol 0.25 mg cap calcitrol 0.5mg capsule calcitrol calcium carbonate and zinc capsule chloramphenicol 250mg capsule chloramphenicol 500mg capsule crizotinib 250mg capsule cyclosporine 100 mg cyclosporine 50 mg deferiprone 500 mg cap. imatinib mesylate 100 mg oseltamivir ( 45mg ) , capsule palbociclib 100 mg cap palbociclib 75 mg cap sildenafil 20mg tetracycline capsules 250 mg tetracycline capsules 500 mg ulipristal acetate capsules 5mg acyclovir 3% ear drop beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5% 5 ml ear drop fluromethanol eye drop gentamycin eye drop homatropine hydrobromide eye drop ip 5ml sterile lignocaine hcl 4% eye drop natamycin eye drop polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml polyvinyl alcohol 1.4% 5 ml prednisolone eye / drop. proparacaine hydrochloride 0.5% eye drops 5ml sodium chloride opthalmic solution 5% eye drop acyclovir 3% eye oint.5 gm tube atropine eye oint. 3gm tube chloramphenicol eye ointment 5 gm tube ciprofloxacin eye ointment 5 gm tube hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment tobramycin eye oint.3gm tube benzocain gel chlorhexadine gel choline salicyclic gel triamadone accetate gel sterile collogen granules nephro steril ( alanine 6.3 gm+l arginine 4.9 gm+l histidine 4.3 gm+l isoleucine 5.1 mg+l leucine 10.3 mg+l lysine 10.01 gm+l phenylalanine 3.8 gm+l threonine 4.8 gm+l valine 6.2 gm+methionine 2.8 gm+n acetylcarnosine 0.5 gm+proline 4.3 gm+serine 4.5 gm+tryptophan 1.9 gm ) 250ml infusion normal saline 1.6% 500 ml bottle parenteral nutrition two chamber bags without lipid ornidazole iv infusion 100ml bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle sodium chloride hyper tonic n / 2 ( 0.45% ) 500 ml ffs bottle sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle desflurane 240ml bottle solution usp inhalation anaesthetic adalimumab 20mg / 0.4ml inj adalimumab 40mg / 0.8ml inj adenosine 3 mg / ml 2 ml amp ado trastuzumab emtansine 100 mg inj alteplase 50mg inj amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle aminophylline 25 mg / ml 10 ml vial ampicillin+sulbactum 1.5 mg inj anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d anti human thymocyte immunoglobulin 25 mg anti scorpion venom inj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj benzathine penicilline 12 lac iu / vial betamethasone sodium phosphate 4 mg / ml 1 ml amp biphasic insulin aspart ip penfill 100 iu inj 3 ml cartridge bortezomib 3 .5 mg / vial botalinin 100iu inj botalinin 200iu inj botulinum toxin type a injection buprenorphine hydrochloride 0.3mg base / ml 1ml amp inj butorphanol 1mg / ml 1ml amp carboprost tromethamin 250 mcg / ml 1ml amp cefuroxime 1.5gm inj cefuroxime 500mg inj cetuximab 100mg 2mg / ml vial cetuximab 200mg 2mg / ml vial cetuximab 50mg 2mg / ml vial chloramphenicol 500mg inj chlorpromazine ip 25mg vial cholecalciferol 600000 iu / ml injection cis atracurium 2mg / ml vail cladribine 10 mg / 10ml inj clonidine hydrochloride 100 mcg / ml 10 ml vial contrast urograffin inj cytarabine 1000 mg iv cytarabine 100mg injection cytarabine 1gm inj daunorubicin 50 mg / vial dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) dextron 40 inj diatrizoate meglumine & diatrizoate sodium ( 37% ) vial diatrizoic acid 60% amp diatrizoic acid 65% amp diatrizoic acid 76% ( urographin dye ) injection diazepam 5 mg / ml 2 ml amp dicyclomine 10mg / ml 2 ml vial digoxin i.p. 0.5mg / 2 ml amp diltiazem 25mg / 5ml vial diphtheria antitoxin 1000 iu vial doxorubicin 500mg injection doxycyclin 100 mg injection edaravone 60 mg inj enalapril maleate inj 1.25 mg per ml 2ml vial ephedrine 30mg / ml 1ml inj esmolol / 40mg / ml 5 ml vial etanercept 25mg inj etanercept 50mg inj etomidate 2 mg / ml emulsion with mct 10ml vial fentanyl 100 microgran 2 ml amp fentanyl 50 microgran 2 ml amp fluorescein 20% 5 ml amp flupentixol 20 mg inj flupentixol 25 mg inj fluphenazine 25 mg / ml 1 ml amp ganciclovir 500 mg vial gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp gatifloxacin vial gentamycin 80mg / 2ml amp glutathion 600mg inj granulocyte colony stimulating factor ( gcsf ) inj haemocoagulase 1 iu inj haemophilus influenzae type b vaccine hepatitis b vaccine / 1ml hyaluronidase 1500 iu / 2ml amp ifosfamide + mesna 1gm inj infliximab 100mg inj insulin glargine injection iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle isobaric levobupivacaine 0.5% inj isoprenalin inj 1ml amp isoxsuprine hcl 5mg / ml 2ml amp ketamine hydrochloride 50 mg / ml 10 ml ketoprolac tromethamine 30 mg inj l aspiraginase 10000iu inj leuprolide 6.25mg inj levobupivacaine hyperbaric 0.5% lidocaine 4%, 5 ml vial lignocaine ( preservative free ) 2% 50 ml vial lignocaine 10% injection lignocaine 4% 30 ml vial lignocaine for spinal anaesthesia lignocaine 5% + destrose 7.5% 2 ml amp heavy lorazepam 2 mg / ml, 1 ml vial low molecular weight dextran 40000 vial mannicoccal acwy 0.5 ml inj meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial mephentermine 30 mg / ml 10 ml mesna 200mg injection methacarbamol 100 mg. / 10ml vial methotrexate 500mg injection metoprolol 5mg / ml 5ml vial micafungin 100 mg micronised progesterone 50mg / ml 2ml amp micronized progesterone 100mg / ml 2ml amp milrinone 1mg / ml solution for injection / infusion mitomycin c 40mg inj mitoxantrone 15 mg inj morphine sulphate 10mg / ml 1ml amp naloxone 0.4 mg / ml, 1 ml nikethamide amp nimodipine 10mg / 50ml injection nitrofurantoin injection olanzapine 10 mg inj olanzapine depot inj panitumumab 100mg / 5ml inj pembrolizumab 100mg / 4ml ( 25mg / ml ) penicillin v 125 mg inj pentoxiphylline 20 mg / ml pertuzumab 30mg / ml ( 420mg / 14ml ) phenobarbitone 100mg / ml 1ml amp. phenobarbitone 200mg / ml 1ml amp. pilocarpine 0.5 % / 1ml amp piperacillin 2 gm+tazobactam 250 mg placenta extract 2 ml injection pneumococcal vaccine 10 ml vial pregabalin inj progesterone b.p.100mg vial promethazine 2 ml / 2.5% vial protamine sulphate 1%, 10mg / 5ml amp quinine sulphate 300 mg / ml, 2 ml amp romiplostim 250 mg injection romiplostim 500 mg injection ropivacaine 0.5% 20 ml vial ropivacaine 0.75% 4ml amp ropivacaine 10mg / ml 2.5ml vial ropivacaine hydrochloride 0.2% 40mg / 20ml vial ( 2mg / ml ) ropivacaine hydrochloride 0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) sargramostim 500 mg inj soluble insulin penfill 3 ml injection surfactant ( porcine lung surfectant extract 80mg / ml ) terbutaline 0.5mg / ml aml amp teriparatide 600mcg 3 ml amp tetanus immunoglobulin usp 500 iu / vial thiamine 400mg inj thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) thiopentone sodium 0.5gm powder / vial, 20 ml vial tobramycine 80 mg vial tocilizumab 400 mg inj torsemide inj 2ml amp trypan blue opthalmic solution 0.06% pre filled syringe ulinastatin 100000iu injection urokinase 500000 iu vial vasopressine 40 iu / ml amp verapamil hydrochloride 2.5 mg / ml 2ml amp vinblastine 10 mg / 10 ml amp vinorolbine 50mg inj vit d3 injection vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide 12 mg inj water for injection 10 ml amp zuclopenthixol acuphase 50 mg inj zuclopenthixol decanoate 200 mg inj acetic acid solution 3% 100ml acetone detection kit ada kit ae 1 / ae 3 aluminium ammonium sulphate powder 500gm amacr ana test kit anti a lactin 05ml anti ab sera 10ml anti d igg+ igm 10ml anti d igm 10ml anti h lactin 05ml anti her / erbb2 monoclonal anti human globulin ( ahg ) 05ml anti a sera 10 ml anti b sera 10 ml banded use in blood bank barium chloride 10 % 500 ml bcl 2 benedict reagent 5 lit cane bismark brown stain 100 gm blood culture media aerobic for adult ( bac t / alert pf plus blood culture media anaerobic for pediatric ( bac t / alert pf plus ) blotting paper 50 / pkt bovine albumin 22% 05ml buffer solution for hiv 50ml ca 125 calcium chloride 05ml / vail capillary tube cd34 combined spinal epidural ( cse ) kit couplin jar cover slips size 18x18mm cover slips size 22x22mm cox 2 csf protein kit cyclin d 1 cyto fix spray desmin disposable microtome blade ( 50 blades in one ) dpx mount 250ml ehlrich aldehyde reagent 125 ema estrogen receptor epi monoclonal filter paper 12.5 cm 0.1 micron ( 50 per pkt ) fouchet reagent 250ml glacial acetic acid 100 ml glial fibrillary acidic protein ( gfap ) h2so4 25 % 500 ml bottle haematoxylene 5gm haemoglobin strip hbv elisa test kit 4th generation 96 test hbv rapid test kit hpr polymerr kit with dab chromogen hydro chloride acid about 36.46% i.d. microtyping abd card i.d. microtyping gel card ahg immersion oil iso propyl alcohol ki67 / mib 1 06 ml antibody kit leishman stain 500 ml leucoreductionfilter ( bed side ) light green stain 100 gm liquid ammonia 500 ml liss diluent for gel card malaria parasite elisa test kit massons trichrome stain mercuri oxide 25gm methanol 2.5lit mgg 480ml multi parameter urine strips ( 100 in 1 box ) myogenin n / 10 hcl 500ml nfp nitric acid 500 ml nkx 3 1 p 53 pandys reagent 125ml pap pen papanicalou ea 125ml pea 030 papanicalou og 6 125ml pea 010 paraffin wax 58 60c pas stain pasture pipette poly l ltsin solution p8920 polythene gloves pricking lancet progestron receptor monoclonal retic stain 125ml s 100 sharp collection containers disposable 5 ltrs sharp collection containers disposable 1.5 ltrs single donor platelet kit make haemonotics / terumo penpol ( close system ) slide tray sma sodium chloride for analysis steel cassets for tissue processing sulpgar powder 500 gm sulpho salicylic acid 500ml synaptophysin tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) tissue paper roll titriplexiii pure ( edta ) tris buffer gr tween 20 for synthesis vdrl elisa test kit vimentin wafers cutting blade for tube welders xylene chlorhexidine mouthwash 0.2% 50 ml sterile haemocoagulase solution topical solution 0.2 cu nasal drop saline nasal gel 15 gm tube budesonide nasal spray 32mcg / spray methylcobalamin nasal spray 250 mcg saline nasal wash 3gm kit sodium chloride nasal wash betamethasone 0.5mg, gentamicin 1mg betamethasone valerate cream 0.05% 15gm betamethasone valerate ointment 0.1%, 15 gm tube centella asiatica extract based skin moisturization and antiscar gel 30gm clindamycin ointment 10gm fluconazole ointment 20 gm tube fusidic acid 2%, 15 gm heparin 20gm oint human placental extract ointment ketoconazole cream lidocaine zinc oxide ointment luliconazole cream la magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm papain urea and silk protein based debriding ointment and cream 100 gm papain urea and silk protein based debriding ointment and cream 25 gm papain urea and silk protein based debriding ointment and cream 50 gm papain urea 15 gm tube povidone iodine ointment 7.5%, 500 gm salicylic acid 2%, 30 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm silver sulphadiazine cream usp 1% w / w 250gm clotrimazole+beclomethasone oral paint triamcinolone oromucosal paste bp 0.1% ketocanazole oral paste triamcinolone acetonide dental paste usp 0.1% barium sulphate powder 250 gm clotrimazole powder neomycin sulphate+polymycin b powder polyethylene glycol + electrolyte powder protein powder silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial n acetylcysteine solution for inhalation respules tiotropium ( 18 mcg ) + formoterol ( 12 mcg ) fostomycin sachet 3gm orodispersible probiotic sachet acyclovir lotion beclomethasone lotion citric acid 500 ml bottle compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml feracrylum solution 1% 100 ml gention violet l / a glycerine 15% and sodium chloride 15% enema 20ml sodium hypochloride solution 5% 5 ltr topical heparin solution 5ml vial benzocaine +cetramide spray lignocaine spray 10% absorbable 2 0 endo suture cartridge 48 length advance rf energy hand instrument of 5 mm shaft diameter for laproscopic procedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 31 mm diameter having varied staple height of 4 4.5 5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 3.5 4 4.5mm circular stapler for end to end anastomosis with 33 mm diameter having varied staple height of 4 4.5 5mm disposable circular stapler 31mm diameter disposable circular stapler – 32mm diameter disposable circular stapler 33mm diameter disposable circular stapler iii rows disposable circular stapler 25 / 26mm diameter disposable circular stapler 28 / 29mm diameter disposable clip applier medium 10mm with 20 clips disposable clip applier medium 5mm with 16 clips disposable curved cutter stapler disposable hemorrhoidal stapler iiirows disposable hemorrhoidal stapler with detachable anvil. disposable linear stapler with fixed staple height 75mm 90mm size disposable linear stapler with fixed staple height 55mm 60mm size disposable trocar 05mm disposable trocar 10mm disposable trocar 12mm disposable trocar 15mm distal tip closure titanium ligation clip large size distal tip closure titanium ligation clip medium size distal tip closure titanium ligation clip small size endoscopic cutter & stapler 60mm long length endoscopic cutter & stapler 60mm regular length endosuturing device 10mm with toggle lever handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh handpiece ( transducer ) compatible with ultrasonic vessel sealing dissector installed in myh hemorrhoid stapler 33.5 mm diameter with detachable anvil, bridged anoscope, housing of 20 cc locking clip cartridge medium / large mesh fixation device with non absorbable titatinum tacks 20 multifire clip applier long size 15 clip multifire clip applier small size 20 clip non absorbable 2 0 endo suture cartridge 48 length open clip applicator 100 20cm length open clip applicator 200 20cm length open clip applicator 300 open clip applicator 400 open disposable clip applier for medium clip size 9.75 having 20 clips open linear cutter reload with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter reload with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 3.5 4 4.5 mm in reload having 60mm length open linear cutter stapler compatible with 3 rows of staple line having varied satple height of 4 4.5 5 mm in reload having 60mm length plastic locking clip applicator medium / large polycearbonte bladeless trocar with reducer seal 10mm polycearbonte bladeless trocar with reducer seal 12mm polycearbonte bladeless trocar with reducer seal 5mm polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm reload 55 60mm for medium thick tissue blue compatible with linear cutter. reload 55 60mm for thin / vascular tissue white compatible with linear cutter. reload 75 80mm for medium thick tissue blue compatible with linear cutter. reload 75 80mm for thick tissue green compatible with linear cutter. reload compatible with curved cutter reload endoscopic cutter & stapler 45mm purple reload endoscopic cutter & stapler 60mm purple reload endoscopic cutter & staplter 45mm blue reload endoscopic cutter & staplter 45mm green reload endoscopic cutter & staplter 60mm / black reload endoscopic cutter & staplter 60mm blue reload endoscopic cutter & staplter 60mm gold reload endoscopic cutter & staplter 60mm green reload endoscopic cutter & staplter 60mm white reload for linear stapler with fixed staple height 35mm 45mm size blue reload for linear stapler with fixed staple height 35mm 45mm size green reload for linear stapler with fixed staple height 55mm 60mm size blue reload for linear stapler with fixed staple height 55mm 60mm size green reusable laparoscopic clip applicator for large titanium clips with 15cm 20cm length reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly reusable laparoscopic clip applicator for large titanium clips. reusable laparoscopic clip applicator for medium large titanium clips with 28cm 30 cm length reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly reusable linear cutter 55 60mm with 200 firing reusable linear cutter 75 80mm with 200 firing single use clip applier with 16 clips, 5mm diameter having display counter instrument u shaped clip suture locking autolock titanium clip 100 titanium clip 400 universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m. paracetamol suppository abdominal drain no 8 abdominal drain bag accessory spikes amorphous hydrogel with colloidal silver antimicrobial , liquid parafin based silver sulphate antiseptic tulle 10cmx12cm antimicrobial incise drape 3 meter antimicrobial, liquid paraffin based chlorhexidien antiseptic tulle 10cmx12cm arterial pressure bag 1000ml arterial pressure bag 500ml ash brace m size barium sulphate liquid 1 liter bionet connector biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered bipolar forceps cable bis monitor electrode black monofilament 2 / 0 rc loop black thread ( stitching ) big bleaching powder gr ii 25 kg bag blood bag double 350 ml cpd solu blood bag double 350 ml with sagam blood bag quadruple 350 ml top bottom with cpd sagam solu blood bag quadruple 450 ml top bottom with cpd sagam solu blood bag single 350 ml blood bag transfer 350 ml blood bag triple 350 ml blood bag triple 350 ml sagam blood culture bottles bone marrow aspiration needles ( 14 ) bone marrow aspiration needles ( 15 ) bone marrow aspiration needles ( 16 ) bone marrow aspiration needles 13 g bone marrow biopsy needle bp cuff adult & pediatric carbolic acid 500 ml cardiovascular angiographic catheter 100cm, 4fr ( 1.35mm ) catheter single lumen 6.6 no catheter single lumen 7.7 no cautery patient plate disposable central venous line 4f cerebral catheter reservoir 12mm dia chamber cerebral catheter reservoir 18mm dia chamber cervical soft collar chlorhexidine gluconate dressing material chlorinated lime with boric acid solution 400ml cling drape 15x500cm closed suction trachostomy suction tube with pro s collegen patch collogen sheet 10x10 collogen sheet 15x15 colostomy kit condom catheter small, meadium, large conjugated drain craniotomy cutter blade cresol with soap solution 5ltr jar cvp manometer cylinder connection nut dermatome blade disposable haemorrhoidal circular stapler with dual safety with transparent housing size 34 dj stent 6 / 26 double monitoring pressure transducer dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. dura guide for neuro surgery ecg paper 80mmx20 mtr roll ecg paper computerized triple channel 20m elastomeric pump for post operative analgesia endo stich lap suturing device 10 mm endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 exchange transfusion catheter with four way adaptor size 4cm, l 40 cm extra ventricular drain ( evd ) fibrin & tissue glue fluorescein strips pkt foam sclerotherapy fibre fogartis catheter 4 fr gasket for vaccume jar 1000 ml gasket for vaccume jar 600 ml gasket for humidifier bottel guide wire m 0.89mm, 150cm halogen bulb holder ( heavy duty ) hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) hip u drape humbys knife disposable blade hydrocephalus shunt medium pressur ( vp shunt ) hydrogen peroxide 21% w / w, paracetic acid 4% w / w, acetic acid 10% w / w ( cold st disinfectant for dialysis ) icd bag implantable pain port with epidural catheter for long term pain management impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 14 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 16 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 18 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 20 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 22 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 24 balloon capacity between 1ml to 30ml, 50ml impregnated antimicrobial latex two way foleys catheter with silicon coated.it should be impregnated with silver nano particles to prevent catheter associated uti and catheter blockage should have strong drainage funnel, double fixed non return valve for free inflation and deflation. size 26 balloon capacity between 1ml to 30ml, 50ml intraocular lens 14 30d dioptre intravenous drip set pediatric size introducer sheath 0.97mm 6fr, ( 2.0mm ) , 11 cm introducer sheath 0.97mm, 7 fr, ( 2.3mm ) , 11cm j r c bag 1 ltr j r c bag 1.5 ltr j r c bag 1 / 2 ltr 500ml kehr t tube laser radial fibre 600 micron and 400 micron liga clip 200mm, 300mm, 400mm liver biopsy gun long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm mackintosh double colour water proof roll ( 20 meter per roll ) malecot rubber catheter no 12 malecot rubber catheter no 16 malecot rubber catheter no 20 malecot rubber catheter no 22 malecot rubber catheter no 24 medical dry imaging film 10x12 medical dry imaging film 14x17 medical dry imaging film 8x10 methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 microlaryngeal surgery tube no 5 monopolar cautry wire disposable neonatal urine collection and measurement bag 100 ml omaya reservoir large size oxygen adaptor 5 type oxygen catheter oxygen connection with flow meter for central line oxygen connection with flow meter for cylinder oxygen high pressure hose pipe oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) oxygen regulator for control penal board ( oxygen pipe line ) oxygen tailpipe ( flexible metalic ) pacing leads 6 fr paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, paraffin gauze dressing material 10x10cm pediatric diapers peritonial dialysis catheter 200mm pediatric peritonial dialysis catheter 280mm adult peritonial dialysis fluid 1ltr. pigtail catheter 6 fr ( 150 cm ) pigtail catheter with needle 6 fr ( 30 cm ) plaster of paris powder ip 1 kg pkt plastic nozel cap post exposure prophylaxis kits ( pep kits ) pressure regulated v p shunt for peadtric probe for oxygen radiopaque polyurethane catheter with fixation wings and integral extension tube 2f, 5f ( leader flex ) rectified sprit 4.5 ltr. scrotals support short pencil point spinal needle g 25 / 22, l 38mm. sics kit ( small incision cataract surgery ) silicon / double nasal prong with universal connector. all sizes silicon cautery plate silicon folyes catheter 14 fr silicon folyes catheter no 12 silicon tubing set for endoflaton silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm silk protein based sterile surgical wound dressing sheet 20 cmx 40 cm silk protein based sterile surgical pu foam dressing 20cmx20cm silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilized sizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr soda lime for anesthesia workstation 5kg spatula for papsmear sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. sterile post‐operative surgical dressing surgical kit drape gown t.piece circuit with oxygen tubing set ( complete set ) tear test strip ( 100 strips in box ) terrimo guide wire thomas splint tmt graph paper tommy syringe tounge depresser wooden tracheostomy filter transducer set for invasive b.p. triway folyes catheter no 22 turp set ureteric catheter urine collecting bag with urometer 1 ltr. vaccum adaptor 5 type vaccum pump belt vaccum pump oil vaccum regulator ventilator circuit ( heated wire ) ventilator mask water bed wipes wound protector extra small incision size 2 4 cm wound protector large incision size 9 14 cm wound protector large incision size 9 14 cm with retraction ring wound protector medium incision size 5 9 cm wound protector small incision size 2.5 6 cm x ray casset 12x15 x ray casset 10x12 x ray casset 8x10 x ray developer 22.5 lit. x ray films size 10x12 50film per pkt blue sensitive x ray films size 12x15 50film per pkt blue sensitive x ray films size 8x10 50film per pkt blue sensitive x ray fixer 22.5 lit x ray hangers ( clip type ) 10x12 x ray hangers ( clip type ) 12x15 x ray hangers ( clip type ) 8x10 x ray screen high speed 12x15 x ray screen high speed 8x10 x rayscreen high speed 10x12 180 absorbable polyglyconate knotless wound closure device with unidirectional 0 30cm , green 37mm 1 / 2 circle taper point 180 absorbable polyglyconate knotless wound closure device with unidirectional 2 0 30cm , green 37mm 1 / 2 circle taper point 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 12cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 15cm 3 dimentional polyester mesh with micro porosity, x stich macro porosicty and multidirectional elasticity with optimesed atello collagen 1 absorbable anti adhesive barrier 20cm 5 mm helical shaped non absorbable titanium tacker for laproscopic mesh fixation device with 30 tacks 5 mm screw shaped polyglycolic lactic acid absorbable tacker for laproscopic mesh fixation fevice with min 30 tacks absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved absorbable unidirectional barbed device polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device symmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm black braided silk 2 0 rb 5333 suture 17mm 1 / 2c taper black braided silk 3 0 rb suture 17mm 1 / 2c taper black braided silk 5 0 rb suture 17mm 1 / 2c taper black braided silk eyeless needled suture usp, size 8 0 suture length 76cm, needlelength & description 3 / 8 circle round bodied 30mm blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. knotless wound closure device with unidirectional 2 0 45cm , undyed 24mm 3 / 8 circle reverse cutting knotless wound closure device with unidirectional 3 0 58cm , undyed 24mm 3 / 8 circle reverse cutting macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene. 15cmx15cm monofilament glycomer 0, 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 1 , 90cm , violet 40mm 1 / 2 circle taper point monofilament glycomer 2 0 , 75cm , violet 27mm 1 / 2 circle taper point monofilament glycomer 3 0 75cm , undyed 24mm 3 / 8 circle reverse cutting monofilament glycomer 3 0 75cm , violet 22mm 1 / 2 circle taper point patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or and us fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. perforator 14mm pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system polydioxanone 122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. polydioxanone barbed suture 1 0 polydioxanone suture voilet monofilament 17mm 1 / 2c taper no 4 0 90cm polydioxanone suture voilet monofilament 40mm 1 / 2c blunt point 1 240cm polydioxanone suture voilet monofilament double armed trocar point 2 0 70cm polydioxanone suture clear monofilament 36mm 1 / 2c taper 3 0 70cm polydioxanone suture voilet monofilament 17mm 1 / 2c 5 0 70cm polyglactin 4 0suture undyed braided 1 / 2c reverse cutting polyglactin 910 with triclosan no. 0 x 90 36mm hc rb polyglactin 910 with triclosan no. 1 x 100 55mm hc rb polyglactin 910 with triclosan no. 1 x 90 36mm hc tc progrip self fixating mesh 12*08cm progrip self fixating mesh 14*9cm progrip self fixating mesh 15*15cm progrip self fixating mesh 20*15cm progrip self fixating mesh 30*15cm protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved sterilised surgical needled suture 8mm 1 / 4 spatulated micropoint double 5 0 sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved synthetic absorbable surgical suture triclosan coated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm synthetic absorbable surgical suture triclosan coated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system v shape clip applicators large v shape clip applicators medium v shape clip applicators small v shape ligation clip large v shape ligation clip medium v shape ligation clip small aciclovir 200mg / 5ml oral suspension 100ml bottle albendazole suspension 200 mg / 5ml bottle baclofen oral solution ip 1mg / ml syp calcium phosphate, 2:1 ratio, 100 ml bottle carbamazepine oral suspension usp 100ml syp chloramphenicol palmitate oral suspension ip 125mg / ml 100ml syp chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle ciprofloxacin 125mg / 5ml syp 60 ml bottle co trimoxazole 30 ml cyanocobalamin 7.5 mcg+ferrous ammonium citrate 160 mg+folic acid 0.5 mg / 10ml cyclosporine oral solution usp 100mg / ml 50ml syrup cyproheptadine + lycine and vitamins 200ml syp cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml bottle domperidon suspension 1mg / ml 30 ml bottle etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle ibuprofen oral suspension bp 100mg / 5ml 100ml syp iron+zinc syp metronidazole 200mg / 5ml suspension 60ml bottle nitazoxanide 100mg / 5ml 30 ml bottle norfloxacine suspension ( 30 ml bottle ) oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle paracetamol oral solution 150mg / ml 15 ml bottle with dropper paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) phenobarbitone syp 30ml. 20mg / 5ml. phenytoin sodium suspension 30mg / 5ml 100 ml bottle prednisolone sodium phosphate solution 5mg / 5ml 60ml syp salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle sodium valporate oral solution 100ml syp sorbitol 7.15 gm+tricholine citrate 0.55 gm sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle trypsin bromelain & rutoside trihydrate tablets 6 mercaptopurine , 50mg acarbose 25 mg aceclofenac 100mg+paracetamol 500mg , tablet aceclofenac+thiocolchicoside 100mg+4mg tablet aceclofenace 100mg+serratiopeptidase 15mg tab acenocoumarol 2 mg tab acenocoumarol 1mg acyclovir 200mg tab ademetionine 100mg tab afatinib 40 mg agomelantine 025 mg tab alpha lipoic acid 100 mg+folic acid 1.5 mg+mecobalamin 1.5 mg+vitamin b6 3 mg ambroxol hydrochloride 30mg tab amitriptyline 10 mg amlodipine ( 5 mg ) + metoprolol ( 50 mg ) artemether 80mg tab artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab aspirin 75 mg aspirin 150 mg aspirin 75 mg+clopidogrel 75 mg+rosuvastatin 10 mg aspirin 75 mg+prasugrel 10 mg atorvastatin 10 mg+aspirin 75 mg. baclofen 5mg tab benfothiamin 150mg betahistine 4mg tab betamethasone 0.5 mg bisoprolol 2.5 mg+hydrochlorothiazide 6.25 mg bisoprolol 5 mg+amlodipine 5 mg bosentan 62.5 mg tab brivaracetam 50mg tab bromocriptine 2.5mg tab buprinorphine 4mg buprinorphine 8 mg bupropion 300 cabargolin 0.25 mg cefadroxil 500 mg chlorthalidon 50 mg tab cilostazole 50mg tab cilostazole100mg tab cinnarizine 20 mg and dimenhydrinate 40 mg citicoline 500mg tab clopidogrel 75 mg+aspirin 75 mg clopidogrel 75 mg+atorvastatin 20 mg clotrimazole 400mg tab co trimoxazole tab cyclophosphamide 50 mg tab cyclosporine 300mg tab cynocobalmin + folic acid tab dapagliflozin 5mg tab dapsone 100 mg tab deferasirox dispersible 500mg tab deflazacort 6mg tab desmopressin 0.5mg tab dexamethasone 4 mg tab diphenylhydramine 50 mg domperidone+ranitidine 150mg tab drotaverine 40 mg tab drotaverine 80mg duloxetine 40mg dydrogesterone 10mg eltrombopag olamine 150mg tab empagliflozin 25mg tablet entecavir 0.5mg tab entecavir 1mg tab eplerenone 25mg erlotinib tablets ip 100mg escitalopram 10 mg tab esomeprazole 40mg ethambutol hydrochloride 400mg tab ethambutol hydrochloride 800mg tab etizolam+propranolol 20mg tab etophylline 77 mg+ theophyllin 23 mg etoposide 50 mg etoricoxib 90mg farmalin 1gm tab ( 100 tab per box ) fenofibrate 160mg tab ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) fludrocortisone 0.1mg tab folic acid 800 mcg fungal diastase 100 mg+papain 60 mg gabapentin 400 mg+nortriptyline 10 mg ganciclovir 1000mg tab glibenclamide 2.5mg tab gliclazide 60mg glimepiride 2 mg + metformin 500 mg + pioglitazone 15 mg glimepiride 2 mg+metformin 500 glipizide 5 mg+metformin 500 mg glucagon 0.1mg tablet glyceryl trinitrate 0.5 mg sublingual tab hydrocortisone 10 mg hydrocortisone 20mg tab hydroxyzine 10 mg tab hyoscine butylbromide tab 10mg ibuprofen 400 mg indapamide hemihydrate 1.5mg isoniazid 200 mg tab isosorbide 5 mononitrate 20 mg isosorbide mononitrate 30 mg itopride 150mg itopride hydrochloride 25 mg tab itopride hydrochloride 50 mg tab l carnosine 200mg tablet lactobacillus 120 lamotrigine 25mg tab lansoprazole 15mg tab lapatinib 250 mg levetiracetam 750mg tab levodopa + carbidopa 100+25mg levofloxacin 750mg tab loperamide 8 mg tab lorcaserine 10 mg tab losartan ( 50 mg ) + chlorthalidone ( 12.5 mg ) lurasidone 20 magnesium oxide 200 mg magnesium valproate 400 mg mebendazole 100 mg tab meclizine hydrochloride 25 mg mefenamic acid 250mg+dicyclomine 10mg tab megestrol acetate 40mg melatonin 3mg melatonin 6mg mercaptopurine 50mg tab mesalamine ( 5 aminosalicylic acid ) 400 mg tab metaclopramide 10 mg tab metformin ( 1000 mg ) + vildagliptin ( 50 mg ) metformin 500 mg+voglibose 0.3 mg methimazole 10 mg tab methocarbamol 500 mg. methotrexate 10 mg methotrexate 5 mg tab methylcobalamin +folic acid tab methylcobalamin 1500mg tab methyldopa 250 mg tab methylphenidate 10 mg methylphenidate 20 mg methylphenidate 5 mg metoclopramide 05 mg metoprolol 12.5 mg metoprolol 50 mg+ramipril 5 mg misoprostol 200 mg modafinil 200mg tab morphine sulphate 10mg tablet moxonidine 0.3 mg multivitamin tab nfi formula sugar coated vit a 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) mycophenolate mofetil, 500 mg n acetylcysteine 300mg tab naproxen 250 mg tab naproxen 500mg + domperidone 10mg tab naproxen 500mg tab nebivolol 5mg nicorandil 5 mg tab nicotinamide 250mg tab nicoumalone 1 mg nimesulide 100 mg nimodipine 30mg tablet nitazoxanide 200 mg nitazoxanide 500mg tab nitrocontin 2.6 nitroglycerin 2.5 mg ofloxacin 200mg +tinidazole 600mg tab ofloxacin 400mg tab olmesartan 10 mg olmesartan 20mg olmesartan medoxomil 20 mg+amlodipine 5 mg+hydrochlorothiazide 12.5 mg olmesartan medoxomil 40 mg+amlodipine 5 mg oxcarbazepine 150 mg tab oxcarbazepine 300 mg tab oxybutynin 2.5mg tab pancreatic enzyme 1000mg tab pancreatic enzyme 2000mg tab pancreatic enzyme 500mg tab pantoprazole 40 mg+domperidone 30 mg paracetamol, chlorpheniramine maleate, phenylephrine hydrochloride & caffeine tablets pazopanib 200mg / 400mg penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) pentoxifylline 400mg perampanel 4mg phenobarbitone 30 mg. pramipexol 0.26 sr pramipexol 0.50mg prazosin 10mg tab propranolol hydrochloride 40mg+flunarizine 10mg tab propylthiouracil 50mg prucalopride 2mg tab quetiapine 50mg tab racecadotril 100mg ranolazine sustained release 500mg tab rifaximin 550 mg tablet rivaroxaban 10mg tab rivaroxaban 15mg tab rivaroxaban 5mg tab rosuvastatin 20 mg sacubitril 24 mg+valsartan 26 mg secnidazole 500 mg tab sevelamer carbonate 400mg tab sevelamer carbonate 800mg tab sildenafil 25 mg silodosin 8mg tab sitagliptin 50 mg+metformin 500 mg sodamint tab solifenacin 5mg tab sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab sulfasalazine 500mg tab sunitinib 50 mg tapentadol 50mg tab telmisartan 40 mg+amlodipine 5 mg telmisartan 80 mg+amlodipine 5 mg telmisartan 80 mg+hydrochlorothiazide 12.5 mg teneligliptin 20 mg tenofovir disoproxil 300mg tab terbutaline sulphate 2.5mg tab tetrabenazine 12.5mg tab tetrabenazine 20 mg tab tetrabenazine 25mg tab thiamine 200mg tab thiamine 75mg thyroxine sodium 137 mcg thyroxine sodium 62.5 mcg thyroxine sodium 12.5 mcg thyroxine sodium 150 mcg thyroxine sodium 125 mcg thyroxine sodium 88mcg tablet tianeptine 12.5 mg tolperisone hydrochloride 150 mg tab tolvaptan 15 mg topotecan 1 mg torsemide 10 mg+spironolactone 50 mg tramadol 37.5mg and acetaminophen 325mg tablet valganciclovir 450mg tab valganciclovir 500mg tab valganciclovir 900mg tab valsartan 40 mg venlafaxine 75 verapamil 120mg tab vidagliptin 100mg tab vidagliptin 80mg vilazodon 20mg vilazodon 40mg voriconazole 100mg tab voriconazole 150mg tab voriconazole 200 mg voriconazole 50mg tab vortioxetine 20mg vortioxetine 10mg vortioxetine 5 mg warfarin sodium 5 mg tab zonisamide 100 mg tab zonisamide 50 mg tab...

Directorate Of Health Services - Madhya Pradesh

33747699 supply of medicine and material medicine and material , medicine name , atropine inj 0.6 mg / ml 2 ml amp , bupivacaine hcl inj 0.5% 20 ml vial , glycopyrolate inj 0.2 mg / ml 1 ml amp , halothane inhalation 250 ml bottle , isoflurane inhalation 250 ml bottle , ketamine inj 10 mg / ml 10 ml vial , lignocaine inj 2% 30 ml vial , lignocaine gel 2% 30 gram tube , lignocaine +adrenaline inj 2% + 0.005 mg / ml30 ml vial , midazolam inj 1 mg / ml 5 ml amp / 10 ml vial , pentazocine injection 30mg / ml 1 ml ampule , thiopentone inj 0.5gm powder / vial 20 ml vial , nitrous ( store under pressure in metal cylinders of the type conforming to the appropriate safety regulations and at temperature not exceeding 37°c ) , oxygeninhalation , promethazine injection 10 mg / mlone injection 1 vial , propofal injection 10 mg / ml 1 ml / vial , aceclofenec tab 100mg 10 x10 , acetylsalicylic acidtablet 150 mg 10 x 10 , acetylsalicylic acid ( aspirin ) *tablet 25 mg 10 x 10 , allopurinol tablet300 mg 10 x 10 , allopurinol tablet 100 mg 10 x 10 , aspirin tab 75 mg 10 x 10 , atracurium inj 10 mg / ml 2.5 ml amp , diclofenac tab 50 mg 10 x 10 , diclofenac inj 25 mg / ml 3 ml amp , diclofenac 1% gel , fentanyl 50 microgram / ml 2 ml amp , hydroxychloroquine tablet 200 mg 10 x 10 , ibuprofen tab 400mg 10 x 10 , ibuprofen oral suspension 100mg / 5ml 60 ml bottle , morphine inj 10 mg / ml1 ml amp , paracetamol tab 500mg 10 x 10 , paracetamol drops 125mg / ml drops 125mg / ml , paracetamol inj150 mg / ml 2 ml amp , paracetamol syp 125mg / 5 ml 60 ml bottle , paracetamol tab 650mg 10 x 10 , pregabalin tablet 150 mg 10 x 10 , succinyl choline inj 50 mg / ml10 ml vial , sulfasalazine tablet 500 mg 10 x 10 , tapentadol tablet 100 mg 10 x 10 , tramadol inj 50 mg / ml 2 ml amp , tramadol tab 50mg 10 x 10 , betahistine tab 8 mg 10 x 10 , cinnarizine tab 25 mg 10 x 10 , adrenaline inj 1 mg / ml 1 ml amp , betamethasone tab 0.5 mg 10 x 10 , betamethasone sodium phosphate inj 4 mg / ml 1 ml amp , cetirizine tab 10 mg 10 x 10 , cetirizine syp 5mg / 5ml 30 ml bottle , chlorpheniramine inj 10 mg / ml10 ml vial , chlorpheniramine oral liquid 2 mg / 5 ml , dexamethasone inj 8 mg / 2 ml 2 ml vial , dexamethasone tab 0.5 mg 10 x 10 , hydrocortisone inj 100 mg / vial dry powder 100mg / vial , hydrocortisone ointment 0.5% , hydrocortisone ointment1% , hydroxyzine syrup 10 mg / 5 ml , hydroxyzinetablet25 mg 10 x 10 , pheniramine injection 22.75 mg / ml 2 ml vial , prednisolone tab 20 mg 10 x 10 , promethazine syp 5mg / 5ml 60 ml bottle , ferrous ascorbate ( 100mg. elemental iron+ folic acid 1.5 mg ) 10 x 10 , phytomenadione injection 10 mg / ml 10 mg ampule , carbamazepine tab 200 mg 10 x 10 , carbamazepine tablet 200 mg 10 x 10 , carbamazepineoral liquid 100 mg / 5 ml , diphenylhydantoin tab 30 mg 10x10 , levetiracetam tablet 250 mg 10 x 10 , magnesium sulphateinjection 500 mg / ml , phenobarbitone inj 200 mg 1 ml amp , phenobarbitone tab 30 mg 10 x 10 , phenytoin inj 50 mg / ml 2 ml amp , phenytoin / diphenylhydantoin tab 100mg 10 x 10 , sodium valproate tab 500 mg 10 x 10 , sodium valproate syrup each 5ml contains 200mg 200 ml bottle , valproate oral solution 200mg / 5ml 100 ml bottle , desferrioxamine injection 500 mg vial , naloxone inj 0.4 mg / ml 1 ml amp , pralidoxime ( pam ) inj 25 mg / ml 20 ml amp , abacavir tablet 300 mg 10 x 10 , acyclovir inj 250 mg / vial vial , acyclovir tab 200 mg 10 x 10 , acyclovir tab 800 mg 10 x 10 , albendazole 200mg / 5 ml 10 ml bottle , albendazole tab 400 mg 10 x 10 , amikacin inj 100 mg / 2 ml 2 ml vial , amikacin inj 500 mg / 2 ml vial2 ml vial , amoxycillin cap 250 mg 10 x 10 , amoxycillin cap 500 mg 10 x 10 , amoxycillin oral suspension 125 mg / 5 ml30 ml bottle , amoxycillin +clavulanic acid inj ( amoxycillin 500 + clavulanic acid 100 mg ) / vial , amoxycillin +clavulanic acid syp ( amoxicillin 200mg + clavulanic acid 28.5mg ) / 5ml 30 ml bottle , amoxycillin +clavulanic acid tab ( amoxycillin 500 + clavulanic acid 125mg ) 10 x 10 , amphotericin b injection 50 mg vial / ampoules , ampicillin cap 500 mg 10 x 10 , ampicillin inj 500 mg / vial , artesunate inj 60 mg / vial , artesunate powder for injection 120 mg , artesunate + sulphadoxine + pyrimethamine ( age group 15 or above ) ab artesunate 200 mg ( 3tab ) + sulphadoxine 750 mg ( 2tablets ) + pyrimethamine 37.5 mg ( 2 tab ) tablets ip1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group 9 to 14 years ) ab artesunate 150mg ( 3tab ) + sulphadoxine 500mg ( 2 tab ) +pyrimethamine 25mg tab ip ( 2tab ) 1 combi pack , artesunate + sulphadoxine + pyrimethamine ( age group between 1 4 years ) tab artesunate 50 mg ( 3 tab ) + sulphadoxine 500 mg ( 1 tab ) + pyrimethamine 25 mg ( 1 tab ) tablets ip 1 combi pack , azithromycin tab 250 mg 10 x 10 , azithromycin tab 500 mg 10 x 10 , azithromycin syp 200mg / 5ml 15 ml bottle , benzathine penicilline 6 lakh iu / vial , benzathine penicilline 12 lakh iu / vial , cefixime tab 50 mg 10 x 10 , cefixime tab 200 mg 10 x 10 , cefixime oral suspension 100mg / 5ml 10 ml bottle , cefotaxime inj 250 mg / vial , cefotaxime inj 500 mg / vial , cefotaxime inj 1gm / vial , cefpodoxime tab 200 mg 10 x 10 , ceftazidime powder for injection 250 mg , ceftazidime powder for injection 1gm , ceftriaxone inj 250 mg / vial , ceftriaxone inj 500 mg / vial , ceftriaxone inj 1 gm / vial , cephalexin cap 250 mg 10 x 10 , cephalexin syp 125mg / 5ml 30 ml bottle , chloroquine inj 40 mg / ml 5 ml amp , chloroquine syp 160mg / 10ml ( 50mg / 5ml base ) 60 ml bottle , chloroquine tab 250 mg 10 x 10 , ciprofloxacin tab 250 mg 10 x 10 , ciprofloxacintab 500 mg 10 x 10 , ciprofloxacin inj 200 mg / 100 ml 100 ml ffs bottle , clarithromycintablet 250 mg 10 x 10 , clindamycin capsule 150 mg 10 x 10 , clofazimine tablet 50 mg 4 10 x 10 , clofazimine capsule 100 mg 10 x 10 , clotrimazole ( vaginal tab ) pessary 500 mg ( with applicator ) single tab , clotrimazole cream 2%w / w 15 gram tube , cloxacillin capsule 125 mg 10 x 10 , cloxacillin capsule 500 mg 10 x 10 , cycloserine capsule 125 mg 10 x 10 , dapsone tablet 100 mg 10 x 10 , diethylcarbamazine tab 100 mg 10 x 10 , diethylcarbamazineoral liquid 120 mg / 5 ml , diloxanide furoate tablet 500 mg 10 x 10 , doxycycline cap 100mg 10 x 10 , doxycycline dry syrup 50 mg / 5 ml , fluconazole tab 150 mg 10 x 10 , furazolidone tab 100 mg 10 x 10 , gentamicin inj 40 mg / ml 2 ml amp , itraconazole tablet / capsule 100 mg 10 x 10 , ivermectin tab 12 mg 10 x 10 , levofloxacin tab 250 mg 10 x 10 , levofloxacin tab 500 mg 10 x 10 , linezolid tablet 600 mg 10 x 10 , meropenem 500 mg vial , metronidazole inj 500 mg / 100 ml100 ml ffs bottle , metronidazole tab 400 mg 10 x 10 , metronidazole oral suspension 200 mg / 5ml 60 ml bottle , norfloxacin tab 400 mg 10 x 10 , norfloxacin dispersible tablet 100 mg 10 x 10 , ofloxacin 200 mg 10 x 10 , ofloxacin 400mg 10 x 10 , piperacillin +tazobactam inj 4.5 gm / vial vial , primaquine tab 2.5 mg 10 x 10 , primaquine tab 15 mg 10 x 10 , primaquine tab 7.5 mg 10 x 10 , quinine inj 300 mg / ml 2 ml amp , quinine tab 300 mg 10 x 10 , sodium aminosalicylate granules 10 gm , sulfamethoxazole and trimethoprim tab800mg + 160mg 10 x 10 , sulfamethoxazole +trimethoprim tab200mg +40 mg 10 x 10 , sulfamethoxazole +trimethoprim oral liquid ( 200mg +40 mg ) / 5 ml 50 ml bottle , sulfamethoxazole+trimethoprim ( pediatric tablets ) tab 400 mg+80 mg 10 x 10 , tablet artemether ( a ) + lumefantrine ( b ) tablet 20 mg ( a ) + 120 mg ( b ) 1x6 tab , tablet artemether ( a ) + lumefantrine ( b ) oral liquid 80 mg ( a ) + 480 mg ( b ) / 5 ml , tablet artemether ( a ) + lumefantrine ( b ) tablet 80 mg ( a ) + 480 mg ( b ) , tablet penicillin v ( phenoxymethyl penicillin ) 250 mg , tinidazole tab 300 mg 10 x 10 , vancomycin powder for injection 1 g , vancomycin powder for injection 250 mg , vancomycin powder for injection 500 mg , flunarizine tablet 5 mg 10 x 10 , sumatriptan tablet 25 mg 10 x 10 , 5 fluro uracil 500 mg , bendamustine inj 100 mg , calcium leucovorin 50mg , capecitabine 500 mg , carboplatin 450 mg , cisplatin 50 mg , cyclophosphamide 500 mg , bleomycin inj 15 mg , docetaxel 120 mg , doxorubicin 50 mg , epirubicin 100 mg , bortezomib inj 2 mg , etoposide 100 mg , decarbazine inj 200 mg 10 mg / ml , erlotinib tab 150 mg , exemestine tab 25 mg , gemcitabine1.4 mg , fulvestrant inj 500 mg , imatinib mesylate 400 mg , gefitnib tab 250 mg , methotraxate 50 mg , oxaliplatin 100 mg , paclitaxel 260 mg , hydroxyurea cap 500 mg , ifosfamide inj 1 gm , tamoxifen 20 mg , irinotecan inj 100 mg , vincristin 1 mg , lenalidomide tab 25 mg , zoledronic acid 4 mg , letrozole tab 2.5mg , doxorubicin , pemetrexed inj 50 mg , pomalidomide cap 2 mg , rituximab inj 500 mg , sorafenib tab 200mg , sunitinib tab / capsule50 mg , temozolamide tab 250 mg , topotecan inj 4 mg , trastuzumab inj 440 mg , vinblastin inj 10 mg , vinorelbine inj 10 mg , trihexyphenidyl tab 2 mg 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 10 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 100 mg ( a ) + 25 mg ( b ) cr 10 x 10 , levodopa ( a ) + carbidopa ( b ) tablet 250 mg ( a ) + 25 mg ( b ) 10 x 10 , diltiazem injection 5 mg / ml , adenosine inj 3 mg / ml 2 ml amp , amiodarone inj 50 mg / ml 3 ml amp , amiodarone tab 100 mg 10 x 10 , amlodipine tab 5 mg 10 x 10 , amlodipine tab 10 mg 10 x 10 , atenolol 100 mg 10 x 10 , atenolol tab 50 mg 10 x 10 , atorvastatin tab 10 mg 10 x 10 , atorvastatin tablet 40 mg 10 x 10 , chlorthalidone 12.5mg , chlorthalidone 25mg , clopidogrel tab 75 mg 10 x 10 , digoxin tab 0.25 mg 10 x 10 , digoxintab 250 mg 10 x 10 , diltiazem sr tablet 90 mg 10 x 10 , diltiazem tablet 60 mgl tablet 60 mgl 10 x 10 , diltizem tab 30 mg 10 x 10 , dobutamine inj 50 mg / ml 5 ml amp , dopamine inj 40 mg / ml5 ml amp , enalapril maleate tab 10 mg 10 x 10 , esmololinjection 10 mg / ml , finofibratetablet160 mg 10 x 10 , finofibrate tablet 40 mg 10 x 10 , hydrochlorothiazid tablet 12.5 mg 10 x 10 , hydrochlorothiazid tablet 50 mg 10 x 10 , isosorbide 5 mononitrate tab 20 mg 10 x 10 , isosorbide dinitrate tab 5 mg 10 x 10 , labetalol tab 100 mg 10 x 10 , labetalol inj 20 mg / 4 ml 4 ml amp , labetalol injection 5 mg / ml , methyldopa tab 250 mg 10 x 10 , metoprolol sr tab 25 mg 10 x 10 , metoprolol sr / plain tab 50 mg 10 x 10 , nifedipine cap 5 mg 10 x 10 , nifedipine tab 10 mg 10 x 10 , nitroglycerine ( glyceryl tri nitrate ) sub lingual tab 0.5 mg 10 tab , nitroglycerine ( glyceryl tri nitrate ) inj 25 mg / 5 ml 5 ml amp , noradrenaline inj 2 mg base / 2 ml amp. 2 ml amp , propranololtab 10 mg 10 x 10 , protamineinjection 50 mg / 5 ml , ramipril tab 2.5 mg 10 x 10 , streptokinaseinjection 15 lac / vialvial , telmisartan tab 40 mg 10 x 10 , verapamil tab 40 mg 10 x 10 , verapamilinjection 5 mg / 2 ml , urokinase ( 5 laciu ) vial , gum paint ( tannic acid ) 2% w / v 15 ml bottle , gutta percha ( gp ) 30tab / bottel , light cure composite , ketorolac10 mg tablet 10 x 10 , povidine iodine germicide gargle 20% w / v , gamma benzene hexachloride , benzoyl peroxide gel 5% , betamethasoneinjection 4 mg / ml 1 ml amp , betamethasone dipropionate ointment 0.05% 15 gram tube , calamine lotion 50 ml bottle , framycetin sulphate 1% cream 30 gram tube , fusidic acid cream / ointment 2% 5 gram tube , glycerin oral liquid , miconazole cream 2% w / w 15 gram tube , mupirocin cream / ointment 2% 5 gram tube , permethrin permethrin lotion 5% w / v ( 60 gm bottle , salicylic acid , silver sulphadiazine cream usp 1% 25 gram tube , haemodialysis fluid , intraperitoneal dialysis solution , bleaching powder containing not less than 30% w / w of available chlorine ( as per i.p ) containing not less than 30% w / w of available chlorine ( as per i.p ) 25 kg bag , cetrimide solution 20% ( concentrate for dilution ) , hydrogen peroxidesolution 6% , povidone iodine solution 5%, 100 ml bottle , povidone iodinevaginal pessary 200mg 10 x 10 , povidone iodine 5% ointment 15 gram tube , acetazolamide tab 250 mg 10 x 10 , furusemide tab 40 mg 10 x 10 , furusemide inj 10 mg / ml2 ml amp , hydrochlorothiazide tab 25 mg 10 x 10 , mannitol inj 20% 100 ml ffs bottle / 350 ml ffs bottle , mephentermine injection 30 ml vial mg / ml 10 ml vial , spironolactone tablet 25 mg 10 x 10 , xylometazoline nasal drops: adult ( 0.1% ) , boro spirit ear drops 0.183 gm boric acid in 2.08 ml of alcohol , normal saline nasal drops: sodium chloride drops 0.05% w / v , xylometazoline nasal drops 0.05 %, , turpentine oil 15% w / v 50ml bottel , wax solvent ear drops: benzocaine 2.7% w / v 10 ml bottel drop , wax solvent ear drops:paradichlorobenzene 2 % w / v 10 ml bottel , activated charcoal , hyoscine butylbromide 20mg / ml 1 ml vial / amp , tab mebeverine tab 200 mg 10 x 15 , bisacodyl tab 5mg10 x 10 , bisacodyl suppositories 5 mg 10 x 10 , dicyclomine hydrochloride inj 10 mg / ml 2 ml amp , dicyclomine hydrochloride tab 20 mg 10 x 10 , domperidone tab 10 mg 10 x 10 , domperidone 1mg per 1ml suspension , lactulose solution 10 gm / 15 ml , metoclopramide inj 5 mg / ml , metoclopramide tab 10 mg 10 x 10 , ondansetron tab 4 mg 10 x 10 , ondansetron inj 2 mg / ml 2 ml am , ondansetron syp 2mg / 5 ml 30 ml bottle , pantoprazole inj 40 mg / vial vial , rabeprazole tab 20 mg 10 x 10 , ranitidine tab 150 mg 10 x 10 , ranitidine inj 50 mg / 2 ml 2 ml amp , dicyclomine tablet 500 mg 10 x 10 , loperamide tablet 2 mg 10 x 10 , losartan 10 mg 10 x 10 , drotaverine inj 40 mg / 2 ml 2 ml amp , drotaverine tab 40 mg 10 x 10 , sucralfate syrup 1gm / 5ml 100ml bottle , sucralfatetablet 20 mg 10 x 10 , bicalutamidetablet 50 mg 10 x 10 , tamoxifen tablet 10 mg3 10 x 10 , ethinylestradioltablet 0.05 mg 10 x 10 , ethinylestradioltablet 0.01 mg 10 x 10 , empagliflozin 25 mg 10 x 10 , ethinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) 10 x 10 , glibenclamidetablet 5 mg 10 x 10 , human chorionic gonadotropininjection 10000 iu vial of 1 ml injection , human chorionic gonadotropin injection 5000 iu vial of 2 ml injection , levonorgestreltablet 0.75 mg 10 x 10 , medroxyprogesteronetablet 10 mg 10 x 10 , medroxyprogesterone acetate injection 150 mg 1 ml / vial , methylprednisoloneinjection 1000 mg / ml vial , methylprednisolone tablet 16 mg 10 x 10 , methylprednisolonetablet 16 mg 10 x 10 , methylprednisolonetablet 4 mg 10 x 10 , ormeloxifenetablet 30 mg 10 x 10 , premix insulin 30:70 injection ( regular: nph ) 2 , premix insulin30:70 injection 40 iu / ml , sitagliptin tab 50 mg 10 x 10 , thinylestradiol ( a ) + levonorgestrel ( b ) tablet 0.03 mg ( a ) + 0.15 mg ( b ) with ferrous fumarate10 x 10 , metformin sr 1000mg 10x15 , pioglitazone 15mg , biphasic isophane insulin insulin biphasic aspart 30:70 100 iu / ml ( firm has to supply compatible pen along with cartridges as and when required without any extra cost ) ( 3ml cartridge ) , cartridges , carbimazole , carboprost ( 15 methyl pgf2a ) inj 250mcg 1 ml amp , clomiphene citrate 50 mg tab 10 x 10 , gliclazide tab 80 mg 10 x 10 , glimeperide tab 1 mg 10 x 10 , glimeperide tab 2 mg 10 x 10 , glucose packet 75 mg for ogtt test glucose packet 75 mg for ogtt test packet , insulin soluble inj 40 iu / ml 10 ml vial , levothyroxine tab 50 mcg 100 tab per bottle , levothyroxine tab 100 mcg 100 tab per bottle , metformin tab 500 mg 10 x 10 , iv human immunoglobin 5% iv ig ( 5mg / 100ml each ) , injection , anti d immunoglobulin for iv / im use ( monoclonal ) inj 150mcg 1 ml vial , anti d immunoglobulin for iv / im use ( monoclonal ) inj polyvalent 10 ml ( lyophilized ) inj 300mcg pfs / vial , anti snake venom , antitetanus immunoglobulins inj 250 iu / vial vial , hepatitis b immunoglobulin 100 iu / vial vial , rabies immunoglobulin 300 iu / 2 ml2 ml vial , rabies vaccine ( cell culture ) id / im inj 2.5 iu / ml 1 ml vial , formoterol inhaled bronchodilator , levosulbutamol 100 mcg , ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 15mg+1.25mg+50mg / 5m 100ml bottle , aminophylline inj 25 mg / ml 10 ml vial , bromhexine syp 4mg / 5ml 50 ml bottle , budesonide nebulising suspension containing budesonide 0.5 mg / 2 ml 2 ml amp , caffeine citrate inj 20 mg / ml 3 ml vial , deriphylline tablet sr 300 mg 10 x 10 , etophylline +theophylline tab 100 mg ( etophylline 77 + theophylline 23 ) mg 10 x 10 , etophylline +theophylline inj 220 mg / 2 ml ( 169.4+50.6 mg ) 2 ml amp , ipratropium inhalation ( mdi / dpi ) 20 mcg / dose ipratropium respirator solution for use in nebuliszer 250 mcg / ml , levosalbutamol 50mcg / dose , montelukastsyrup 60 ml bottle , montelukasttablet 5 mg 10 x 10 , salbutamol tab 4 mg 10 x 10 , salbutamol inhaler 100mcg / dose metered dose container , salbutamol syp 2mg / 5ml 60 ml bottle , syrup dextromethorphan syrup 10 mg / 5 ml 100 ml pack bottle , tiotropium inhalation ( dpi ) 18 mcg / dose , tiotropium inhalation ( dpi ) 9 mcg / dose , human albumin solution 5% bottel 250 ml , deferasirox tab 250mg 10 x 10 , dispersable tablet hydroxyurea 100 mg 10 x 10 , enoxaparin inj 40 mg equivalent to 4000 iu vial / pfs , erythropoietin injection 2000 iu / ml , erythropoietin injection 10000 iu / ml , ethamsylate tablet tab 250 mg 10 x 10 , heparin inj 1000 iu 5 ml vial , hydroxyureacapsule 500 mg 10 x 10 , inj. deferoxamine 500mg / vial vial , recombinant factor eight inhibitor bypassing activility ( feiba ) 500 units , recombinant factor ix 500iu , recombinant factor vii a 1 mg , recombinant factor viii 250iu , 500iu , tab. deferasirox tab 500 mg 30 tab , tab. deferiprone 500mg 10x10 , tranexamic acid inj 500 mg / 5 ml. , tranexamic acid tab 500mg 10x10 , warfarin tab 5 mg 10x10 , warfarin tablet 1 mg 10x10 , warfarin tablet 2 mg 10x10 , caffeine oral liquid 20 mg / ml , surfactant suspension inj 25 mg / ml 100 ml vial , donepezil tablet 5 mg 10 x 10 , water for injection , water for injection 5 ml amp 2 ml amp , disulfiram tablet 250 mg 10 x 10 , baclofen baclofen 40 mg tablet10 x 10 , duvadilan 10 mg10x50 , duvadilan inj 5mgvial , neostigmine inj 0.5 mg / ml 1 ml amp , vecuronium inj 2 mg / ml 2 ml amp , pilocarpine drops 4% 5 ml bottel , acyclovir ointment3% 5gm tube , atropine sulphate 1%, tube , 3 gm , carboxymethylcellulosedrops 0.5% 10 ml / vial , dexamethasone drop ( 0.1%, 5ml ) , eye drop 5ml eye drop , fluconazole eye drop 3 mg / ml ( 10 ml vial ) , eye drop10 ml eye drop , homatropinedrops 2% , lantanoprost 0.005% ( 5ml ) , eye drop 5ml eye drop , moxifloxacin 0.5% w / v ( 5 ml ) , eye drop 5ml eye drop , pilocarpinedrops 2% 5 ml bottel , pilocarpine drops 1% 5 ml bottel , prednisolone drops 1% 10 ml bottel , tropicamide drops 1% 5 ml drop , atropine 1% eye ointment 3 gram tube , atropine 1% eye drops 5 ml vial , chloramphenicol eye ointment 0.5% 4g / 5g tube , ciprofloxacin eye / ear drop 0.3% 5 ml vial , ciprofloxacin eye ointment 0.3% 3 / 3.5 gram tube , combo ear drop chloramphenicol 5% w / v +clotrimazole 1% +lignocaine hydrochloride 2% 5 ml drop , gentamicin ear / ear drop ( 0.3% ) 5 ml vial , timolol 0.5% eye drops 5 ml vial , codeine oral solution 15 mg / 5 ml 60 ml bottle , morphineinjection 15 mg / ml vial , morphine tablet 10 mg 10 x 10 , morphine tablet sr / 30 mg 10 x 10 , oxytocin injection 5 iu / ml injection 5 iu / ml1 ml ampule , drotaverine inj 40 mg / 2 ml 2 ml amp , methyl ergometrine maleate inj 0.2 mg / ml 1 ml amp , misoprostal tab 200 mcg 4 tab in 1 pack , combi pack with mifepristone + misoprostol ( 1 tablet of mifepristone 200 mg and 4 tablets of misoprostol 200mcg ) combi pack , methyl ergometrine maleate tab 0.125 mg 10 x 10 , mifepristone tab 200 mg 1 tab per pack , misoprostal tablet 100mcg 4 tab pack , misoprostoltablet 200mcg ( oral / vaginal ) 4 tab pack , risperidone 50 mg , alprazolam tab 0.25 mg 10 x 10 , chlorpromazine tab 100 mg 10 x 10 , clonazepam tablet 0.5 mg 10 x 10 , clozapine tablet 50 mg 10 x 10 , clozapine tablet 25 mg 10 x 10 , diazepam inj 5 mg / ml 2 ml amp , diazepam tab 5 mg 10 x 10 , escitalopram tablet 10 mg 10 x 10 , fluoxetine capsule 20mg 10 x 10 , fluphenazineinjection 25mg 1ml vial / ampoules , haloperidol inj 5 mg / ml 1 ml amp , haloperidol tab 5 mg 10 x 10 , imipramine tablet 25 mg 10 x 10 , lithium carbonatetablet 300 mg 10 x 10 , lorazepam tab 1 mg 10 x 10 , lorazepam inj 2 mg / ml , olanzapinetablet 5 mg 10 x 10 , olanzapine 10 mg 10 x 10 , phenobarbitonetablet 60mg 10 x 10 , promethazine injection 50 mg ( 25mg / ml ) 2ml vial / ampoules , risperidone tab 2 mg 10 x 10 , zolpidem 10 mg 10 x 10 , calcium gluconate inj 10% 10 ml vial , d 10 ( dextrose 10% ) iv fluid ( dextrose 10% ) 500 ml ffs bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 100 ml bottle , d 25 injection ( dextrose ) iv fluid ( dextrose 25% ) 500 ml bottle , dextrose 5% iv fluid ( dextrose 5% ) 500 ml ffs bottle , dextrose with saline i / v fluid ( dextrose 5% + saline 0.9% ) 500 ml ffs bottle , glucose ( a ) + sodium chloride ( b ) injection 5% ( a ) + 0.9% ( b ) 500ml ffs bottle , hydroxyethyl ( 6% saline solution for infusion ) starch 6%ip , pediatric solution like isolyte p, n / 2 & n / 5 pediatric solution like isolyte p, n / 2 & n / 5 100 ml bottle , potassium chloride oral solution 100mg / ml 200 ml bottle , reduced osmolarity ors pkt. who formula o.r.s. glucose 75meq, sodium 75m eq or m mol / l, chloride 65meq or m mol / l, potassium 20meq or m mol / l , citrate 10m mol / l osmolarity 245m osm / l, dextrose 13.5g / l sodium chloride 2.6g / l potassium chloride 1.5g / l, trisodium citrate dihydrate 2.9g / l+trisodium citrate dihydrate may be replaced by sodium hydrogen carbonate ( sodium bi carbonate ) 2.5g / l. sachet of 21.8gm , ringer lactate i / v 0.24 % v / v of lactic acid ( eq. to 0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , sodium bicarbonate inj 7.5% w / v 10 ml amp , sodium chloride hypotonic inj n / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 500 ml ffs bottle , sodium chloride isotonic inj 0.9% isotonic ( equivalent to na+154 m mol / l, cl+154 m mol / l ) 100 ml ffs bottle , nicotinamide tablet 50 mg7 10 x 10 , ascorbic acid ( vitamin c ) tablet 100 mg tablet 100 mg 10 x 10 , calcium carbonate .tab 500 mg 10 x 10 , calcium with vitamin d3 calcium equivalent to 500 mg & vit. d3 250 iu 10 x 10 , ferric carboxymaltose 250mg 10 x 10 , ferric carboxymaltose 50mg / ml 20 ml vial , folic acid tab 5mg 10 x 10 , iron & folic acid syp iron each 1 ml contains 20mg elemental iron+folic acid 100 ?g 50 ml bottle with dropper , iron & folic acid sugar coated iron folic acid sugar coated ( red tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron folic acid sugar coated ( blue tablet ) ferrous sulphate ip equivalent to60 mg elemental iron & 500 mcg folic acid ip 10 x 10 , iron & folic acid sugar coated iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip ( pink colored tab ) wifs junior ifa tablets 10 x 10 , iron sucrose inj 100 mg / 5 ml 5 ml amp , multivitamin sugar coated tab nfi formula sugar coated vit a 2500 iu , vit c 50mg, calcium pantothenate 1mg, vit b1 2 mg vit b6 0.5 mg vit d3 200 iu vit b2 2mg niacinamide 25mg folic acid 0.2mg. 10 x 10 , pyridoxine tab 10 mg 10 x 10 , pyridoxine tablet 40 mg 10 x 10 , pyridoxine tablet 100 mg 10 x 10 , riboflavin tablet 5 mg7 10 x 10 , thiamine injection 100 mg / ml , thiamine tablet 100 mg7 10 x 10 , vitamin a syp 100000 iu / ml with marked spoon for 1ml &2ml 100 ml bottle , vitamin k1 inj 1 mg / 0.5 ml 0.5 ml amp , vitamin. b complex tab nfi ( prophylactic ) b1 2 mg, b2 2mg, b6 0.5 mg, niacinamide 25 mg, calcium pantothenate 1 mg 10 x 10 , zinc sulphate tab dispersible 10mg 10 x 10 , zinc sulphate tab dispersible 20mg 10 x 10 , vitamin b12 inj, injection 500 mcg / ml ( 30 ml amp / vial ) , glacial acetic acid 99.99% 500 ml , visco pfs 3 ml prefilled syringe opthalmic , disposable gown , diclofenac+menthol 30 gm tube , cap antioxident 10x10 , tab. paracetamole 325 mg+ chlorpheniramine 4 mg + phenylepherine 10 mg 10x10 , syp diphynhydramine 100 ml , multivitamin drops 22 drops approx , material name , alkaline phosphatase 10x 22ml erba comfitable make , anti h span / tulip comfitable make , anti a1 lactin , anti d ( 1gg+2gm ) tulip / span / j.mitra comfitable make , anti ab anti sera span / tulip 10 ml comfitable make , ahg span / tulip vial comfitable make , abg cartiadge , albumine kit erba comfitable make , acitic acid 5% , acetone kit , bloting paper , bacilol , baby msks size 0, 1 , blood administration set , barium sulphate powder, susp. 95%w / v, powder ( hd ) 95% w / v 400 gram. , benedicts soluton ( qualitative ) 500 ml bottle , blood groupingseara antia, b&d ( 10 ml ) j.mitra / span / tulip comfitable make , blood lancet , blood bag 100 ml j.mitra / haemopack, hll life care comfitable make , blood bag 350 ml j.mitra / haemopack, hll life care comfitable make , blood bag 150ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood bag 200ml ( single bag ) j.mitra / haemopack, hll life care comfitable make , blood cell counter key based gem , barium chloriad powder , barium chloriad ( 500 ml ) , brain tromoblastin for , b.t.c & c.t tube , basik fucksion powder , bruck sitrick , cidex , csf protien kit , csf suger kit , calcim reagent , crp kit ( agapee ) j.mitra / span qualicative 50 test kit comfitable make , crp kit 50 test kit erba comfitable make , cpk mb kit erba comfitable make rapid kit , capillaries ( serumbilirubinometer ) , capillaries ( wax ) , capillary tube for bt&ct , cover shlip ( 40gm ) , calorie meter , cyanemeth solution for hb ( drabkins solution , carbol fuchsin , culture media with nutrient agar high media company comfitable make , culture media with maconkey agar high media company comfitable make , culture media with blood agar high media company comfitable make , culture media with peptone water high media copany comfitable make , culture media with nutrient broth high media company comfitable make , culture plate , chikunguniya , counting numbers ( chekers ) , detaction for protien in urine ( uristixs ) 100strip , disposable cups for urine collection with screw cap , distilled water 5 letter , digital anyalytical balane 0.1gm to 160 gm , dengue card test span / j.mitra comfitable make , dropper rubber , drop mct oil , d.p.x. wax qualigence , esr tube , elisa plate reader with washer and printer , edta250 gm powder , e.d.t.a powder 500 gm , edta vial with screw cap , edta solution , electrolyte analyser reagents pack na+, k+ accurex enlite 2 para , electrolyte analyser reagents deproteinize , electrolyte analyser reagents riffil solution forna+, k+ and reffrence electrode , thermal paper roll for cell counter machine , electronic chemical weings scale , emmersion oil30ml , formaldehyde ( formalin ) 37% acq. 450 ml bottle , fliltter paper , field stain a qualigens , field stain b qualigens , forchest reagents 125 ml bottel , flask , flask , falckon tubecultre sterlized , glucose kit ( godpod ) , glutaraldehyde lotion 2% w / v stabilized 5 ltr. cans , glass droper , glass test tubes borosil glass 18 x 150 mm , glass piaptte , glass beaker 100 ml , glass beaker 200 ml , glass marking pencil ( white ) , glucometer sd company comfitable make , haemoglobin colour scale , heamocyto meter , glucometer stripsmorphan` comfitable make , glucometer strips acuchaklcomfitable make , glucometer stripssd company code free ivd , hydrogen peroxide sol. 20% w / v 1 ltr. bottle , h2so4 acid 20% , hb pipate , hb tube , hbsag card test rapiedj.mitra / span comfitable make , hdl chloleslestrol kit , h.c.v card rapid span / ing comfitable make , hdl kit erba comfitable make , hiv kit , hiv test card tridot flow through paste 3 dot span / j.mitra comfitable make , hematolgy cell counter reagents erma company pce 210 autodil er comfitable make , hematolgy cell counter reagents erma company pce 210 autolyse er comfitable make , hematolgy cell counter reagents erma company pce 210 autoclean er comfitable make , haemoglobin meter isi marked superior quality , hand sanitizer sterilium , incubator superior quality isi marked microbiology , listaman stain ( 500ml ) qualicative , laugles ioden , led bulb , lance paper , liquid hand wash , micropore , micro glass slide packet 50 slide packet , mp antigen test card for view for falciferum ozon / span / j.mitra comfitable make , malaria card test antibody j.mitra / span comfitable make , methylene blue , mithylated sprit100% , micropippate tips large , micropippate tips small , micropippate for analyzer erba company variable 5 50 comfitable make , micropippate for analyzer erba company variable 10 100 comfitable make , micropippate for analyzer erba company varialbe100 1000 comfitable make , micropippate for analyzer erba company varialbe 2micrlit. 1000 microlit comfitable make , multichanel pippate , n / 10 hcl , nitric acid 500 ml , new warce chamber , platilate diluting fluid , pt reagents span comfitable make , aptt reagents spancomfitable make , pandys reagent for csf , preganacy test strip 100strip , pasture piaptte ( borosil ) comfitable make , piaptte glass , phenol crystol , peatidisc large disposable , peatidisc small disposable , plain vial 12 x 75 with screw cap , permanentmarkers , pollythin 30 lit capacity , rapid pap kit span , rapid test kit for torch tes ( 1gm+1gg ) , r.b.c dilluting fluid ( 500 ml ) , r.a.factor 50 test kit qualicative j.mitra / span comfitable make , serum bluribine 4 x60 ml erbacomfitable make , serum bovine albumine 22% bsb span / tulip comfitable make , sodium citrate 3.8 % , sodium hypochlorid 5 lit jar , sulphuric acid ( 450 ml ) , serum tringlyieride ( 5x20ml ) , serum creatinine kit erba company 4 x60 ml comfitable make , serum protien kit erba comfitable make , staning rack , slide markers , slide stand , slide box 50 soidde , spirit lamp , sulpher powder , sulfuric acid 100% , semun diluting fluid , stop watch digtal , sypllis test card jaimitra / spam / biolab comfitable make , sputam cuntnar disposable , stickers ( blank ) 2x1 cm , twinket balt , taste tubeglass ( borosil ) 7.5x 12mm15 ml comfitable make , taste tubeglass ( borosil ) 7.5x 12mm5 ml comfitable make , tissue puper , teat rubber 1 ml , teat rubber 2 ml , teat rubber 5 ml , typhoid card test kitj.mitra / span comfitable make , torch test kit j.mitra / span comfitable make , t3, t4 tsh kit , test tube stand 10 holl , test tube stand 20 holl , thermocol box with packd , thermometer for water wath , triglyceride kit erba comfitable make , vdrl kit for sypllis comfitable make , vdrl kit j / mitra / span 50 test kit qualicative comfitable make , water wath , w.b.c dilluting fluid ( 500 ml ) , wbc diluting fluid 100ml , wintrob tube stand , xylene qualigens , zentition viloet 0.25% , zentition viloet 0.5% , zn stain , feeding tube for infant no. 6 , oxygen mask child , oxygen mask adult , cord clamp dispossable , plastic tubs , reagents for semi auto anyalyzer erba company , blood glucose kit erba company 50 test kit comfitable make , blood urea kit erba company 50 test kit comfitable make , sgpt test kit erba company 50 test kit comfitable make , sgot test kit erba company 50 test kit comfitable make , g6pd test kit erba company 50 test kit comfitable make , blood grouping sera 5 ml anti ab&d set j.mitra / span / tulip comfitable make , widal test kit erba company 50 test kit comfitable make , vdrl test kit erba company 50 test kit comfitable make , cholestrol kit erba company 50 test kit comfitable make , austrailia antigen card test , rpr kit for syplis 50 kit , lead protection partion , lead letters , lead protective barrir , lead goggle , lead protectvie apprean , lead rubber glove , lead gonad shield , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , intcifying screen kiren high speed comfitable make , xray castetes kiran, kr8 , xray castetes , xray castetes , xray castetes , xray hangers , xray hangers , xray hangers , xray hangers , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray film 50 sheet packet , x ray dental film 50 sheet packet , x ray developerpowder , x ray developerpowder , x ray fixerpowder , x ray fixerpowder , x ray view box , xray safe light , absorbent cotton wool ip 500 gm paket , absorbable gelatine sponge ip 66 80mm x 50mm x 10 mm , adhesive plaster usp 7.5 cm x10mts / roll , adhesive plaster usp 7.5 cm x5 mts roll , bismith lodoform paraffin paste , boric acid with sprit drop , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 1 / 0 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm no 2 , b.b silk with 1 / 2 cir rb needle 20 mm length 75 cm , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 1 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no1 / 0 , b.b silk with 1 / 2 cir cutting needle 20 mm length 75 cm no 2 , b.b silk with 3 / 8 cir rb reverse 2 / 0 cutting needle 45 mm length 76cm , b.b silk6 reels x 25 mts length 25 mts , cotton roll100 gm , cresol with soap sol. 5 ltr. cans , chromie with cd. rb needle 40 mm length 75cm , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 1 0 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 , catgut chromic with 1 / 2 cir rb needle 40 mm length 95cm no. 2 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 , catgut chromic with cd cutting needle 12 mm length 70cm no. 1 0 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 , catgut chromic with cd cutting needle 12 mm length 70cm no. 2 0 , crap bandageall sizes , poly propylene with 1 / 2 cir rb needle 30 mm length 70 cm , poly propylene with 1 / 2 cir rb needle 40 mm length 70 cm , poly propylene with 1 / 2 cir rb heavy needle 30 mm length 70 cm , poly propylene with cutting needle 45 mm lengyh 100 cm , poly propylene with curved 8 / 0 rb bv double needle 7.6 mm length 60 cm , disposable syringe with needle cgs 1cc with mark 0 1ml , disposable syringe with needle cgs 2cc , disposable syringe with needle cgs 5cc , disposable syringe with needle cgs 10cc , disposable syringe with needle cgs 20cc , disposable syringe with needle cgs 50cc , disposable suction cather size: 12, 14 , disposable scale vein set size 20g , disposable scale vein set size 22g , disposable needle 18 g ( single use ) , disposable needle 20 g ( single use ) , disposable needle 22 g ( single use ) , disposable needle 23g ( single use ) , ecg gel 250 ml bottle , ecg paper80mm x 20mts for manual ecg machine bpl company 6208 view / view plus chemical red comfitable make , ecg paper 50mm x 20 mts computerzed for computer bpl company 6108tchemical blue comfitable make , endotracheal tube no 2.5 , endotracheal tube no 3 , endotracheal tube no 3.5 , endotracheal tube no 5 , endotracheal tube no 7 , endotracheal tube no 8 , foleys urinaty catheter size 8 ( 2way ) , foleys urinaty catheter size 10 ( 2way ) , foleys urinaty catheter size 14 ( 2way ) , foleys urinaty catheter size 16 ( 2way ) , foleys urinaty catheter size 18 ( 2way ) , foley balloon cather three way ( a ) fg 24 , glycerinc ip 30 ml plasric bottle , gention violet paint 0.5% 100ml bottle , hmf sachet , iv cannula ( two way ) size 18 , iv cannula ( two way ) size 20 , iv cannula ( two way ) size 22 , iv cannula ( two way ) size 24 , iv cannula ( two way ) size 26 , i.v. cannula sizes 23 two way , intravenous set ( adult ) with airway and needle , intravenous set ( children ) with airway and needle , infant mucus extractor , infant feeding tube ( catheter ) 8 g , infant feeding tube ( catheter ) 10 g , infant feeding tube no. 3.5 , infant feeding tube no. 7 , liquid paraffin ip 500 ml bottle , liqued stesimox , lysol , mackintosh double colour water proof , micro drip set , metrasses 3×6 with raxine cover 4 density , metrasses 2 5×4 with raxine cover 4 density for child bed , needle hypodermic insulin needle ( metallic non sterile ) size 26 gx1 / 2 , nasal prom for neonatiol , n 95 mask for swine flue , disposable mask , l.p. needle no. 22 , l.p. needle no. 23 , oxygen catheter , oxyzen flowmeter regulator , oxygen tube , plaster of paries 1kg pkt.isi qulity , paper adhesive plaster 1x9.0 mts , p.o.p. bandag 6 inch , p.o.p. bandag 4 inch , peadiartic chamber set 110 ml , pressure monitoring line , pvc apron , ryles tube ( p.v.s ) childrn size 10, 12 , ryles tube ( p.v.s ) adult size 16, 18, 14 , sanitary pads , slippers all sizes , sterile gloves size 6 isi marked , sterile gloves size 6 1 / 2 isi marked , sterile gloves size 7 isi marked , sterile gloves size 7 1 / 2 isi marked , surgical blade size 11, 100 blade per packet , surgical blade size 15, 100 blade per packet , surgical blade size 21, 100 blade per packet , surgical blade size 22, 100 blade per packet , surgical blade size 23, 100 blade per packet , suture needles curved &1 / 2 circle cutting assorted sizes 1 5 , suture needles curved &1 / 2 circle cutting assorted sizes 6 10 , suture needles curved &1 / 2 circle cutting assorted sizes 11 15 , suture 10 0 nylone , suture 8 0 silk , suture 5 0 mono phalment , suction catheter no.7 green , suction catheter no.8 green , suction catheter no.16 green , suction catheter no.14 green , scalp vein set ( single use diposable ) size 23 gauge , scalp vein set ( single use diposable ) size 24 gauge , spoon marked 1 ml / 2 ml plastic , surgical spirit 100 ml bottle , sterlium hand wash , three way connector , tincture benzoin co. 500 ml bottle , ultra sonogram gel 250 ml bottle , urinary drainage bag , volium drip set , vicryl no.1 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.1 0 polyglyoviont 1 / 2 cir needle 95 cm , vicryl no.2 polyglyoviont 1 / 2 cir needle 95 cm , wax dissoluent , pamper for children , oxygen key , tab. chlorine 500 mg isi marked , tab. water purifying 4 gm , montex test 2 tu , montex test 5 tu , 1 twv csx ¼ftlessa vanj dh vksj ls , e vks , p , qq mcy;w@, q ih ds yksxks yxk, tk, xsaa½ 2 iseiysv nis gq, ¼lwpuk i= uofookfgr naifr ds fy, tkudkjh ½ 3 lksan;z lkexzh@ lopnrk csx ¼ deiyhv csx fueu lkexzh dk uke& rksfy;k lsv nksvk ] da?khfcanhirrk ] usy dvj ] nks lsv :eky ] lsusvjh usifdu isdsv vksj khkk nksvk ½ lfgr 4 tkudkjh dkmz nik gqvk ftlesa { ks=h; vkkk rfkk , , u , e dh laidz dh tkudkjh 5 lwpuk i= ¼xhkz izjh { k.k fdv ds mi;ksx laca / kh funszk ij iw.kz lwpuk i=½ , d.mkse ckwdl ¼fvu½ , d.mkse ckwdl ¼qkbzcj½ , d.mkse ckwdl ¼ydm+h½ , osusvh ckwdl ¼fvu ½ , lsusvªjh usifdu isdsv 10 ihl , lsusvªjh usifdu isdsv 12 ihl , vkbzmsauvh fqdsku vsx qkwj u;w cksuz , vkbzmsauvh fqdsku vsx qkwj enj , digital wrist watch , digital thermometer , neonatal / infant weighing scale with sling , warm sleepig bag for neonates , blankets for neonates , mucus extractr , baby feeding spoon , torch with cells , bag for carrying kit / material during home visit , heamocheck book with strip complete , hemax cell cleaner 1 litre , hemax diluent 20 litre , hemax lyse 500ml , amber colored bottle 2 lit. , amber colored bottle 3 li. , ethanol absolute alcohol 500 ml , hcl 500 ml , diamond marker , tissue paper , auramine powder 25 gm , lense paper , thermacol box , sputum container , micro glass slide , forcep steel , weighing machine digital , water bath , paraffin role , spirit rectified 1 lit. , slide box 100 slide per box , glass beaker 200 ml , glass beaker 100 ml , permanent marker , slide rack , n / 95 mask , long stool lab , vinelands social maturity scale ( indian adaptalaion ) with manual , 16 pf questionnaire of age 16 and older with sheets with manual , binef kamath test of intelligence with manual , thematic apperception test ( indian adaption ) with manual , rorhchacs ink blot test cauds with location charts , nimhans neuro psychological battery for adult with manuals , nimhans index of sld with manuals , crescent blade , keraton ( 3.2 ) , disposable gown , vergin silk 8.0 black ( 1x12 ) , vergin silk 10.0 black ( 1x12 ) , vicryl 8.0 ( 1x12 ) , dark glass , cornear scissor , capsulereris forceps , scissor plain 4 inch , surgical blade 11 no. , side port , air cannula 27 g , fine port irrigaling vetis wire , banass scissor , trypan blue solution , propaciane hcl opthalmic solution , tropicaciyl plus eye drop , inj hyaluronidase ip 1500 iv , inj senscerocaine 0.5 1% , weight machine adult , scissor plain , artery forcep , tooth forcep , needle holder , oxygen flowmeter , cheatle forcep , sponge holdig forcep , bleaching powder 1 kg , stethoscope , labour ot fogging machine , ambu bag , cervical collar high neck , head mobilizer , fire extinguisherco2 2 kg , yoga mate , airotor hand piece , ultrasonic scaler , forcep ( set of 10 pieces ) , periosteal elevator , mouth mirror , sickle porpe , alginate , k file no. 10, 20 , 15, 25 , h file no. 15, 20, 25, 10 , formalin chamber , uv chamber , compressor , fracture plate , putty impression , zoe impression paste , upper & lower impression paste , abx diluent 20 lit can { horiba } , abx diluent 1 lit can { horiba } , white diff 1 lit { horiba } , abx minocleaner 100 ml { horiba } , printer ink modal h.p. tank4 bottel 3019 , t3 icromax , t4 icromax , tsh iromax , blood sugar erba , serum billirbin erba , blood uria erba , sgpt erba , sgot erba , uric acid erba , alkaline phosphate erba , total protin erba , hdl erba , total cholestrol erba , albumin erba , triglistride erba , diluent 20 lit hemax , :yse 500 ml hemax , cell cleaner e.z. 1 lit hemax , cleaner 100 ml hemax , printer |roll size 55 mm , printer roll size 50 mm , vtm kit 50 test / kit , standard q covid test card 25 test card / kit , face shield , ice gel pack 8x10 cm , brown tape 6 inch , zipper polythene 8x10 cm , polythene 1 kg red / black , sanitizer 100 ml , sanitizer 500 ml , shoe cover , disposable bed sheet , dead body suit , thermal scanner , pulse oxymeter , ppe kit , surgeon cap , disposable kelleys pad , latex examination gloves large 100 gloves / pkt , goggles , microglass slide blue star 50 slide / pkt , sanitiry napkin 8 pad / pkt , cough syrup sugar free 100 ml , tab vitamin c 500 mg sugar free , ct scan film 8x10 konica minolita , ct scan film 14x17 konica minolita , ct scan film 11x14konica minolita , shaving blade , ct scan film 10x12konica minolita...

Directorate Of Medical Education - Madhya Pradesh

33336734 tender for supply of chemical and reagents for mdru department of sgm hospital rewa , mdru chemical and reagents , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , tips i. 0.2 20 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips ii. 20 200 ?l tips 2 pack ( pack size of 1000 psc. each ) , tips iii. 200 1000 ?l tips 2 pack ( pack size of 1000 psc. each ) , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips i. 0.2 20 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips ii. 20 200 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , filter tips iii. 200 1000 ?l filter barrier tips 2 pack ( pack size of 1000 psc. each ) , mct variable tubes i. 20 200?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes ii. 200 600 ?l tubes 2 pack ( pack size of 1000 psc. each ) , mct variable tubes iii. 500 2000 ?l tubes 2 pack ( pack size of 1000 psc. each ) , nitrile autodextorous gloves 2 pack ( pack size of 1000 psc. ) , mctstands for variable tubes sizes i. 20 200?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes ii. 200 600 ?l tubes stand pack size of 1000 psc. each , mctstands for variable tubes sizes iii. 500 2000 ?l tubes stand pack size of 1000 psc. each , filter tip boxes i. 0.2 20 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes ii. 20 200 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , filter tip boxes iii. 200 1000 ?l filter barrier tip box 2 pack ( pack size of 1000 psc. each ) , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000 ml 05each , graduated beakers 50, 100, 500, 1000 ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 500 ml , dettol / lifeboy alcohol based hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , microwave gloves 2 pkt. , brown paper for autoclaving 10 rolls , liquid nitrogen 5ltrpkt. , phosphate buffer saline 500 ml , formalin 500 ml , paraffin wax ( 58 60c ) 250 gm , xylene , glycerol 250 ml , ammonia 100 ml , methanol 250 ml , acrylamide / bis ar 250 ml. , 10x tbe buffer 500 gm , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100 ml , diethyl pyrocorbonate 100ug , pbs 500ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5 agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ 5 od , pik3ca set 1 reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662f 5’ ctgagattcaattaggccca 3’r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ 5 od , anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , total rna mini kit ( from human skin tissue ) 2 pack ( pack size for 100 reaction ) , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. 1 psc. each , buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen sample handling gloves 5 sets of gloves , slide tray / rack pack of 3psc. , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 3 psc. , whatman filter paper grade 1 & 2 2 pack ( pack size of 50 psc. ) , harri’s hematoxylin powder 2 pack of 50 gm , yellow eosin powder 2 pack of 50 gm , coverslip 18x18 ( microscopic ) 2pack ( pack size of 100 psc ) . , dpx mount 50 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , hot plate 1 psc. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , human pai 1 elisa kit pack size of 96 reactions , mortar and pestle homogenizers 1 psc....

Indian Army - Madhya Pradesh

33210710 bids are invited for haemocult test occult blood test kit of 50 tests , abst octa disc ready made gnb and gpc , acetone commercial , alcohol amyl , alcohol dehydrated ethanol , biomerieux reflectance standards bact alert complete set , blood agar base , cled agar , d p x mounting med , diamond glass writing 240 per 240 , formalin 05 ltr can , kit for pas ready to use , mgg stain kit may grunwald giemsa , paraffin liquid 500ml , parrafin tissue block moulds metal steel , perls iron stain kit , cover slip microscopic rectangular 22x50 mm , uti agar , xylene xylol pure , zn stain kit readymade , eightcheck 3wp set of three controls low normal high compatible with sysmex xp 100 , leishmans stain ready to use with buffer for bone marrow study 500ml , mpo stain kit , pt prothrombin time reagent vial of 25 tests , water culture agar double strengh , reticulocyte stain kit readymade j k diagnostics , anti h lactin ,ependorf tubes 1000ul , ependorf tubes 500ul , erba normand erba path internal qc combipack , erba wash kit 4 x50 ml , glucose powder 500gm , kit for estimation ofamylase 6 x 6 ml , kit for estimation of ck mb 2x8 ml 2x2 ml, kit for estimation of cpk 2x8 ml 2x2 ml , kit for estimationof ldh 4x8 ml 1x8 ml , kit for estimation of lipase 1x20 ml ,kit for ldl cholesterol by direct estimation 2 x 50 ml ,protein csf kit 1 x 50 ml micro protein , tube test 125 mm x16 mm rimless , tube test 75 mm x 12 mm rimless , himedia biochemical test kit kb002 20 kit per pack , ehrlichhaematoxylin stain , e check calibrator for sysmex xp 100 ,lypholized assayed control biorad l 1 , lypholizedassayed control biorad l 2 , blood agar base infusion agar, garber glass tube with cork , d dimmer estimation test kitpack size 1 x 7 ml 1 x 4 ml total quantity : 4417...

Indian Army - Madhya Pradesh

32792469 bids are invited for haemocult test occult blood test kit of 50 tests , abst octa disc ready made gnb and gpc , acetone commercial , alcohol amyl , alcohol dehydrated ethanol , biomerieux reflectance standards bact alert complete set , blood agar base , cled agar , d p x mounting med , diamond glass writing 240 per 240 , formalin 05 ltr can , kit for pas ready to use , mgg stain kit may grunwald giemsa , paraffin liquid 500ml , parrafin tissue block moulds metal steel , perls iron stain kit , cover slip microscopic rectangular 22x50 mm , uti agar , xylene xylol pure , zn stain kit readymade , eightcheck 3wp set of three controls low normal high compatible with sysmex xp 100 , leishmans stain ready to use with buffer for bone marrow study 500ml , mpo stain kit , pt prothrombin time reagent vial of 25 tests , water culture agar double strengh , reticulocyte stain kit readymade j k diagnostics , anti h lactin ,ependorf tubes 1000ul , ependorf tubes 500ul , erba normand erba path internal qc combipack , erba wash kit 4 x50 ml , glucose powder 500gm , kit for estimation ofamylase 6 x 6 ml , kit for estimation of ck mb 2x8 ml 2x2 ml, kit for estimation of cpk 2x8 ml 2x2 ml , kit for estimationof ldh 4x8 ml 1x8 ml , kit for estimation of lipase 1x20 ml ,kit for ldl cholesterol by direct estimation 2 x 50 ml ,protein csf kit 1 x 50 ml micro protein , tube test 125 mm x16 mm rimless , tube test 75 mm x 12 mm rimless , himedia biochemical test kit kb002 20 kit per pack , ehrlichhaematoxylin stain , e check calibrator for sysmex xp 100 ,lypholized assayed control biorad l 1 , lypholizedassayed control biorad l 2 , blood agar base infusion agar, garber glass tube with cork , d dimmer estimation test kitpack size 1 x 7 ml 1 x 4 ml total quantity : 4417...

Central Council For Research In Ayurvedic Sciences - Madhya Pradesh

32670762 bids are invited for alanine amino transferase , aspartate amino transferase , alkaline phosphatase , albumin , blood urea nitrogen , calcium , chloride , creatinine , glucose , gamma glutamyl transferase , phosphorus , potassium , sodium , total plasma protein , total cholesterol , triglycerides , total bilirubin , rodent thyroid stimulating hormone , rodent thyroxin , rodent triiodothyronine , dekaphan laura urine strips , prothrombin time , activated partial thromboplastin time , micro pipette tips , glass slides , cover slips , btct capillary tubes , nitrile gloves small , nitrile gloves medium , nitrile gloves large , micro centrifuge tubes 0.5 , microcentrifuge tubes 1.5 , micro centrifuge tubes 2 , oralgavage set , magnetic stirrer beads small , magnetic stirrerbeads medium , microtome blades slee , blotting papers ,bottle corks , diethyl ether , potassium iodide , isoflurane ,propanol , ethanol , xylene , hematoxylin stain solution ,eosin stain solution , paraffin wax , formaldehyde ,propylene glycol , sodium chloride , sodium dihydrogenphosphate , dihydrogen sodium phosphate , gum acacia ,giemsa stain solution , cell clean cl 50 , disodium edta total quantity : 53051...

Indian Army - Madhya Pradesh

32400812 price agreement for art disposable items price agreement for art disposable items , marker pens for labling ivf plates (non xylene) (human ivf grade) dual point set of 8 pens ( each pens separate colour) red, blue, black, green, purple, yellow, orange, brown (8 pen set) , powder free gloves surgical (sterile), (pair of ) size 7.5 (conforming to bis standards is 13422;1992) , powder free gloves surgical (sterile), (pair of ) size 6.5 (conforming to bis standards is 13422;1992) , powder free gloves surgical (sterile), (pair of ) size 8.0 (conforming to bis standards is 13422;1992) , powder free gloves surgical (sterile), (pair of ) size 6.0 (conforming to bis standards is 13422;1992) , vitrifit embrio loading device pack of 20 , 5 ml tube poly round bottom tubes individually sterile packed (human ivf grade) pack of 500 , denudation pipette (plastic) 300 microns (human ivf grade) individually sterile packed vial of 10/20 pippette , denuding pipette(170 175)microns (ivf grade) vial of 10 , 3 ml pipette sterile individually packed (human ivf grade) pack of 500 , 10 ml serological pipette sterile individually packed (ivf grade) pack of 500 , embryo transfer catheter soft with outer guide catheter having bulbous atraumatic tip inner soft catheter with steel reinforced proximal shaft (individually packed), length of inner catheter 190 mm , 1 ml rubber free tuberculin syringes for ivf embryo transfer (human ivf grade) , disposable tips (10 to 100 ul) individually sterile packed (human ivf grade) , disposable tips (1 to 10 ul) individually sterile packed (human ivf grade) , sperm preparation media for iui htf mea tested ce/usfda certificate approved , iui media double density (80%+40% ) usfda approved , 9x9disinfection wipes for cleaning bench top (mea tested) box of 70 , disinfectant spray (non embryo toxic) of 1 litre (human ivf grade) , 1.8 ml cryo tube vial ( pack of 500 ) , ivf multidish 4/5 well plate(human ivf grade) pack of 120 , semen collection jar sterile individually packed (110 ml) (human ivf grade) pack of 100 , icsi dish for ivf (human ivf grade) ( pack of 500) , 14 ml tube poly round bottom tubes individually packed sterile packed for ivf (human ivf grade) pack of 500 , iui catheter individually sterile packed with syringe pack of 100 , single well organ culture dish (human ivf grade) individualy packed pack of 500 , 15 ml conical tubes plsterene (ivf grade;mea tested pack of 500 , transducer probe cover individually sterile packed mea tested ce/usfda certificate approved (70 mm) , shepard intrauterine insemination set 5.4 fr/20 cm , ovum aspiration needle single lumen (k iops) 20 g,35 cm , disposable lithotomy drape (conforming to bis certificate) , denuding pipette(134 145)microns plastic (human ivf grade) individually sterile pack of 10 , ultra pure gas in line filters for co2 incubators (human ivf grade) , 35mmx10 mm ivf plates (human ivf grade) pack of 500 , aluminium cryo canes , embryo grade water for co2 incubator (human ivf grade) 2000 ml bottle , 60mm x 15 mm ivf plates (human ivf grade) individually sterile packed pack of 500 , fully metallic embryo transfer catheter for difficult transfer (human ivf grade ) with 10 compatible et catheter , 100% ethanol , kim wipes disposables wipes ( l x w 4.5 inch x 8.5 inch) , disposable tips (100 to 1000 micron) individually sterile packed (human ivf grade) , 7 x detergent (ivf lab cleaning solution 5 litres) , opu needle 17g needle lengh 35cm tubing length 90 100cm , sticky mats for lab (human ivf grade) (pack of 30 sheet/mat) , icsi injecting for ivf and icsi holding needle for ivf 35 degree angle pack of 10 , powder free gloves latex, gamma irridiated, size 7 , ivf grade disinfectant and laminar flow hoods , picsi dish pack of 20 , disposable tips (ivf grade ) individually packed , humidification flask for trigas incubatore , vitrifit embrio loading device pack of 20...

Rani Durgavati Vishwavidyalaya Jabalpur - Madhya Pradesh

32176703 bids are invited for nitroaniline , oxalic acid , p aminoacetanilide , pepsin ,peptone , petroleum ether 40 60 , phenol , phenolphthalein ,phthalic acid , picric acid , polyvinyl alcohol , polyethyleneglycol , polymethyl methacrylate , polypropylene glycol ,polystrene , potassium thiocyanate , pyridine , resorcinol ,saccharin sodium , salicylic acid , serine , starch , succinicacid , sucrose , sulphuric acid , tannic acid , tetrabutylperchlorate , thiosemicarbazide , thio urea ,triphenylphosphine , xylene , ammonium sulphate ,ammonium ferric sulphate , beef extract powder , benedictreagent , benzil , citric acid , cetyl alcohol , calamine ,gum tragacanth , hydrazine sulphate , indigo carmine , ironsulphate , lead acetate , lactose , magnesium sulphate ,magnesium sulphate monohydrate , magnesium carbonate ,potassium phosphate , potassium chloride , potassiumhydroxide , sodium sulphate , sodium oxalate , sodiumcarbonate , silica gel , sodium hydrogen orthophosphate ,sodium thioglyconate , tin chloride , tetra methylthioureadisulphide , zinc oxide , 4 amino phenol , acacia , anthrone total quantity : 130...

Directorate Of Medical Education - Madhya Pradesh

32061822 tender for purchase of chemical and reagent for mdru dep tender for purchase of chemical and reagent for mdru dep , supply of chemicals and reagents for mdru , ammonium chloride 250gm , potassium bi carbonate 250gm , sodium chloride 250gm , tris hcl 250gm , sds 250gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyle alcohol 500ml , glacial acetic acid 500ml , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml , ethidium bromide 5ml , molecular weight ( dna ladder ) 100bp & 1kb 50ug , molecular weight ( dna ladder ) 50bp 50ug , molecular weight ( dna ladder ) 25bp 50ug , taq polymerase 5000unit , amplitaq gold dna polymerase master mix 500 unit , mgcl2 100 ul , dntp mix 100 ul , dnase 100 unit , rnase 100 unit , proteinase k 100 unit , triss 250gm , edta 250gm , boric acid 250gm , teepol 5 liter , xylene cynol 5 ml , dmso 500 ml , mnl i 500 unit , bcli 1500 unit , hpych4v 100 unit , hpych4iii 250 unit , sau96i 500 unit , sfci 200 unit , bcci 500 unit , scrfi 500 unit , afliii 250 unit , scai 500 unit , avai 500 unit , bsmi 250 unit , tspri 500 unit , mboii 300 unit , bsh1236i 500 unit , banii 1000 unit , mph1103i 500 unit , dde i 500 unit , bsmb i 200 unit , afa i 500 unit , bal i 250 unit , fspi 500 unit , primers 5 od , fmr1 set 1 – f5 tcaggcgctcagctccgtttcggtttca 3 5 od , r5 5 aagcgccattggagccccgcacttcc 3 5 od , mecp2 exon 1 set 1 f5 gttatgtctttagtctttgg–3´ r5 tgtgtttatcttcaaaatgt–3´ 5 od , exon 2set 1 f5 cctgcctctgctcacttgtt–3´ r5 ggggtcatcatacatgggtc–3´ 5 od , exon 2set 2 f5 agcccgtgcagccatcagcc–3´ r5 gttccccccgaccccaccct–3´ 5 od , exon 3 set 1 – f5 tttgtcagagcgttgtcacc–3´ r5 cttcccaggacttttctcca–3´ 5 od , exon 3 set 2 f5 aaccacctaagaagcccaaa–3´ r5 ctgcacagatcggatagaagac–3´ 5 od , exon 3 set 3 f5 ggcaggaagcgaaaagctgag–3´, r5 tgagtggtggtgatggtggtgg–3´ 5 od , exon 3 set 4 – f5 5´–tggtgaagcccctgctggt–3´ r5 ctccctcccctcggtgtttg–3´ 5 od , exon 3 set 5 f5ggagaagatgcccagaggag–3´ r5 cggtaagaaaaacatccccaa–3´ 5 od , exon3 ( l100v ) f5 aaccacctaagaagcccaaa 3 r5 gcttaagcttccgtgtccagccttcaggta 3 5 od , putative promoter and exon 1. f5 gggtgcaatgaaacgctta 3 r5 tttaccacagccctctctcc 3 5 od , mc4r rs17782313 f 5 aagttctacctaccatgttcttgg 3 r 5 ttccccctgaagcttttcttgtcattttgat 3 5 od , fto rs9939609 f 5 aactggctcttgaatgaaataggattcaga 3 r5agagtaacagagactatccaagtgcagtac 3 5 od , adipoqrs2241766 – f5 tgtgtgtgtggggtctgtct 3 r 5 tgtgatgaaagaggccagaa 3 5 od , rs1501299 f5 ctacactgatataaactatatggag 3 r5 ccccaaatcacttcaggttg 3 5 od , pomcrs6232 f5 ttgtgcccttcatctgaaca 3 r5 tgtagcaactttggcatgga 3 5 od , rs155971 f5tatatgcagccaccaatcca 3 r5 aaaatgaagggagaagcacaaa 3 5 od , ppar g ( pro12ala ) f5gcc aat tcaagc cca gtc 3 r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g 3 5 od , kcnj11 ( rs5219 ) f5 gactctgcagtgaggcccta 3’ r5 acgttgcagttgcctttctt 3’ 5 od , capn10 ( rs3792267 ) f5 cacgcttgctgtgaagtaatgc 3’ r5 tgattcc catggtctgtagcac 3’ 5 od , pik3ca set 1 forward 5’ ggagtatttcatgaaacaaatgaatgatgcg 3’ reverse 5’ gagctttcattttctcagttatctt 3’ 5 od , bat 25 set 1 f 5’ tcgcctccaagaatgtaagt 3’ r 5’ tctgcattttaactatggctc 3’ 5 od , bat 26 set 1 f5’ tgactacttttgacttcagcc 3’ r5’ aaccattcaacatttttaaccc 3’ 5 od , d2s123 set 1 f5’ aaacaggatgcctgcctttta 3’ r5’ gtttggactttccacctatgggac 3’ 5 od , d5s346 set 1 f 5’ actcactctagtgataaatcg 3 r5 agcagataagacagtattactagtt 3 5 od , d17s250 – set 1 f5’ ggaagaatcaaatagacaat 3’ r5’ gctggccatatatatatttaaacc 3’ 5 od , impdh2 set 1 f5 gtttctgcggtatcccaatc 3 r5 cgagcaagtccagcctat 3 5 od , bmp6 rs73719353 f5’ gctcctttgcacttcgctgt 3’ r5’ aggctctgctg agctcctac 3’ 5 od , bmp6 rs73719341 f 5’tgaacttcccattcccctct 3’ r5’ataaaattagcattgatcca 3’ 5 od , bmp6 rs73719318 f5’caggtgctgtgcaacttctt 3’ r 5’agagggcaccatggttgcct 3’ 5 od , bmp6 rs73381662 f 5’ ctgagattcaattaggccca 3’ r 5’taaagaacagcaaaagtctg 3’ 5 od , bmp6 rs73381650 f 5’cacataaagattgctgcatt 3’ r 5’tagtaatcctaaaaatggga 3’ 5 od , anxa2 rs7170178 f 5’ ttcacagcagttcaaaatac 3’ r 5’ ctgggtttccagagatggaa 3’ 5 od , anxa2 rs73435133 f 5’ gagtgcaaggtgctgaggat 3’ r 5’ gatttcagacagcccttgca 3’ 5 od , anxa2 rs73418020 f 5’ tctgagagtgaaaggtgcac 3’ r 5’ tcccatcccctgaatccctg 3’ anxa2 rs72746635 f 5’ cctgactcattgtcacatca 3’ r 5’ aagtggctttccactgccc 3’ 5 od , anxa2 rs73418025 f 5’ cttctcatcttactttt 3’ r 5’ agggaaggatacagaggaga 3’ 5 od , hsp 70 primer sequence 5 agcgt aacac cacca ttcc 3 ( forward ) 5 tggct cccac cctat ctc 3 ( reverse ) 5 od , the gapdh sequence forward primer 5 agc cac atc gct gag aca c 3, reverse primer 5 gcc caa tac gaccaa atcc 3. 5 od , tips i. 0.2 20 ?l tips pack size of 1000 each , tips ii. 20 200 ?l tips pack size of 1000 each , tips iii. 200 1000 ?l tips pack size of 1000 each , superscript ii rnase reverse transcriptase 10000 u ( 200u / ul ) , power sybrgreen pcr master mix 2.5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12 18 primer25 ?g , absolute ethanol 500 ml , pcr plates pack of 50 , sealing foil ( rt pcr / qpcr grade ) pack of 50 , filter tips pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tips , filter tips pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tips , filter tips pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tips , mct variable tubes , i. 20 200?l tubes pack size of 1000 psc. , ii. 200 600 ?l tubes each , iii. 500 2000 ?l tubes , nitrile autodextorous gloves pack size of 1000 psc. , mctstands for variable tubes sizes pack size of 1000 psc. each , i. 20 200?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , ii. 200 600 ?l tubes stand , mctstands for variable tubes sizes pack size of 1000 psc. each , iii. 500 2000 ?l tubes stand , filter tip boxes pack size of 1000 psc. each , i. 0.2 20 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , ii. 20 200 ?l filter barrier tip box , filter tip boxes pack size of 1000 psc. each , iii. 200 1000 ?l filter barrier tip box , rt pcr grade water 20 ml , tip discard box ( 1 2 liter capacity ) 10 each , graduated measuring cylinders 50, 100, 500, 1000ml 05each , graduated beakers50, 100, 500, 1000ml 05 each , flat bottom tube 5ml ( with screw cap ) 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 500 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. each , edta blood collection tube 5ml 100 psc. , plain vial ( for clot activator ) 100psc. , fluoride vial 100 psc. , test tube 5, 10ml 100 psc. , slide+cover slips 50 psc. , tissue paper roll 10 psc. , fine tissue cloth roll 10 psc. , cotton 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr 5 psc. , funnels variable range 5 psc. , plastic bottle, 200, 500, 1000ml 5 psc. , syringe + needle 2ml, 5ml pack size of 100 psc. each , nitrile gloves; medium and large size pack size of 1000 psc. , dna isolation kit pack size for 100 reaction , rna isolation kit pack size for 100 reaction , total rna mini kit ( human skin tissue ) pack size for 100 reaction , human leptin elisa kit pack size for 96 reaction , human adiponectin elisa kit pack size for 96 reaction , human adipsin elisa kit pack size for 96 reaction , human resistin elisa kit pack size for 96 reaction , human iron elisa kit ( serum iron ) pack size for 96 reaction , human ferritin elisa kit ( serum / ferritin ) pack size for 96 reaction , thyroid estimation kit pack size for 96 reaction , chloroform 500 ml , phenol 500 ml , isoamyl alcohol 500 ml , hno3 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2 amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500ml , benzoicacid ar 500ml , sds 250 gm , cholin cleaner 500 ml , sterilium 500 ml , hand sanitizer 500 ml , hypo 4% 1000ml , floor cleaner phenyl 500 ml , serum separator vial 3 ml 100 psc. , labolene 1000 ml , cleaning mop 5 psc. , broom 5 psc. , ice maker machine for laboratory purpose 1 psc. , microwave gloves 2 pkt. , pcr mini cooler 03 psc. , brown paper for autoclaving 10 rolls , pipette 0.5 10ul, 02 20ul, 10 100ul, 20 200ul and 100 1000ul. 1 psc. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5 7.5 cm ( height ) , 40 60 samples, multichannel pipette compatible combs and gel caste 1 psc. each , mini horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side 1 psc. each , multi size forceps lab set 01 pkt. , liquid nitrogen sample storage tanks 5 tanks ( 3, 5, 10, 20, 25 ltrs ) , liquid nitrogen 5ltrpkt. , liquid nitrogen sample handling gloves 5 sets of gloves , phosphate buffer saline 500 ml , formalin 500 ml , slide tray / rack pack of 2 psc. , paraffin wax ( 58 60c ) 250 gm , l mold pack of 2 psc. , tissue cassette steel pack of 2 psc. , electric tissue float bath ( thermostate ) 1 psc. , coupling jar pack of 2 psc. , staining rack pack of 2 psc. , whatman filter paper grade 1 & 2 pack size of 50 psc. , harri’s hematoxylin powder 50 gm , yellow eosin powder 50 gm , coverslip 18x18 ( microscopic ) 100 psc. , dpx mount 50 ml , xylene 250 ml , glycerol 100 ml , thymol crystals 250 gm , plastic boxes 5 boxes , steel / aluminium boxes 3 boxes , ammonia 250 ml , hot plate 1 psc. , methanol 250 ml. , mx35 premier microtome blade ( 34 / 80mm ) 50 blades 1 box , diamond pen ( histopathology use ) 1 pen , embedding mold and embedding ring 5 psc. , acrylamide / bis ar 500 gm , 10x tbe buffer 100 ml , urea 100 ml , ammonium persulfate 100 ml , temed 100 ml , 4’, 6 diamidino 2 phenylindole 100ug , human pai 1 elisa kit pack size of 96 reactions , diethyl pyrocorbonate 5 ml , pbs 500ml , mortar and pestle homogenizers...

Government Medical College - Madhya Pradesh

31823117 supply of chemical, reagents and consumables 2 2, 4 dnph 3 2, 6 dichloro phenol 4 4, amino antipyrine 5 acetic anhydriye 6 acetone 7 agar 8 agarose 9 alpha keto glutaric acid 10 alpha naphthol 11 amino acids 12 ammonia 13 ammonium molybdate 14 ammonium oxalate 15 ammonium persulphate 16 ammonium sulphate powder 17 amonical silver nitrate 18 anitmonic trichloride 19 arabinose 20 arsenic acid 21 barium chloride 22 benzidine powder 23 beta mercepto ethanol 24 bile pigments 25 bis acrylamide 26 blue litmus paper 27 bromophenol blue 28 butanol 29 calcium chloride 30 casein 31 ccl4 32 charcoal 33 cholesterol crystals 34 citric acid 35 concentrated h2so4 36 concentrated hno3 37 concentrated hcl 38 coomassie brilliant blue r 250 stain 39 copper sulphate 40 creatinine pure 41 cupric acetate 42 dextrin powder 43 di sodium phenyl phosphate 44 diacetyl monoaxime 45 diethyl pyrocarbonate 46 disodium monohydrogen ortho phosphate 47 dithiothreitol 48 dl alanine 49 dl aspartic acid 50 edta 51 eosin 52 ether 53 ethyl alcohol 54 ferric chloride 55 filter papers 56 filter papers whatmans no. 1 sheets 57 fluroglucinol powder 58 formaldehyde 59 formic acid 60 fructose powder 61 galactose powder 62 gelatin 63 glacial acetic acid 64 globulin 65 glucose powder 66 glycerol 67 hydrogen peroxide 68 hydroxy quinoline 69 iodine crystals 70 isopropanol 71 k2hpo4 72 keratin 73 kh2po4 74 lactic acid 75 lactose powder 76 lead acetate 77 lead oxide 78 liquid bromine 79 lithium chloride 80 low retention auto pipette tips 81 magnesium chloride 82 magnesium oxide 83 magnesium sulphate 84 maltose powder 85 mercuric chloride 86 mercuric sulphate 87 methanol absolute 88 methyl red 89 methylene blue 90 molybdic acid 91 monosodium dihydrogen phosphate 92 ninhydrin 93 nitrocellulose membranes 94 orcinol 95 orthophosphoric acid 96 paradimethylamino benzaldehyde 97 pasture pipettes 98 peptone powder 99 perchloric acid 100 ph papers range 2 14 101 phenol 102 phenolphthelin indicator 103 phenyl hydrazine hydrochloride 104 phenyl mercuric acetate 105 phenyl phosphate 106 phloroglucinol 107 phosphomolybdic acid 108 picric acid 109 potassium chloride 110 potassium ferricyanide 111 potassium ferrocyanide 112 potassium hydroxide 113 potassium iodide 114 potassium oxalate 115 potassium permanganate 116 potassium sodium tartarate 117 protein molecular weight markers 118 pvdf membranes 119 red litmus paper 120 resorcinol 121 silver nitrate 122 sodium acetate powder 123 sodium benzoate 124 sodium bicarbonate 125 sodium carbonate 126 sodium chloride 127 sodium citrate 128 sodium dithionite 129 sodium dodisyl sulphate ( sds ) 130 sodium hydroxide 131 sodium hypobromide 132 sodium hypochromate 133 sodium nitrite 134 sodium nitropruside crystals 135 sodium pyruvate 136 sodium sulphite 137 sodium tungstate 138 sprit lamps stainless steel 139 starch powder 140 sucrose powder 141 sudan black 142 sulphanilic acid 143 sulphosalysilic acid 144 sulphur powder 145 tannic acid 146 temed 147 thiosemicarbazide 148 thymol blue indicator 149 toffers indicator 150 trichloro acetic acid 151 tricine 152 tris base 153 urea 154 urease powder 155 uric acid crystals 156 vaniline 157 vitamin a 158 vitamin c 159 zinc chloride 160 zinc sulphate 161 bovine serum albumin 162 di sodium edta 163 ethidium bromide 164 xylene cyanol 165 potassium dichromate 166 twin 20 167 coomassie brilliant blue g 250 168 sodium deoxy cholate 169 glycine 170 amido black 171 6 amino hexanoic acid 172 ponceau s 173 fast green fcf 174 guanidine chlorid 175 ethidium bromide 176 bromophenol blue 177 methylene blue 178 bromocresol green s 179 lithium carbonate 180 bacteriological peptone 181 beef extract 182 yeast extract 183 malt extract 184 nutrient agar 185 blood agar base 186 cystine lactose electrolyte deficient agar 187 macconkey agar 188 agar agar 189 robertson cooked meat broth 190 bile salt agar 191 thiosulphate citrate bile salt sucrose 192 2.92 bile aesculin agar 193 brain heart infusion broth 194 2.94 mueller hinton agar 195 pikes media ( h. inf. ) 196 plet media ( b. anthracis ) 197 pnf medium ( s. pyogenes ) 198 lj medium 199 sda 200 bile salt agar 201 ss agar 202 sorbotolmacconkey agar ( ehec ) 203 tetrathionate broth 204 selenite f broth 205 stuart transport medium 206 thayer martin medium 207 triple sugar iron agar 208 sim medium 209 simmon’s citrate agar 210 christensen urea agar 211 dca 212 pre reduced anaerobically sterilized media 213 mannitol salt agar 214 xld agar 215 wilson blair brilliant green bismuth sulphite agar 216 hoyle’s tellurite lysed blood agar 217 mrvp broth 218 glucose 219 sucrose 220 lactose 221 maltose 222 mannitol 223 inulin 224 amikacin 30μg 225 amoxicillin 25 μg 226 ampicillin / cloxacillin 10 μg 227 amoxicillin + clavulanic acid 20+10 μg 20+10 μg 228 ampicillin +salbactam 10+10 μg 10 vial each 229 azithromycin 15 μg 230 aztreonam 30 μg 231 bacitracin 130 μg / μl 232 carbenicillin 100 μg 233 cefaclor 30 μg 30 μg 234 cefalexin 30 μg 30 μg 235 cefazolin 30 μg 30 μg 236 cefepime 30 μg 237 cefixime 5 μg 238 cefoperazone 75 μg 239 cefoparazone+ salbactam 75+30 μg 240 cefotaxime 30 μg 241 cefotetan 30 μg 242 cefoxitin 30 μg 243 cefpirome 30 μg 244 cefpodoxime 10 μg 245 ceftazidime 30 μg 246 ceftriaxone 30 μg 247 cefuroxime 30 μg 248 cephalotin 30 μg 249 chloramphenicol 30 μg 250 ciprofloxacin 5 μg 251 clarithromycin 15 μg 252 clindamycin 2 μg 253 colistin 10 μg 254 doripenem 10 μg 255 doxycycline 30 μg 256 ertapenem 10 μg 257 erythromycine 15 μg 258 fosfomycin 200 μg 259 gentamicin 10 μg 260 gentamicin ( high load ) 120 μg 261 imipenem 10 μg 262 kanamycin 30 μg 263 levofloxacin 5 μg 264 lincomycin 15 μg 265 linezolid 30 μg 266 meropenem 10 μg 267 moxifloxacin 5 μg 268 nalidixic acid 30 μg 269 netilmicin 30 μg 270 nitrofurantoin 300 μg 271 norfloxacin 10 μg 272 ofloxacin 5 μg 273 oxacillin 1 μg 274 penicillin 6 μg / 10iu 275 piperacillin 100 μg 276 piperacillin+tazobactam 100+10 μg 277 polymixin 50 μg / 300 ui 278 quinupristin dalfopristin 15 μg 279 rifampicin 5 μg 280 spectinomycin 100 μg 281 streptomycin 10 μg 282 streptomycin ( high load ) 300 μg 283 teicoplanin 30 μg 284 tetracycline 30 μg 285 ticarcillin 75 μg 286 ticarcillin+clavulanic acid 75+10 μg 287 tigecycline 15 μg 288 tobramycin 10 μg 289 trimethoprim+sulfamethoxazole 1.25+23.75 μg 290 trimethoprim 5 μg 291 vancomycin 30 μg 292 polymyxin b 30 μg 293 elisa kit for hbsag 294 elisa kit for dengue ns 1 295 elisa kit for dengue igm 296 rapid card test dengue ns1 297 elisa kit for chikungunya igm 298 torch nanoplex igg / igm ( nano elisa kit ) 299 aso latex agglutination test 300 crp latex agglutination test 301 ra latex agglutination test 302 widal slide agglutination test 303 rpr test kit 304 vdrl test 305 hbsag card test 306 malaria card test 307 hav igm card test 308 hcvigm card test 309 gram stain 310 acid fast bacilli staining 311 india ink 312 albert stain 313 potassium hydrochloride 314 lectophenol cotton blue 315 lugols iodine 316 nacl crystal 317 stain a and stain b 318 methanol 319 surgical spirit 320 melachite green 321 nigrosine 322 h2so4 323 kmno4 crystal 324 iodine 325 hydrogen peroxide 326 oxidase reagent ( tetramethyl p phenylenediaminedihydochloride ) 327 rabbit plasma 328 kovac’s reagent or ehrlich reagent 329 potassium nitrate ( kno3 ) 330 optochin disc 331 sodium deoxycholate 332 bacitracin disk 333 potassium iodide 334 potassium hydroxide 335 formaldehyde 40% 336 glycerine 337 potassium acetate 338 pyridine 339 sodium hydrosulphite 340 thymol crystal 341 2 propanol 342 xylene 343 paraffin wax 344 pap stain 345 giemsa stain 346 hematoxylene stain 347 eosin stain 348 sodium metabisulphite 349 brilliant cresyl blue 350 leishman stain 351 ethyl alcohol 352 methanol 353 glacial acetic acid 354 dpx 355 cdi tissue marking dyes 356 sodium iodate 357 potassium alum 358 citric acid 359 chloral hydrate 360 1% aq potassiumferrocyanide 361 2% aq. hydrochloric acid 362 turk diluting fluid 363 pandy’s reagent 364 trichloroacetic acid 365 ehrlich’s reagent 366 lugol’s iodine 367 n / 10 hcl 368 semen diluting fluid 369 sulfur powder 370 bovine albumin 371 g6pd reagent 372 cedar wood oil 373 drabkin solution for hb 374 edta powder 375 filter paper sheet 376 fouchets reagent 377 liquid ammonia 378 methylene blue 379 rbc dilution fluid 380 rectified spirit 381 3% acetic acid 382 chlorhexidine 0.5% hand rub 383 fluorescein 384 rhodamine 385 acridine orange 386 salmonella diagnostic antiserum 2ml – 0:2 387 salmonella diagnostic antiserum 2ml – 0:4 388 salmonella diagnostic antiserum 2ml – o:9 389 salmonella diagnostic antiserum 2ml – h d 390 salmonella diagnostic antiserum poly o’ a g 2ml 391 vibrio cholera diagnostic antiserum ogawa 2ml 392 vibrio cholera diagnostic antiserum inaba 2ml 393 vibrio cholera diagnostic antiserum 2ml – poly’o’ 394 shigella boydii antiserum polyvalent 2ml 395 shigella dysenteriae antiserum polyvalent 2ml 396 shigella flexneri antiserum polyvalent 2ml 397 shigella sonnei antiserum polyvalent 2ml 398 desorb u 399 owner koller buffer 400 cacl2 0.025 m 401 cephascreen 402 neoplastine solvent 2 403 listest d di plus ( layex ) 404 listest d di ( buffer ) 405 liquid fib 406 liatest control n 407 neoplastine c1 plus r 2 408 lh lyse m52 409 diff lyse m52 410 diluent m52 411 prob cleaner 412 aspen m 68 diluent 413 aspen m 68 lb lyse 414 aspen m 68 lh lyse 415 aspen m 68 ld lyse 416 aspen m 68 fd dye 417 aspen probe cleaner 418 alfa lyse 419 alfa dilutents...

Government Dental College - Madhya Pradesh

31532122 supply of dental materials dental material, orthodontic material , 1.5 mmx miniplate s.s. , 1.5 mmy miniplate s.s. , 1.5 mm l miniplate with gap left s.s. , 1.5 mm l miniplate with gap right s.s. , 1.5 mm l miniplate without gap left s.s. , 1.5 mm l miniplate without gap right s.s. , 1.5 mm 4 hole miniplate with gap ( straight ) s.s. , 1.5 mm 4 hole miniplate without gap ( straight ) s.s. , 10 mm screw for2.5 mm plate , 10 mm screw for2mm mini plate ss , 2.5 mandibularreconstruction ( 20 hole ) plate with angle , 2.5 mandibular plate left angle s.s. , 2.5 mandibular reconstruction ( 20 hole ) straight plate s.s. , 2.5 mm mini plate 6 hole with gap , 2.5mm 4 hole miniplate with gap ( straight ) s.s. , 2mm 10 hole miniplate s.s. , 2mm 20 hole miniplate without gap ( straight ) s.s. , 2mm 4 hole miniplate without gap ( straight ) s.s. , 3.0 round body silk suture , 5% taper hand endodontic files , 6 mm screw for2mm mini plate ss , 6 mm screw for 2.5 mm. mini plate , 6 mm screw x 1.5 mm for 1.5 mm mini plate , 8 mm screw for2.5 mm plate , 8 mm screw for2mm mini plate ss , 8 mm screw x1.5 mm for 1.5 mm mini plate , abrasive & polishing burs , abrasive finishing stone for ni cr &cr co. assorted , abressive sand for sand blaster 1 kg , absorbable gelatine sponge ( abgel ) , absorbent paper ( plain ) , absorbent points ( 15 40 ) ( 45 80 ) , accuchek strips , acrylic cold cure 400 gms.& 400 ml.both in single pack , acrylic cold cure shade for jc different shades a ( 1 ) b ( 1 ) c ( 1 ) d ( 1 ) e ( 5 ) f ( 1 ) 450 gm.450 gm.powder. , acrylic heat cure 450 gm. powder, 256 ml, liquid, 112 ml. cold mold seal pink / clear , acrylic heat cure shade for jc different shades a ( 1 ) b ( 1 ) c ( 1 ) d ( 1 ) e ( 3 ) 450 gm.powder , acrylic trimmer stonet2 , acrylic trimmer stone t1 , acrylic trimmer stone t3 , acrylic trimmer stone t4 , adhesive plasterroll , air rotor cartridges ( std. and high torque ) , airotor burs ( diamond ) differentshapes , airotor diamond burstapering, with ce mark , airotor diamond burs flat fissure with ce mark , airotor diamond burs inverted cone with ce mark , airotor diamond burs round with ce mark , airotor spray for quick lubrication of handpiece ( approx. 500 ml ) , alcohol 100% ( ethanol ) , alginate impression material1125 gms. jar , alpine green wheels assorted for contra angle hand piece , amalgam finishing kit , apf gel with fluoride application trays 200 gm. pack , arsenic fiber for dental use , articulating paper for prosthodontic purpose to check occlusion , austins retractors , automix gic type ii capsules , b.p. blade ( 15 no. ) , band material .125x.003 , band material .150x.003 , band material .150x.004 , band material .180x.005 molar , barbed broches 21 mm ( pkt 6 piece ) , base former moulds adult , base former moulds pediatric , base paste for ceramic , base plate shellac u / l , biodentine , bite registration paste. , bleaching kit in office gel form , bleaching powder , bod gardner pattern mallet , bondable & weldable beggs oval buccal tubes , bondable beggs round buccal tubes double weldable beggs round buccal tubes double , bondable brackets beggs high flauge ( flat & curved ) , bonding material light cure ( trans bond xt ) , bonding material self cure ( rely – a – bond ) , bone graft material synthetic tricalcium phosphate , hydroxiapatite and / or combination dfdba, fdba, glass reinforced , bone graft material – containing glass particle, particle size above then 90 micron , bone graft material bmp’s and growth factors , bone graft material dfdb , bone graft material fdba , bone graft material hydroxyappatite crystal, , bone graft material synthetic alloplastic material , bone graft material tricalcium phosphate , bone graft material xenografts , bone wax , bow friction stop – 100 092 ( ortho org ) , brackets ( beggs ) weldable ) , brass pin stage 1, 2, 3 lock pins , brass wire ( 0.7mm ) , brush for denture cleaning , buccal tube bondable .022x.028 mbt – single double & u / l & u / triple , buccal tube weldable .022x.028 mbt – single double & u / l & u / triple , bur straight hand pie ( flat fissure ) , bypass clamps pack of 10 , calcium hydroxide ( two paste system ) ( for pulp capping ) , calcium hydroxide powder 8 gms. , capillary tube ( bt ct ) , carbide trimmer , carbide trimmers for based metal ( different shape ) , carbolic acid minimum pack of 250 ml. , carborandum disc large , carborandum disc small , carborandum lathe wheel , carborundem disc wheel , caries detecting dye , carving wax , carving wax block for individual tooth carving , casting investment material a. casting investment for porcelain b. phosphate bonded , casting material a. nickel chrome b. chrome cobalt c. metal for porcelain , cavit temporary restoration , cavity varnish pakc of 30 ml. , celluloid matrixstrips , ceramic bracket kit mbt 022 x 028 , ceramic finishing kit , ceramic kit containing opaquer, dentine shade, glaze, modeling liquid 16 shades , ceramic metal for pfm work pellets for crown & bridge pkt. of 1 kg. , ceramic polishing kit , cheek retractor adult , cheek retractor child , chemo mechanical carries removal system with instruments , chip syringe , chisel 5 mm ss with ce mark , chisel 3 mm, ss with ce mark , chlorhexidiene for endodontic irrigation , cintered diamond point , cintered diamond trimmer different shape and size , clot activator , clove oil 110 ml. , coated glass slide for immunohistochemistry , cold mould seal ( 5 litres jar ) , combination pull head gear , compo nomer 20 comp pack , composite filling material universal opaquer , composite finishing & polishing kit , composite restorative kits ( having dentin and enamel shades along with bonding agent and applicator tips ) , compressor tube for air , cord for units , cover slip ( 22x22, 22x50, 22x70 ) , crimpable hooks straight , crown & bridge waxes a. occlusal b. cervical c. body wax d. mockup wax , crucible for centrifuge casting machine , crucible for induction casting machine , crystal for ceramic ( light + medium + dark ) , cusaliers ( assorted ) , cytofix , debubblizer 100ml. spray bottle , dental ceramic dentin porcelain 1 oz ( 28.3 gms. ) a1, a2, a3, a3.5, b2, b3, c1, c2, d2 , dental ceramic enamel porcelain powder50g bottle ( i1, i2 ) , dental ceramic opaque porcelain 4x28.3 gms. ( 4 oz ) a1, a2, a3, a3.5, b2, b3, c1, c2, d2 , dental floss , dental floss with handle , dental investment material , dental mercury 225 gm. , dentulas mould to prepare models – adult , dentulas mould to prepare models – pedo , diamond disc set ( different size, & safe sides ) , diamond disc set different sizes , diamond points ( airotor h.p ) a.tf no. 11 & 12 b. tr no. 11 , 12 & 13 c.wr no.13 d.tc no.21 e.bud shaped , diamond polish kit a. for composite b. for porcelain , diamond stripes pack of 10 , diamond stripsanterior , diamond stripsposterior , diamond strips 106 200 ( anterior & posterior ) , die hardner 15ml. bottle , die pin double , die pin single , die sealear 15 ml. bottle , die spacer silver &gold 15 ml. bottle , die stone pack of 3 kg. , digital carestream xray films8x10 , disposable surgical sterilizedgloves 6 ½ , 7, 7 ½ , disposable syringe 24 gauge x 1 ½” , disposable syringe 26 gauge x 1 ½” , dowel pins , drill bit 1.0 mm ss for micromotor straight hand piece , drill bit 1.5 mm ss for micromotor straight hand piece , drill bit 2 mm ss for micromotor straight hand piece , duplicating material , dynaplast 2” , edtatube , edta for root canal irrigation and chelation , edta powder pack of 500 gm. , elastic chain ( long ) spool form 15 feet , elastic chain ( long, short & continuous ) , elastic separators pack of 100 , elastic thread pack of 100 , elastics pink and red , electrolytic liquid 1 lt. , enamel boding agent 20 gms , endo ice in spray form minimum 100 ml. pack , endo ice or equivalent , endodontic sealer ( ah plus or equivalent ) , endodontic side vented irrigation syringe ( 27 and 30 gauge ) , endodontics pluggers iso assorted , engine driven rotary endodonticfiles , eosin ( 125ml ) , ericharch bar with ce mark , esr needle , etching agent , etching agent liquid type , eugenol free periodontal dressing pack , examination gloves small, medium, large , expansion screw conventionalu / l , expansion screw hyrax , explorer with ce mark , face mask ( delairs face mask ) , felte cone , felte wheel , feracrylum gel , feracrylum sulphate solution , files .04 taper used in reduction hand piece , filter paper , finger spreader ( 15 40 ) , flate fissure bur for straight hp , flexifile15 40 k file , flexifile45 80 k file , fluoride gel , fluoride varnish , flux pack of 10 gms. , formaldehyde 100% , formaline , formocresol ( cresol 35%, formaldehyde 19% ) 15 ml bottle , french chalk , gates glidden drills assorted , gentian violet crystel , gingifast used for gingival substitute implent model fabrication , glass innomer cement for cementation ( type 1 luting ) minimum pack of powder 35gm. , glass ionomer restorative material ( type 9 ) ( capsules ) , glass ionomer restorative material ( type 9 ) ( powder approx. 15 gm and liquid approx. 8 ml ) , glass ionomer restorative material ( type ii ) ( powder approx. 15 gm and liquid approx. 8 ml ) , glass slide ( 7.5cmx2.5cmx1.25mm ) and ( 7.5cmx2.5cmx1.1mm ) , grams staining kit , green stick compound ( tracing stick ) , gtr membrane eptfe , ptfe, resorbable, collagen , gutta percha point ( 4% 20, 25, 30; 6% 20, 25 ) , gutta percha point protaper , gutta percha points ( i.s.o. size 2% taper ) ( 15 40 ) , gutta percha points ( i.s.o. size 2% taper ) ( 45 80 ) , gutta percha solvent , hand operated set of files for rct ( single cone technique ) , harris hematoxylin ( 125ml ) , hbs ag cards , head gear high pull , head gear medium pull , histocassettes ( plastic ) , howarths periosteal elevators with ce markc make , implant & abutments3.3x13 , implant & abutments 3.3x10 , implant & abutments 3.3x11.5 , implant & abutments 3.3x16 , implant & abutments 3.5x10 , implant & abutments 3.5x11.5 , implant & abutments 3.5x13 , implant & abutments 3.5x16 , implant & abutments 3.75x10 , implant & abutments 3.75x11.5 , implant & abutments 3.75x13 , implant & abutments 3.75x16 , implant & abutments 3.75x8 , implant & abutments 4.2x10 , implant & abutments 4.2x11.5 , implant & abutments 4.2x13 , implant & abutments 4.2x16 , implant & abutments 4.2x8 , implant & abutments 5x10 , implant & abutments 5x11.5 , implant & abutments 5x13 , implant & abutments 5x16 , implant & abutments 5x8 , implant kit ( surgical drills / physiodespenser / endosteal implants ) , implant kit complete surgical kit & implant with tiunite surgical prosthetic components , implant prosthetic kita.impression coping, b. healing abutment d. implant analogue , implant screw driver 1.5mm, 2 mm, 2.5mm , implant surgical kitdental implants 25 no with easy abutment, dental implants 20 no with ball and socket attachments, implant physiodispenser with fiber optic reduction hand piece , 05 set of implant analog, gingival former, impression post , implant with tiunite surface ( dental ) & abutment , impression compound with ce mark pack of 200 gm. , impression paste zinc oxide eugenol , inlay wax , interlig splinting material 8.5 cm length pack of 3 , intra oral distractor rt & lt side , intra oral distractor rt & lt side 10” , investment material for ceramic work powder with liquid , iodoform powder 50 gm , irm filling material 38 gm power and 14 ml liquid , kobaysi hooks , lancet , lentulo spiral 15 40 hand operated , leukart pieces l blocks for histopathology of brass with plate , light cure composite resin ( 3 syringes each of a1, a2, b1, b2 shades ) , light cure pack for periodontal dressing , lingual button bondable , local drug delivary system for periondontal therapy , low fusing porcelain ( all ceramic & veneer work ) compelete kit , low fusing porcelain ( all ceramic and veneer work ) complete kit , lubricant spray for hand pieces , m 30 diluent ( 20 lit ) , m 30 probe cleanser ( 17ml ) , m 30 rinse ( 20 lit ) , m 30 lyse ( 500ml ) , madrill for disk for straight hand piece , madrill for sand paper for straight hand piece , mandrills for sand paper , matrix band retainer ivory no.1 , matrix band retainer ivory no.8 , matrix bands no 1 and no 8 , matrix system sectional ( palodent or like ) , maxilofacial prosthetic medical grade silicon material complete kit , meta pex pressure syringe , metal saw with handle 6 inch and 12 inch , miracle mix , mixing gun for gic , mixing gun for rubber base , modelling wax with ce mark , modules ( transparent ) , modules ( transparent ) strips pack of 100 , mounted dental x ray viewer , mouth mirror top ( front surface ) , mta delivery syringe , mushroom loop arch u / l – 32, 33, 34mm. , mylar strips , nasal hood for nois , niti coil spring close and open , niti palatal expander – diff. sizes , nylon suture 3 0 ( r.c ) non absorbable surgical suture u.s.p. ce0197 , nylon suture 4 0 ( r.c ) non absorbable surgical suture u.s.p. ce0197 , nylon suture 5 0 ( r.c ) non absorbable surgical suture u.s.p. ce0197 , occlusal films , opaque liquid 250 ml. , orthodonticelastics green 5000 per packets , orthodonticelastics yellow 5000 per packets , orthodontic bondable begs round buccal tubes with hook pack ofn 50 , orthodontic elastics blue 5000 per packets , orthodontics arch wire edgewise straight length ss022”x.028” pkt. of 10 , orthodontics arch wire edgewise straight length ss .016”x.022, pkt. of 10 , orthodontics arch wire edgewise straight length ss .017”x.025, pkt. of 10 , orthodontics arch wire edgewise straight length ss .019”x.027” , pkt. of 10 , orthodontics arch wire preformed blue elgiloy.016”x.016” u / l pkt. of 10 , orthodontics arch wire preformed niti wire .012 lower ( mandibular ) pkt. of 10 , orthodontics arch wire preformed niti wire .012 upper ( maxillary ) pkt. of 10 , orthodontics arch wire preformed niti wire .014 lower ( mandibular ) , orthodontics arch wire preformed niti wire .014 upper ( maxillary ) pkt. of 10 , orthodontics arch wire preformed niti wire .016lower ( mandibular ) , orthodontics arch wire preformed niti wire .016 upper ( maxillary ) pkt. of 10 , orthodontics arch wire preformed reverse curve niti .016” u / l, 16x22” , orthodontics arch wire preformed s / s , 021x.027 lower pack of 10 , orthodontics arch wire preformed s / s . 019x.025” lower pack of 10 , orthodontics arch wire preformed s / s .017”x.025” lower pack of 10 , orthodontics arch wire preformed s / s .017”x.025” upper , orthodontics arch wire preformed s / s .019x.025” upper pack of 10 , orthodontics arch wire preformed s / s .021x.027 upper pack of 10 , orthodontics arch wire preformed tma .019”x.027 upper , orthodontics arch wire preformed tma .019”x.027” lower pack of 10 , orthodontics arch wire preformed tma .022x.028 lower pack of 10 , orthodontics arch wire preformed tma .022x.028 upper pack of 10 , orthodontics australian premium plus .010 spool form , orthodontics australian premium plus .012 spool form , orthodontics australian regular wire .016 spool form , orthodontics band material .125x.003 pack of 10 feet , orthodontics band material .150x.003 pack of 10 feet , orthodontics band material .180x.005 pack of 10 feet , orthodontics base former u / l , orthodontics bondable brackets beggs high flange ( curved ) pack of 50 , orthodontics bondable brackets beggs high flange ( flat ) pack of 50 , orthodontics bonding material light cure for orthodontic purpose kit with atchent bonding agent & composite , orthodontics bonding material self cure kit with atchent bonding agent & composite , orthodontics brass wire ( 0.7mm ) spool form , orthodontics buccal tube bondable .022x.028 mbt – lower single , orthodontics buccal tube weldable .022x.028 mbt –lower single , orthodontics buccal tube weldable .022x.028 mbt – upper double , orthodontics buccal tube weldable convertible .022x.028 ( mbt ) lower , orthodontics buccal tube weldable convertible .022x.028 ( mbt ) upper , orthodontics ceramic bracket kit mbt .022 x .028 , orthodontics cheek retractor adult , orthodontics cheek retractor child , orthodontics cheek retractor medium , orthodontics combination pull head gear , orthodontics elastic chain ( continuous ) spool form 15 feet , orthodontics elastic chain ( short ) spool form 15 feet , orthodontics expansion screw conventionallower , orthodontics indirect bonding kit , orthodontics kobaysi hooks pack of 100 , orthodontics ligature wire .009” spool form 500 gms. by waight , orthodontics lingual button bondable pack of 10 , orthodontics lingual button weldable pack of 10 , orthodontics lingual cleat pack of 10 , orthodontics lingual orthodontic kit .018 size , orthodontics lingual sheaths 971 032 , orthodontics lip bumper pack of 10 , orthodontics micro implant kit , orthodontics ni ti closed coil spring spool form , orthodontics ni ti open coil spring spool form , orthodontics niti palatal expander , orthodontics niti preformed wire round heat acticated upper & lower .014, .016, .018 ( pkt. of 10 ) with , orthodontics niti rectangular wire hear activated 16x 22 ( pkt of 10 ) with ce mark , orthodontics niti rectangular wire hear activated 17x 25 ( pkt of 10 ) with ce mark , orthodontics power module mbt , orthodontics pre adjusted edgwise kit 0.022 mbt with buccal tubes ( single buccal ) , orthodontics pre formed connecticut intrusive arch u / l ( medium size – .016 x .022 ) , orthodontics prefabricated s.s. post 25 posts , orthodontics preformed bands without buccal tube , orthodontics s / s wire all gauge 22 gauge spool of 1 kg. , orthodontics s / s wire all gauge 23 gauge spool of 1 kg. , orthodontics s / s wire all gauge 25 gauge spool of 1 kg. , orthodontics self ligating bracket kit ( 022 x 028 ) mbt , orthodontics thermal niti – 016x022 pack of 10 , orthodontics tma wires 0.016 x 0.022 upper & lower pack of 10 , orthodontics tma wires 0.017x0.025 upper & lower pack of 10 , orthodontics wire s.s. 19 guage pack of 1 kg. , orthodontics wire s.s. 21 guage pack of 1 kg. , paper points no. 15 40, 45 80 assoted pack180 sticks , paraffin wax ( 58 60 degree ) 500gm , pas stain & pap stain kit , patient drape , pediatric endodontic rotary files , pediatric readymade bands , pediatric x ray film 0 size , periodontal dressing coe pak 2 tube system 90 gm. activator 90 gm. catalyst , periodontal dressing material i. eugenol free – coe pac ii. light cure periodontal dressing material , pex pressure syringe , photographic mirrors , piezeo reamers , pink porcelain , pit and fissure sealants tube form minimum 3 gm , plaque disclosing solution 50 ml , plaster of paris indian , plaster stone 25 kg. pack , plastic dropping bottle ( 100ml, 250ml and 500ml ) , polishing cotton buff 4 diameter , polishing luster material for ceramic / porcelain work , poly carboxylate , poly vinyl siloxane impression material light body 180 ml ( base 90 ml+catalyst 90ml ) , poly vinyl siloxane impression material medium body conistency 180 ml ( base 90 ml , poly vinyl siloxane impression material putty consistency 900 ml ( base 450ml + catalyst 450 ml ) , pontic formers anterior u.& l. modules , pontic formers posterior u.& l. modules , porcelain glaze liquid powder both , porcelain opaque paste a1, a2, a3, a3.5, b1, b2, b3, c1, c2, d2 , porcelain powderdifferent shades dentine and opaquea1, a2, a3, a3.5, b1, b2, b3, c1, c2, d2 , porcelain separating liquid 100 ml. , post core system ( drills & compatible post ) , power module mbt , pre adjusted edgwire kit 0.022 mbt with buccal tubes ( single buccal ) , pre formed connecticut intrusive arch u / l ( medium size – .016 x .022 ) , prefabricated post , prefabricated zirconia crown , preformed waxes for cast partial denture frame work a. bicuspid clasp ( 4 pkt ) b. molar clasp ( 4pkt ) c. ligual bar ( 4pkt ) d.anatomic palate ( small &large ) e. relife waxes f. palatel bar , printer paper roll ( 30 mtr ) , proline suture ( 6.0 ) 823 , prosthetic adhesive , pumic powder 1 kg pack , quick setting mineral trioxide aggregate ( mta ) , r.c ( k files ) ( 21mm ) ( 06, 08, 10, 15, 20, 25, 30, 35, 40 and 45 80 ) , rapid vicryl5 0 , reconstruction s.s plate plain , reconstruction s.s plate with condyle , reconstruction ti plate plain , reconstruction ti plate with condyle , refrectary material for all ceramic & veneer work , regenerative membranes : non resorbable membrane eptfe, ptfe , regenerative membranes : resorbable membrane collagen membrane vicryl synthetic skin freeze dried durameter , resinbonded cement ( dual cure ) , resin modified glass ionomer restorative material ( capsules ) , resin modified glass ionomer restorative material ( powder approx. 15 gm and liquid approx. 8 ml ) , resin reinforced glass ionomer cement powder 12wmg, liquied 6mg1 powder scoop 1 mixingpad , retention bead ( small size ) , retractionpaste system , retraction cord ( 0, 00, 000, 1, 2 ) , right upper molar dental extracion forcep ( imported ) with ce mark , ring liner , root canal calcium hydroxide containing paste , root canal edta gel 3 ml. , root canal h files 15 40 iso , root canal h files 45 80 iso , root canal obturating material for primary teeth , root canal reamers 15 40 iso assorted , root canal remers 45 80 iso assorted , root canal sealer resin based , rotary endodontic files ( 4% 20, 25, 30; 6% 20, 25 ) , rotary hand piece file for root canal , rotary protaper endodontic files ( assorted ) , rubber base material ( addition silicon type ) ( putty+ light body ) medium body , rubber dam kit , rubber dam sheets , s d f , sand for sand blaster , sand paper ( 120 no. ) , sand paper mandrill , sealing wax , separating media , sheet acrylic for pressure molding machine 1 & 2 mm , sheet silicon for pressure molding machine , silicon rubber points / wheel / disc, , silicone tooth model dies – all teeth & edentulous silicone dies. , silk suture 3 0 ( 5070 ) braided silk non absorbable suture ce0086 , silver alloy non gamma 30 gm. , slide box ( 2 slide container ) , slide coating chemical , smoothcastingwax pack of 15 sheets 0.3 mm , sodium hypochloride ( approx. 5.25% ) , soft liner cold cure , soft liner heat cure , solder material silver spool 15 feet , splinting material light cure fiber reinforced, strip form , sprue wax 3mm 1 kg. spool , stainless steel crowns – permanent molar , stainless steel crowns – primary molar , stellon c / b polydent ( shade acrylic heat cure ) , stellon c / b polydent ( shade acryliccoldcure ) , steri strip , stone assorted , strip crown , suction tips , sunction appartantus with disp tips , surgical blade no.11 ( 100 blade packet ) , surgical head cap , surgical skinstepller , suture needle, ss, round and / or cutting body ½ and / or3 / 4 circle needle , suture thread, resorbable vicryl, nonresorbable silk3 0, 4 0, 5 0 , t. c.bur / t.c. trimmer , t.c tappering fissure oral surgery burs 701 for straight, hand piece , t.c. tappeing fissure oral surgery burs 703 for stright hand piece , t.c. tappering fissure oral surgey burs 702 for stright hand piece , tc round oral surgery bur for straight hand piece , tc tapering fissure orialbur for straight handpiece , teeth full set cross linked , teeth posterior ( teeth set ) teeth set of 8 / 16 card , teeth set acrylic anterior upper and lower teeth set of6 , teeth set of4 , temporary filling material15 gm , test tube holder , thermoplaticsheets ( 2mm hard and soft ) , three layer surgical mask disposable , tiscrew ( 2.5 x 6 mm ) , ti plate ( 1.5 mm ) , ti plate ( 2.0 mm ) , ti plate ( 2.5mm 4 hole with gap ) , ti screw ( 1.5 x 6 mm ) , ti screw ( 1.5 x 7 mm ) , ti screw ( 1.5 x 8 mm ) , ti screw ( 2.0 x 10mm ) , ti screw ( 2.0 x 6mm ) , ti screw ( 2.0 x 8mm ) , ti screw ( 2.5 x 8 mm ) , ti screw ( 2.5 x10 mm ) , tooth polishing paste, , tracing stick compound , transparent crowns kit , tray adhesive ( coltene ) , tube for water supply in dental chair , tungston carbide bur for micromotor straight hand piece, flat fissure 558 , 560 no. , turbine handpiece oil 500 ml , typodonts with full set of all teeth with ce mark ( adult ) , typodonts with full set of all teeth with ce mark ( pedo ) , vaseline , vicryl suture 3 0 ( 2401 ) absorbable surgical suture u.s.p. , vicryl suture 3 0 ( 2437 ) absorbable surgical suture u.s.p. , vicryl suture 4 0 ( 2465 ) absorbable surgical suture u.s.p. , viscogel relining material , vita pex , wax bees , wax blue inlay , wax carding , wax carving cast all shades , wax castingsheet , wax craving , wax pattern for bondyhardr claps, pack of 10 sheet / 200 clarps , wax pattern for molar claps. pack of 100 sheets / 200 clasps , wax pattern for pre molar claps, pack of 10 sheet / 200 claps , wax sprue ( ) 14, 16&18 guage , wax sticky , wedges ( wooden or plastic ) , weldable round buccal tubes , wheel stone , wide mouth glass bottle with stopper lid ( 125ml, 250ml ) , wide mouth glass bottle with stopper lid ( 500ml ) , wire ss 19 and 21 guage ( 2 kg each ) smith , xylene , zelgan ( alginate imp mat ) , zinc oxide ( approx 100 gm pkt ) , zinc oxide eugenol cement ( filling ) powder & liquid , zinc oxide powder , zinc phosphate cement 90 gms and 30 ml liquid. , tab. ibu profen 200 mg. , tab. ibu profen 400 mg. , cap. amoxicillin 125 mg. , cap. amoxicillin 250 mg. , cap. amoxicillin 500mg. , tab. ranitidine 100 mg. , tab. vitamin b complexwith zinc , tab. carbamezapin 100 mg. , tab. diclofenac sodium 50 mg. , lignocane ointment , lignocane spray , antiseptic lotion , povidon iodine solution5% , normal saline , sodium hypochloride 3% , 5% , povidon iodine ointment , inj. adernaline , inj. decadron , inj. hemolok , inj. avil , formaline tablets , distill water , tab. diclofanac + paracetamol , tab. pantoprazole 40 mg. , tab. fluconozole , tab. metronidazole 200 mg. , tab. metronidazole 400 mg. , tab. amoxicillin + clavaulanic acid 375 mg. , tab. amoxicillin + clavaulanic acid 625 mg. , inj. lignocane 2%with adernaline 1:80000 , tab. ofloxacin + ornidazole , triple antibiotic paste for endodontic treatment...

National Thermal Power Corporation Limited - Madhya Pradesh

31484531 procurement of fine chemicals and standards for ntpc rihand, vindhyachal and singrauli procurement of fine chemicals and standards for ntpc rihand, vindhyachal and singrauli , benzoic acid blisters:thermochemical , acids:nitric acid ar : ( gr ) , oxalic acid ( ar ) , xylene;rectified. , hexane , hydrochloric acid conc. ar / gr , methanol analytical ( ar ) , memrane filter, cellulose nitrate, 47 mm , chmcl:ferrous ammonium sulphate , manganous sulphate gr grade , potassium hydroxide ar / gr / excelar , sodium hydroxide standard:1n in ampoule , reagent: kf appln water standard , hydrochloric acid n / 1 cvs pack 6 ampules , acid:oxalic acid:ar / er / emparta grade , ion chromatograph:7 anion standard , universal indicator solution ph 4 to 11 , chmcl:ortho toludine , sodium molybdate , chmcl; sodium metabisulphite , chmcl:sodium iodide :gr , chemical lab ar sodium chloride , n ( 1 napthyl ) ethylene diamine neda , hexane , sulphuric acid: ( ar / gr / excelr ) , petroleum ether 60 80 deg. c , eriochrome black t, ar , patton and readers reagent; indicator , phenolphthalein indicator powder , phosphate std soln1000mg / l ar / gr / excelar , chloride standard solution 100 ppm , std soln. copper 1000ppm:nist , silica standard : ( ar ) , ammonium molybdate ar / gr / excellar , chmcl:nh3 solution gr:gr , ammonium acetate gr , chmcl:ammonium chloride , ammonium ferric sulphate , chmcl:ammonium oxalate , barium perchlorate ar / gr / excelar , chmcl:dithiazone , ferroin solution, redox indicator , ferrous ammonium sulphate , cm: glycerin lr :r lab ( lr ) , mercury ( ii ) chloride gr , potassium chloride :argrade , potassium hydrogen phthalate gpr grade , potassium hydroxide pellets ar , potassium nitrate gr / ar / excelar , chmcl:silver nitrate ar:gr , sodium molybdate , chmcl:sodium hydroxide pellets ar:gr , chmcl:sodium sulphite , sodium thiosulphate ar / gr / excellar , stannous chloride , chmcl:thorine indicator: ( lr ) , chmcl:tolune ar:gr , formic acid; ar / gr / excelar grade , acid :oxalic , sulphuric acid ar / gr / excelar analy ( ar ) , methanol analytical ( ar ) , alchohol : ethanol : ( gr ) , chmcl:sodium meta bi sulphate lr:gr , soln:hydrogen peroxide:tr , ammonium molybdate ar / gr / excellar => limited...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

31448072 supply of laboratory chemicals and glasswares 1st call supply of laboratory chemicals and glasswares 1st call ref no. 12 , requirment of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) , iso amyl alcohol for milk testing l.r. , acetonel.r. , acetic acid glaciall.r. , ammonium ferrous sulphatel.r. , ammonia solution about 25% l.r. , ammonium molybdate ( extra pure ) , calcium chloride ( fused ) l.r. , chloroforml.r. , citric acidl.r. , cupric sulphate , cupric acetate ( monohydrate ) , diphenylamine , p dimethylaminobenzaldehyde l.r. , erichrome black t metal ( pm ) indicator , ethylenediaminetetra acetic acid l.r. , ferroin indicator solution , formaldehyde solution ( 39% 41% ) l.r. , glycerol l.r. , hydrochloric acid ( about 40% ) l.r. , iodine crystal , lactic acid min. 88% , manganese sulphate ( monohydrate ) , butylated hydroxy anisole ( b.h.a. ) , mercuric sulphate , mercuric chloride , methylene blue tablet for milk testing , nesslers reagent , oxalic acid l.r. , petroleum ether 400c 600cl.r. , phenolphthalein indicator powder , phenolphthaleinsolution indicator , potassium carbonate , potassium dihydrogen orthophasphate , potassium dichromate l.r. , potassium permagnete ( kmno4 ) , potassium oxalate monohydratel.r. , potassium iodidel.r. , potassium hydrogen phthalate , resorcinol crystal l.r. , sodium azide l.r. , sodium carbonate l.r. , sodium hydrogen carbonate l.r. , sodium hydroxide pellets l.r. , sodium hydroxide n / 10 ampule , silver nitrate l.r. , silver sulphate l.r. , starch soluble , sodium sulphate anhydrous , sodium thiosulphate pentahydrate , tartaric acid l.r. , tri sodium citrate l.r. , tri sodium citrate , zinc acetate ( dihydrate ) , citric acid ( food grade commercial ) , p nitrophenyl disodium orthophosphate , p nitrophenyl disodium orthophosphate , rosalic acid , xylene , furfuraldehyde , whats man filter paper ( 4 ) no. , whats man filter paper ( 42 ) no. , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sorbate , sulphuric acid about 98% l.r. , voilet red bileagar , potato dextrose agar , plate count agar , ringer salt solution powder , m7hr fc agar , buffer tablets ph 4.0 , buffer tablets ph 7.0 , buffer tablets ph 10.0 , buffer stripsph 2.0 – 10.5 wide range , requirment of laboratory glasswares ( for plant & mccs ) , test tube with rim 15 x 150 mm. , tube culture 16 x 125 mm. , tube culture 16 x 160 mm. , beaker low form graduated with spout 50 ml , beaker low form graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low form graduated with spout 500 ml , beaker low form graduated with spout 1000 ml , bottle, plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petridish 100 x 15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchamgeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , seperating funnel 500 ml , r.m. valve appratus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 100c to 1100c ) in 10c graduation , thermometer alcohol ( 100c to 500c ) in 0.50c graduation , sprit lamp ( alluminium ) , cotton bundle , culture tube ( with rim 10 ml ) ...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

31224548 laboratory chemicals and similary hygiene items tender iiird call, at bundelkhand sahakari dugdh sangh maryadit, sagar laboratory chemicals and similary hygiene items tender iiird call, at bundelkhand sahakari dugdh sangh maryadit, sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

31041665 supply of laboratory chemicals and similary hygiene items tender iind call, at bundelkhand sahakari dugdh sangh maryadit sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Government Auto Ayurved College Gwalior - Madhya Pradesh

30976353 etender for purchase of instruments equipments and other items required in gac and dtl gwalior etender for purchase of instruments equipments and other items required in gac and dtl gwalior , a.instruments / equipments/items required for ayurved college gwalior , half size with steel top or marble top stainless , x ray viewing box or panels , microscopes with oil immersion , westergen’s pipette for esr , haematocrit tube , sahli’s haemoglobinometer , haemocytometer , stop watches as per specification , centrifuge with speed control , colorimeter (photoelectric) , ph comparator with disc , b.p. apparatus , stethoscopes , clinical thermometer , knee hammer , tuning forks , electrocardiograph , netipatra (pital & tamra) , phototherapy unit as per specification , sterilizer 1 , sterilizer 2 , sterilizer3 , radiant warmer , foetoscope , blunt and sharp curettes , dilators set (hegar’s, hawkins) , uterine sound , mtp suction currate , retractors abdominal (doyne’s etc.) , shirodkar uterus holding forceps , green armytage forceps , uterus holding forceps , forceps obstetrics , endotrachial tubes , cord cutting appliances , i.u.c.d. removing hook , nebuliser , binocular microscope , microscope with oil immersion as per specification , monocular microscope with oil emersion lens20(e) , sahli’s square tube , hb pipette , wbc pipette , dropper , red cell pipette , improved neubauer chamber , incubator , wintrobe’s tube , pasteur’s pipette , westregrens pipette , westergrens’s stand , urinometer , cell counter (haemoautoanalyser) , bp apparatus , tongue depressor standard , stop watch , hot air oven , bunsen burner , refrigerator , laryngoscope , probes , syringe needle destroyer , cover slip , litmus paper , ph indicator paper strips , rubber sheat , water bath , multi stix , steriledisposable launer/needle , glass rode , rubber tap , dental chair with unit and all accessories , grand seiko auto referctometer , dissecting microscope , compound microscope ( trinocular microscope) , electronic balance , slides box with cover slips, , filter papers , dissection box , chloroform , alcohol. , hcl , sulphuric acid , sodium hydroxide , potassium hydroxide , benedict solution , sodium nitrate , potassium nitrate , citric acid , iodine , potassium iodide , xylol/pure xylene (slide preparation) , auroscope , bp apparatus standing , oil field radiators , ophthalmoscope , sims’s speculum , tongue depressor 1 , tongue depressor 2 , weight and height measuring stand , electric coutery , radiant warmer as per specification , phototherapy unit , biomeneque unit , sigmoscope flexible , nebuliser as per specification , knee hammer as per specification , khalvayantrasmall , khalvayantrasmall different size , khalvayantrasmall size different , khalvayantramedium , khalvayantra porcelain different size , khalvayantra porcelain , taptakhalva yantra , pounding apparatus (ulukhalayantra) 1 , pounding apparatus (ulukhalayantra) 2 , moosha (crucibles) graphite , moosha (crucibles) g crucible , moosha (crucibles) gracrucible , moosha (crucibles) graphite cru , moosha (crucibles) graphite c , moosha (crucibles) graphite cruci , moosha (crucibles) grap crucible , moosha (crucibles) graphite crucible , koshti with blower as per specification , koshti with blower , distillation apparatus and arkayantra , kupipakva bhatti , physical balance , chemical balance , hot plate , enamel tray different size , enamel tray , pyrometer , steel container different size , steel container , sieves (different size, 125, 250, 180, 300) , sprite lamp , b.instruments / equipments/items required for dtl gwalior , semi micro balance: , digital rotary flash shaker: , muffle furnace: , melting point apparatus: , digital ph meter...

Department Of Heavy Industry - Madhya Pradesh

30969999 bids are invited for boqauto extension if any seller submits price in last 15 minutes, the rawill be auto extended by 15 minutes. ( for anunlimited time ) total quantity : 1 1 hcl, 32% hydrochloric acid ( hcl ) , minimum 32% by mass 2 hno3, 69% nitric acid ( hno3 ) , minimum 69 % by mass 3 nacl, 99.5% sodium chloride, minimum 99.5% by mass 4 chloro benzene chloro benzene, minimum 99% by mass 5 n heptane n heptane, minimum 99% by mass 6 methanol methanol specially dried ( water 0.02% ) , minimum 99.8% by mass 7 acitic acid acetic acid glacial, minimum 99.7% by mass 8 petrolium ether petroleum ether, distillation range 60 80° c, 0.68 gm / ml at 20° c 9 glycerol glycerol, minimum 85% by mass 10 diethyla mine diethylamine, 99% by mass 11 universal indicator universal ph indicatior ( ph range 4 to 11 ) 12 acetone acetone, minimum 99% by mass 13 h2so4 sulphuric acid ( h2so4 ) , minimum 98% by mass 14 toluene toluene, ar grade 15 acetonitrile acetonitrile, ar grade 16 iso propyl alcohol iso propyl alcohol, ar grade 17 xylene xylene, ar grade 18 hcl, 0.1 n hcl ( 0.1 n ) , ampules 19 hcl, 1.0 n hcl ( 1 n ) , ampules 20 naoh, 0.1 n naoh solution ( 0.1 n ) , ampules 21 naoh, 1.0 n naoh solution ( 1 n ) , ampules...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

30858813 supply of laboratory chemicals and similary hygiene items tender, short terms, at bundelkhand sahakari dugdh sangh maryadit, sagar laboratory chemicals and similary hygiene items tender, short terms, at bundelkhand sahakari dugdh sangh maryadit, sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Department Of Defence Research And Development - Madhya Pradesh

30832398 chemicals chemicals ( as per appendix a of rfp ) , chemicals , sodium hypochlorite 6 14% active chlorine 2.5l , hydrochloric acid 37% 500 ml , sulfuric acid greater equal 97% 500ml , xylene anhydrous 1 l , potassium iodide greater equal 99% 100g , sodium dichloroisocyanurate greater equal 99% 500 g , taurine greater equal 99% 100 g , kaolinite neutral 1 kg , bentonite 500g , montmorillonite k 10 1 kg , eriochrome black t 100 g , sodium chloride greater equal 99% 500g , ethylene diamine tetraacetic acid ( edta ) greater equal 99% 500g , buffer reference standard ph 10 ( 20 degree c ) 500ml , buffer reference standard ph 7 ( 20 degree c ) 500ml , buffer reference standard ph 4 ( 20 degree c ) 500ml , zinc standard solution 1 mg / ml 500ml , ammonium chloride greater equal 99.5% 1 kg , ammonia solution 25% 1l => limited...

Madhya Pradesh State Cooperative Dairy Federation Limited - Madhya Pradesh

30593124 supply of laboratory chemicals and similary hygiene items tender, at bundelkhand sahakari dugdh sangh maryadit, sagar laboratory chemicals and similary hygiene items tender, at bundelkhand sahakari dugdh sangh maryadit, sagar , a ) requirement of laboratory chemicals ( for plant & mccs ) , ethanol ( absolute alcohol ) 500ml , iso amyl alcohol for milk testing l.r. 500ml , acetone l.r. 500 ml , acetic acid glacial l.r. 500 ml , ammonium ferrous sulphate l.r. 500 gm , ammonium solution about 25% l.r. 500 ml , ammonium molybdate ( extra pure ) 100 gm , calcium chloride ( fused ) l.r. 500 gm , chlorofrom l.r. 500 ml , citric acid l.r. 500 gm , cupric sulphate 500gm , cupric acetate ( monohydrate ) 500 gm , diphenylamine 250 gm , p dimethylaminobenzaldehyde l.r. 100 gm , erichrome black t metal ( pm ) indicator 25 gm , ethylenediamine tetra acetic acid l.r. 100 gm , ferroin indicator solution 500 ml , formaldehyde solution ( 39% 41% ) l.r. 5 ltr , glycerol l.r. 500 ml , hydrochloric acid ( about 40% ) l.r. 500ml , iodine crystal 100 gm , lactic acid min.88% 500 ml , manganese sulphate ( manohydrate ) 500 gm , butylated hydroxy anisole ( b.h.a. ) 1 kg , mercuric sulphate 200 gm , mercuric chloride 250 gm , methylene blue tablet for milk testing50 tab ( 1 bottle ) , nesslers reagent 100 ml , oxalic acid l.r. 500 gm , petroleum ether 40 c 60c l.r. 2.5 ltr , phenolphthalein indicator powder 100 gm , phenolphthalein soluction indicator 125 ml , potassium carbonate 500 gm , potassium dihydrogen orthophosphate 500 gm , potassium dichromate l.r. 500gm , potassium permangnate ( kmno4 ) 500 gm , potassium oxalate monohydrate l.r. 500 gm , potassium iodide l.r. 100 gm , potassium hydrogen phthalate 500 gm , resorcinol crystal l.r. 250 gm1 , sodium azide l.r. 100 gm , sodium carbonate l.r. 500 gm , sodium hydrogen carbonate l.r. 500 gm , sodium hydrogen pellets l.r. 500 gm , sodium hydroxide n / 10 ampule 1 ampule , silver nitrate l.r. 100 gm , silver sulphate l.r. 25 gm , starch soluble 500 gm , sodium sulphate anhydrous 500 gm , sodium thiosulphate pentahydrate 500 gm , tartaric acid l.r. 500 gm , tri sodium citrate l.r.500 gm , tri sodium citrate 5 kg , zinc acetate ( dihydrate ) 500 gm , citric acid ( food grade commercial ) 50 kg , p nitrophenyl disodium orthophosphate 25 gm , rosalic acid 25 gm , xylene 500 ml , fur furaldehyde 500 ml , whats man filter paper ( 4 ) no. 1 pkt , whats man filter paper ( 42 ) no. 1 pkt , membrane nylon pore size 0.45 micron dia 47 mm. , potassium sobate 5 kg , sulphuric acid about 98% l.r.500 ml , violet red bile agar 500 gm , potato dextrose agar 500 gm , plate count agar 500 gm , ringer salt solution powder100 gm , m7hrfc agar 500 gm , buffer tablets ph 4.0 ( 10 tablet each bottle ) , buffer tablets ph 7.0 ( 10 tablet ) , buffer tablets ph 10.0 ( 10 tablets ) , buffer stips ph 2.0 10.5 wide range ( 10 pkts ) , distilled water ( 5 liter ) , potassium hydroxide ( 500 gm ) 1 , barium hydroxide solution ( 0.1n ) 500 gm , furfural solution 2% ( 500gm ) , total hardness kit ( range 5 10 & 25 500ppm ) 1 kit , ammonium chloride ( 500gm ) , edta disodium salt ( dihydrate ) 500gm , requirement of laboratory glasswares ( for plant & mccs ) , test tube with rim 15x150 mm. , tube culture 16x125 mm. , tube culture 16x160 mm. , beaker low from graduated with spout 50 ml , beaker low from graduated with spout 100 ml , beaker low form graduated with spout 150 ml , beaker low form graduated with spout 250 ml , beaker low from graduated with spout 500 ml , beaker low form graduated withy spout 1000 ml , bottle plain with screw cap and liner 125 ml , conical flask 100 ml , flask erlenmeyer narrow mouth 150 ml , flask erlenmeyer narrow mouth 250 ml , flask erlenmeyer narrow mouth 500 ml , flask erlenmeyer narrow mouth 1000 ml , petri dish 100x15 mm , pipette 1.1 ml , pipette 2.2 ml , pipette 5 ml graduated 1 / 20 , pipette 10 ml graduated 1 / 10 , milk pipette 10.75 ml , measuring cylinder 10 ml , measuring cylinder 50 ml , measuring cylinder 100 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , measuring cylinder 1000 ml , measuring cylinder 100 ml with interchangeable stopper graduated , volumetric flask 50 ml , volumetric flask 100 ml , volumetric flask 250 ml , volumetric flask 500 ml , separating funnel 500 ml , r.m. valve apparatus 300 ml complete set for fat testing , flask volumetric sugar estimation 100 / 110 ml , funnel glass 12 cm , funnel glass 6 cm , test tube stand plastic for 12 test tube , test tube stand plastic for 24 test tube , thermometer alcohol ( 10oc to 110oc ) in 1oc , thermometer alcohol ( 10oc to 50oc ) in 0.5oc , sprit lamp ( aluminum ) , cotton bundle , culture tube ( with rim 10 ml ) , still head ( rm ) , condenser ( rm ) , glass rod , burette stand , polansky flask 310 ml ( rm ) , requirement of sanitary & heegner items ( for plant & lab ) , sanitizer 5 liter , disposal gloves , disposal mask , disposal hair cap , disposable apron...

Government Medical College - Madhya Pradesh

30306150 supply of lab reagents and consumables supply of lab reagents and consumables , glass slide ( microscope glass slides ( pack of 50 slides ) 75 x 25 x 1.4 mm in one carton ) , cover silp for haemocytometet 20mm×26mm×0.4mm ( 10 gm pkt in one box ) , gloves 6 .5 inch ( 100 pieces in one box ) , gloves 6 inch and 7 inch ( 100 pieces in one box ) , gloves 7 inch ( 100 pieces in one box ) , gloves7.5 inch ( 100 pieces in one box ) , syringe 5ml ( 1packet ×100 ) , syringe 10ml ( 1 packet ×100 ) , syringe 20ml ( 1 packet ×100 ) , aluminum tray for holding atleast 20 slides of25 x 75mm ( 1 x 3 ) microscope slides ( 1 ) , coplin jars allow for complete submersion of slides when staining with grooves || each staining jar features 4 grooves to separate each slide each groove allows for 2 slides to be placed back to back of size slides ( 75 x 26 x 1.3mm ) ( 1 ) , plastic test tube stand, capacity: 12 tubes ( 1 ) , plastic test tube stand, capacity: 18 tubes ( 1 ) , wooden, t est tube holder, ( 1 ) , stainless steel alcohol burner spirit lamp lab tubler ( 1 ) , tourniquet belt 20 inch 1 inch ( 1 ) , litmus paper litmus paper ph test strips, full range 0 14, red, blue, acid / base indicators ( 1 pack 8.6 x 6.4 x 0.8 cm; 40 grams ) , slide storage cabinets with lock ( capacity for 50000slides ) ?specifications for keeping 75x25mm slides made of crc steel. ( 50, 000 / 160 drawers ) capacity . keeps slide in vertical position with easily removable racks price appx 1.6 lacs ) ( 1 ) , block storage cabinets with lock ( capacity for 50000 blocks ) sp for keeping embedded blocks . cantains duly powder coated trays designed to keep blocks one after other in rows . each tray accommodating the block will be easily removable . ( ysi 165 by yorko price 4.0 lacs ) ( 1 ) , staining troughsof glass toholdsminimum 20 x slides ( 1 ) , bone saw with 16 inch stainless steel blade ( 1 ) , premium quality stainless steel dissection kit set with tools ( 1 ) , low density polyethylene made wash bottles ( 500 ml ) ( 1 ) , stainless steel biopsy sternal puncture needle with guardno 16 ( nos ) , stainless steel biopsy sternal puncture needle with guardno 14 ( nos ) , museum jarsmallleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 5x5x5 inches ( 1 ) , museum jar mediumleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 6x6x4 inches ( 1 ) , museum jar largeleak proof acrylic jar with lid and acrylic sheets for mounting the specimen 9x9x5 inches ( 1 ) , esrwintrobe tube ( 1 pack of 10 tubes ) , esrwintrobe tube stand holding 6 tubes ( 1 ) , waestergren tube esr pipette westergren graduated ( 1 ) , esr westergren stand steel holding 6 tubes ( 1 ) , disposable plastic dropper 5 ml ( 1 pkt 1000 dropper ) , brain knife ( 1 ) , edta vacutainers ( i pkt 100 containers ) , edta solution ( 500 ml ) , pt vacutainer ( i pkt 100 containers ) , 3.8% sodium citrate solution ( 500 ml ) , anti abd kit blood grouping kit 5 ml , urine strip protein / sugar ( 1 bottle 100 strips ) , urine strip 10 prameters ( 1 bottle 100 strips ) , whatman filer paper ( cicular ) grade ( 100 circles per box ) , capillary tube for clotting time 0.5x75 mm ( non heparinised ) ( 1 pack ) , tissue blotting paper 46 x 58 centimeters ( 1 rim ) , tissue paper , cotton roll ( 1 roll500gm ) , white absorbent gauze than, bandage size: 100cm, 120cm1m to 36m ( 1 than ) , urine container ( 1 pkt 50 ) , afb staining kit ( 1 kit 3x100 ml ) , chlorhexidine 0.5% hand rub ( 500 ml ×25 ) , afb staining kit 3x100 ml ( r 1 125 ml ) , afb staining kit 3x100 ml ( r 2 125 ml ) , afb staining kit 3x100 ml ( r 3 125 ml ) , india ink ( 100 ml bottle ) , methanol ( 1 ltr. ar ) , formaldehyde 40% ( 5 lit ) , thymol crystal ( 100 gm / pack ) , xylene ( 2.5 litre bottle ) , paraffin wax ( meelting point 58 60degree ) pellets ( 500 gm / pack ) , harris hematoxylene stain ready to use ( 125 ml / bottle ) , hematoxylene stain powder ( 250 gm / pack ) , eosin stain ( 125 ml / pack ) , ready to use retic stain ( 25 ml / pack ) , leishman stain ( 500 ml / pack ) , ethyl alcohol ( 500 ml / pack ) , glacial acetic acid ( 500 ml / bottle ) , dpx ( 250ml / bottle ) , potassium iodate ( 100 gm / pack ) , sodiumiodate ( 100 gm / pack ) , potassium alum ( 100 gm / pack ) , chloral hydrate ( 100 gm / pack ) , n / 10 hydrochloric acid ( 500 ml / bottle ) , lugol’s iodine ( 100 ml bottle ) , liquid hand wash solution ( 5 litre ) , semen diluting fluid ( 100 ml / bottle ) , fouchets reagent ( 500 ml / bottle ) , liquidammonia ( 500 ml / bottle ) , methyleneblue ( 100 ml / bottle ) , rbc dilution fluid ( 500 ml / bottle ) , rectified spirit ( 5 litre / can ) , 3% acetic acid ( 500 ml / bottle ) , 3 5% sulfosalicylic acid ( 500 ml / bottle ) , benedicts reagents ready tu use ( 500 ml / bottle ) , ammonium sulphate ( 500 gm / pack ) , sodium nitroprusside ( 100 gm / pack ) , conc nitric acid ( 500 ml ) , 10% barium chloride solution ( 500 ml / pack ) , sulphur granules ( 500 gm / pack ) , wbc diluting fluid ( 500 ml / pack ) , rapid giemsastain ( 250 test / pack ) , rapid pap stain kits ( 250 test / kit ) , sulphuric acid ( 500 ml / kit ) , potassium ferricyanide ( 500gm / pack ) , potassium frerrocyanide ( 500gm / pack ) , sodium dihydrogen orthophosphate ( monohydrate ) ( 1kg / pack ) , disodium hydrogen orthophosphate ( anhydrous ) ( 1kg / pack ) , csf diluting fluid 100 ml ( 100 125 ml / bottle ) , disposable tipsblue tips 1000 ul ( 1000 / pack ) , disposable tipsyellowtips 10 100 ul ( 1000 / pack ) , picric acid500 gm ( 500 gm / pack ) , toludine blue 100 gm ( 100gm / pack ) , blood collection needles vacuum with safety shield and pre attached holder 22g , 1.25” inches ( 32 mm ) needle, pack of 100 ( 1 pack of 100 ) , disposable neddles23 g ( 1 pack of 100 needles ) , disposable needles 21 g ( 1 pack of 100 nedles ) , urine pregnancy strips ( 1 packof 10 strips ) , sterile sample containers plastic container ( 30ml capacity ) wide open mouth, individually packed. ( 1 pack 50 ) , cotton ( 1 roll500gm ) , gram stain kit ( crystal violet ) ( r 1 125 ml ) , gram stain kit ( grams iodine ) ( r 2 125 ml ) , gram stain kit decolgar zar ( acetone / alchol ) ( r 3 125 ml ) , gram stain kit ( safranin ) ( r 4 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 1 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 2 125 ml ) , afb staining kit 3x100 ml ( carbol fuchsin 20% sulphuric acid methylene blue ) ( r 3 125 ml ) , india ink ( 100 ml bottle ) , albert stain kit ( stain a ) ( r 1 500 ml ) , albert stain kit ( stain b ) ( r 2 500 ml ) , lectophenol cotton blue ( 1ltr. ) , lugols iodine ( 1ltr. ) , nacl crystal ( 1 kg ) , methanol ( 1 ltr. ) , surgical spirit ( 1 ltr. ) , melachite green ( 1 ltr. ) , nigrosine ( 1 ltr. ) , h2so4 ( 1 ltr. ) , kmno4 crystal ( 1 kg ) , iodine ( 1 ltr. ) , hydrogen peroxide ( 1 ltr. ) , oxidase reagent ( tetramethyl p phenylenediaminedihydochloride ) / oxidase disk ( himedia ) ( 100 disk / vial ) , rabbit plasma ( 0.1 gm / vial ) , kovac’s reagent or ehrlich reagent ( para dimethyl amino benzaldehyde ) ( 100 ml / bottle ) , potassium nitrate ( kno3 ) ( 100 ml / bottle ) , sodium deoxycholate ( 10 ml / bottle ) , bacitracin disk ( 100 disk / vial ) , potassium iodide ( 500 gm ) , potassium hydroxide ( 100 gm / bottle ) , antisera salmonella , antisera shigella dysenteriae ( 1 kit ) , antisera shigella flexneri ( 1 kit ) , antisera shigella sonnei ( 1 kit ) , antisera shigella boydii ( 1 kit ) , antisera vibrio cholera ( 1 kit ) , atcc strain e. faecalis 29213 ( 1 kit ) , atcc strain e. coli 25922 ( 1 kit ) , atcc strain e. coli 35218 ( 1 kit ) , atcc strain p. aeruginosa 27853 ( 1 kit ) , atcc strain s. aureus 25923 ( 1 kit ) , atcc strain s. aureus 29213 ( 1 kit ) , wide mouth sterile / universal container , disposable syringe ( 5 ml ) ( nos ) , disposable syringe ( 10 ml ) ( nos ) , disposable syringe ( 3 ml ) ( nos ) , wooden applicator standard size ( nos ) , spatula ( standaed ) ( nos ) , inoculation loop and wire 2 mm ( nos ) , inoculation loop and wire4 mm ( nos ) , conical flask ( 100 ml ) ( nos ) , conical flask ( 250 ml ) ( nos ) , conical flask ( 500 ml ) ( nos ) , conical flask ( 1000 ml ) ( nos ) , measuring cylinder ( 50 ml ) ( nos ) , measuring cylinder ( 100 ml ) ( nos ) , measuring cylinder ( 1000 ml ) ( nos ) , beaker ( 50 ml ) ( nos ) , beaker ( 100 ml ) ( nos ) , beaker ( 250 ml ) ( nos ) , beaker ( 500 ml ) ( nos ) , test tube ( 5ml ) ( nos ) , test tube ( 10ml ) ( nos ) , test tube ( 20ml ) ( nos ) , test tube holder standard size ( nos ) , test tube rack ( 5ml ) ( nos ) , test tube rack ( 10 ml ) ( nos ) , test tube rack ( 20 ml ) ( nos ) , staining stand ( nos ) , slide box ( nos ) , petri dish ( 90 mm ) size 90 x 15 mm ( nos ) , petri dish ( 120 mm ) size 90 x 15 mm ( nos ) , cavity slide ( 100 slide / box ) , cover slip ( 100 per / box ) , wash bottles ( 500 ml ) ( 500 ml volume ) , tissue paper roll ( nos ) , staining rack ( nos ) , cotton thread for spirit lamp ( nos ) , blood culture bottles ( 100 ml ) bio merieux closed system ( aerobobic paediatric anaerobic ) ( 100 ml / bottle ) , spirit lamp , bacteriological peptone ( 100 gm / bottle ) , beef extract ( 100 gm / pack ) , yeast extract ( 100 gm / pack ) , malt extract ( 500 gm / bottle ) , nutrient agar ( 500 gm / bottle ) , blood agar base ( 500 gm / bottle ) , cled agar ( 500 gm / bottle ) , macconkey agar ( 500 gm / bottle ) , agar agar ( 500 gm / bottle ) , robertson cooked meat broth ( 500 gm / bottle ) , bile salt agar ( 500 gm / bottle ) , tcbs ( 500 gm / bottle ) , bile aesculin agar ( 500 gm / bottle ) , brain heart infusion broth ( 500 gm / bottle ) , mueller hinton agar ( 500 gm / bottle ) , pikes media ( h. inf. ) ( 500 gm / bottle ) , plet media ( b. anthracis ) ( 500 gm / bottle ) , pnf medium ( s. pyogenes ) ( 500 gm / bottle ) , l j medium ( 10 pcs / bottle ) , l j medium ( 50 pcs / bottle ) , l j medium ( 100 pcs / bottle ) , sda ( 500 gm / bottle ) , bile salt agar ( 500 gm / bottle ) , ss agar ( 500 gm / bottle ) , sorbotolmacconkey agar ( ehec ) ( 500 gm / bottle ) , tetrathionate broth ( 100 gm / bottle ) , selenite f broth ( 100 gm / bottle ) , stuart transport medium ( 100 gm / bottle ) , thayer martin medium ( 100 gm / bottle ) , triple sugar iron agar ( 50 gm / bottle ) , sim medium ( 100 gm / bottle ) , simmon’s citrate agar ( 100 gm / bottle ) , christensen urea agar ( 100 gm / bottle ) , dca ( 100 gm / bottle ) , pre reduced anaerobically sterilized media ( 100 gm / bottle ) , mannitol salt agar ( 100 gm / bottle ) , xld agar ( 100 gm / bottle ) , wilson blair brilliant green bismuth sulphite agar ( 100 gm / bottle ) , hoyle’s tellurite lysed blood agar ( 100 gm / bottle ) , mrvp broth ( 100 gm / bottle ) , glucose ( 100 gm / bottle ) , sucrose ( 100 gm / bottle ) , lactose` ( 100 gm / bottle ) , maltose ( 100 gm / bottle ) , mannitol ( 100 gm / bottle ) , inulin ( 100 gm / bottle ) , amikacin 30?g ( 50 disk / vial ) , amikacin 30?g ( 100 disk / vial ) , amoxicillin 25 ?g ( 50 disk / vial ) , amoxicillin 25 ?g ( 100 disk / vial ) , ampicillin / cloxacillin10 ?g ( 50 disk / vial ) , ampicillin / cloxacillin10 ?g ( 100 disk / vial ) , amoxicillin + clavulanic acid20+10 ?g ( 50 disk / vial ) , amoxicillin + clavulanic acid20+10 ?g ( 100 disk / vial ) , ampicillin +salbactam 10+10 ?g ( 50 disk / vial ) , ampicillin +salbactam 10+10 ?g ( 100 disk / vial ) , azithromycin 15 ?g ( 50 disk / vial ) , azithromycin 15 ?g ( 100 disk / vial ) , aztreonam 30 ?g ( 50 disk / vial ) , aztreonam 30 ?g ( 100 disk / vial ) , bacitracin 130 ?g / ?l ( 50 disk / vial ) , bacitracin 130 ?g / ?l ( 100 disk / vial ) , carbenicillin100 ?g ( 50 disk / vial ) , carbenicillin100 ?g ( 100 disk / vial ) , cefaclor30 ?g ( 50 disk / vial ) , cefaclor30 ?g ( 100 disk / vial ) , cefalexin30 ?g ( 50 disk / vial ) , cefalexin30 ?g ( 100 disk / vial ) , cefazolin30 ?g ( 50 disk / vial ) , cefazolin30 ?g ( 100 disk / vial ) , cefepime30 ?g ( 50 disk / vial ) , cefepime30 ?g ( 100 disk / vial ) , cefixime 5 ?g ( 50 disk / vial ) , cefixime 5 ?g ( 100 disk / vial ) , cefoperazone 75 ?g ( 50 disk / vial ) , cefoperazone 75 ?g ( 100 disk / vial ) , cefoparazone+ salbactam75+30 ?g ( 50 disk / vial ) , cefoparazone+ salbactam75+30 ?g ( 100 disk / vial ) , cefotaxime30 ?g ( 50 disk / vial ) , cefotaxime30 ?g ( 100 disk / vial ) , cefotetan 30 ?g ( 50 disk / vial ) , cefotetan 30 ?g ( 100 disk / vial ) , cefoxitin30 ?g ( 50 disk / vial ) , cefoxitin30 ?g ( 100 disk / vial ) , cefpirome30 ?g ( 50 disk / vial ) , cefpirome30 ?g ( 100 disk / vial ) , cefpodoxime10 ?g ( 50 disk / vial ) , cefpodoxime10 ?g ( 100 disk / vial ) , ceftazidime30 ?g ( 50 disk / vial ) , ceftazidime30 ?g ( 100 disk / vial ) , ceftriaxone30 ?g ( 50 disk / vial ) , ceftriaxone30 ?g ( 100 disk / vial ) , cefuroxime30 ?g ( 50 disk / vial ) , cefuroxime30 ?g ( 100 disk / vial ) , cephalotin30 ?g ( 50 disk / vial ) , cephalotin30 ?g ( 100 disk / vial ) , chloramphenicol 30 ?g ( 50 disk / vial ) , chloramphenicol 30 ?g ( 100 disk / vial ) , ciprofloxacin5 ?g ( 50 disk / vial ) , ciprofloxacin5 ?g ( 100 disk / vial ) , clarithromycin15 ?g ( 50 disk / vial ) , clarithromycin15 ?g ( 100 disk / vial ) , clindamycin2 ?g ( 50 disk / vial ) , clindamycin2 ?g ( 100 disk / vial ) , colistin 10 ?g ( 50 disk / vial ) , colistin 10 ?g ( 100 disk / vial ) , doripenem10 ?g ( 50 disk / vial ) , doripenem10 ?g ( 100 disk / vial ) , doripenem30 ?g ( 50 disk / vial ) , doripenem30 ?g ( 100 disk / vial ) , ertapenem10 ?g ( 50 disk / vial ) , ertapenem10 ?g ( 100 disk / vial ) , erythromycine15 ?g ( 50 disk / vial ) , erythromycine15 ?g ( 100 disk / vial ) , fosfomycin 200 ?g ( 50 disk / vial ) , fosfomycin 200 ?g ( 100 disk / vial ) , gentamicin 10 ?g ( 50 disk / vial ) , gentamicin 10 ?g ( 100 disk / vial ) , gentamicin ( high load ) 120 ?g ( 50 disk / vial ) , gentamicin ( high load ) 120 ?g ( 100 disk / vial ) , imipenem10 ?g ( 50 disk / vial ) , imipenem10 ?g ( 100 disk / vial ) , kanamycin30 ?g ( 50 disk / vial ) , kanamycin30 ?g ( 100 disk / vial ) , levofloxacin5 ?g ( 50 disk / vial ) , levofloxacin5 ?g ( 100 disk / vial ) , lincomycin15 ?g ( 50 disk / vial ) , lincomycin15 ?g ( 100 disk / vial ) , linezolid30 ?g ( 50 disk / vial ) , linezolid30 ?g ( 100 disk / vial ) , meropenem10 ?g ( 50 disk / vial ) , meropenem10 ?g ( 100 disk / vial ) , moxifloxacin5 ?g ( 50 disk / vial ) , moxifloxacin5 ?g ( 100 disk / vial ) , nalidixic acid30 ?g ( 50 disk / vial ) , nalidixic acid30 ?g ( 100 disk / vial ) , netilmicin 30 ?g ( 50 disk / vial ) , netilmicin 30 ?g ( 100 disk / vial ) , nitrofurantoin300 ?g ( 50 disk / vial ) , nitrofurantoin300 ?g ( 100 disk / vial ) , norfloxacin 10 ?g ( 50 disk / vial ) , norfloxacin 10 ?g ( 100 disk / vial ) , ofloxacin 5 ?g ( 50 disk / vial ) , ofloxacin 5 ?g ( 100 disk / vial ) , oxacillin1 ?g ( 50 disk / vial ) , oxacillin1 ?g ( 100 disk / vial ) , penicillin6 ?g / 10iu ( 50 disk / vial ) , penicillin6 ?g / 10iu ( 100 disk / vial ) , piperacillin100 ?g ( 50 disk / vial ) , piperacillin100 ?g ( 100 disk / vial ) , piperacillin+tazobactam100+10 ?g ( 50 disk / vial ) , piperacillin+tazobactam100+10 ?g ( 100 disk / vial ) , polymixin50 ?g / 300 ui ( 50 disk / vial ) , polymixin50 ?g / 300 ui ( 100 disk / vial ) , quinupristin dalfopristin15 ?g ( 50 disk / vial ) , quinupristin dalfopristin15 ?g ( 100 disk / vial ) , rifampicin5 ?g ( 50 disk / vial ) , rifampicin5 ?g ( 100 disk / vial ) , spectinomycin 100 ?g ( 50 disk / vial ) , spectinomycin 100 ?g ( 100 disk / vial ) , streptomycin10 ?g ( 50 disk / vial ) , streptomycin10 ?g ( 100 disk / vial ) , streptomycin ( high load ) 300 ?g ( 50 disk / vial ) , streptomycin ( high load ) 300 ?g ( 100 disk / vial ) , teicoplanin 30 ?g ( 50 disk / vial ) , teicoplanin 30 ?g ( 100 disk / vial ) , tetracycline 30 ?g ( 50 disk / vial ) , tetracycline 30 ?g ( 100 disk / vial ) , ticarcillin75 ?g ( 50 disk / vial ) , ticarcillin75 ?g ( 100 disk / vial ) , ticarcillin+clavulanic acid 75+10 ?g ( 50 disk / vial ) , ticarcillin+clavulanic acid 75+10 ?g ( 100 disk / vial ) , tigecycline15 ?g ( 50 disk / vial ) , tigecycline15 ?g ( 100 disk / vial ) , tobramycin10 ?g ( 50 disk / vial ) , tobramycin10 ?g ( 100 disk / vial ) , trimethoprim+sulfamethoxazole1.25+23.75 ?g ( 50 disk / vial ) , trimethoprim+sulfamethoxazole1.25+23.75 ?g ( 100 disk / vial ) , trimethoprim5 ?g ( 50 disk / vial ) , trimethoprim5 ?g ( 100 disk / vial ) , vancomycin 30 ?g ( 50 disk / vial ) , vancomycin 30 ?g ( 100 disk / vial ) , polymyxin b ( 50 disk / vial ) , polymyxin b ( 100 disk / vial ) , optochine disc ( 50 disk / vial ) , optochine disc ( 100 disk / vial ) , cedar wood oil ( 100 ml / bottle ) , absolute spirit ( 500 ml / bottle ) , serum glucose ( god / pod enzymatic end point ) ( 1×500 ml ) , serum urea ( urease / gldh ) ( 10×50 ml ) , serum creatinine ( enzymatic pap method ) ( 1×100 ml ) , serum total protein ( biuret method ) ( 1×50 ml ) , serum albumin ( bcg ene point ) ( 3×50 ml ) , serum bilirubin ( diazo method ) ( 4×40 ml ) , sgot ( kinetic ) ( 5×50 ml ) , sgpt ( kinetic ) ( 5×50 ml ) , alp ( kinetic ) ( 5×50 ml ) , ggt ( glupa c kinetic ) , serum amylase ( direct substrate kinetic method ) ( 2×20 ml ) , serum lipase ( turbidometric uv method ( 2×20 ml ) , total cholesterol ( chod / pod method ) ( 2×20 ml ) , triglycerides ( gpo / pod method ) ( 2×20 ml ) , serum calcium ( ocpc method ) ( 2×20 ml ) , serum phosphorous ( uv molybdate methed ) ( 2×20 ml ) , crp ( quantitative ) ( 1×50 ml ) , serum uric acid ( uricase ) ( 2×10 ml ) , serum ldh ( kinetic ) ( 1×25 ml ) , ck mb ( kinetic ) ( 1×25 ml ) , plain vials ( 5000 nos ) , fluoride vials ( 5000 nos ) , lab detergent liquid ( lab detergent ) ( 5 ltr ) , sta lia test d dimer ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×6ml ) , sta lia test control ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 12×2×1 ) , sta desorb u ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 24×15ml ) , sta coagulation control ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 12×2×1 ) , sta neo optimal ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×5ml ) , sta cleaner solution ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 6×2500ml ) , sta owren koller ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) ( 25×15ml ) , cuvette for alliquote ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) , sta compact cuvette ( for automated coagulation analyzer modal : sta compact max 3 make: diagnostica stago s.a.s ) , aspen 68 ds diluentmodal : bc6800 ( for five part fully automated cell counter ) , aspen 68 ld lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fd dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen 68 lb lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 lh lyse modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 dr diluentmodal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fr dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen 68 ln lys modal : bc6800 ( for five part fully automated cell counter ) ( 1×1 l ) , aspen 68 fn dye modal : bc6800 ( for five part fully automated cell counter ) ( 1×12 ml ) , aspen bc 6 d control set modal : bc6800 ( for five part fully automated cell counter ) ( 6×4.5 ml ( 2l, 2n, 2h ) , aspen bc ret control set modal : bc6800 ( for five part fully automated cell counter ) ( 6×4.5 ml ( 2l, 2n, 2h ) , aspen sc cal plus calibratormodal : bc6800 ( for five part fully automated cell counter ) ( 2×3 ml ) , ldl ( direct ) ( 1×40ml ) , cba reagent ( dilute+lyse ) , hdl ( pvs / pegme direct ) ( 1×40ml ) , 40 % urea solution ( 5 ml / vial ) ...

Government Medical College - Madhya Pradesh

30268661 supply of medicine supply of medicine , injection, tablet, capsul, cream, oint, eye drop, syp, solution, ointment, iv fluid, power, gel, spary, inhaler, etc , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , actinomycin 0.5 mg inj , acycloir 250 mg inj , acycloir 500 mg inj , acycloir 750 mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , vial , anti hemophillic factor viii 500 iu ( vial ) , vial , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 500mg / ml 50ml vial ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml amp , azithromycin 100mg / 5ml inj , azithromycin 200mg / 5ml inj , bendamustin 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulphan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10%10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , calcium leucovorin ( folinic acid ) 50 mg / vial 5 ml vial , carboplatin 150 mg inj vial , carboplatin 450 mg injvial , carboprost promithamin 250 mcg / ml 1ml amp , carmustin 100 mg inj vial , carmustine ( bcnu ) 100 mg vial , cefaparazone with salbactum , cefazoline 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +1000 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 100mg vial , cetuximab 200mg / 100ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection , clopixol acuphase 50 mg inj , clopixol deconate 200 mg inj , collistimate sod. 1iuvial , collistimate sod. 2iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , dacarbazine 500 mginj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone 4mg vial , dexamethasone 4mg / 1mlinj , dexmedetomidine100 mg / ml amp ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diazepam 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lypholozed ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edavarane60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj amp , enoxaparin 60mg inj amp , ephedrine 30mg / ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4 k inj , erythropoietin 10000iu inj 1ml pfs , erythropoietin 40000iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , ethamsylate 125 mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fluanxol depot 25 mg inj , fludarabin 50 mg vial , fluorescein 20% 5 ml amp , flupenthioxl 20 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu ( reptilase ) botropose inj , haloperidol 5 mg / iv / im inj , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium , hydroxy progesterone caproate 250mg / ml vial , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosphamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , iohexol 350 mg i / ml ( non ionic contrast medium in sterile , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia , lignocaine hydrochloride + adrenaline , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lmwh low molecular weight heparin 40mg vial , lmwh low molecular weight heparin 60mg vial , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , metaclopromide 5mg / ml 2ml amp , methacarbamol 100 mg. / 10ml vial , methotrexate 15 ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2mlamp , micronized progesterone 200 ml vial , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 10mg / 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine supaphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nabpaclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , nekethamide amp , neostigmine 0.5 mg / ml, 1ml amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 ml 5 ml amp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olenzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , perinorm 2ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , prolution depot 250mg inj 1ml amp , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / 20ml vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , ropivacaine 10mg / ml 2.5ml vial , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , sargramostin 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium thiopentone inj 0.5gm powder / vial 20ml vial , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , vial , tecoplanin 400mg vial , terbutalime 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml, 10 ml , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+niacinamide 12 , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin100 mg / 50 ml 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% , dextrose saline ( dns ) , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) , fat emulsion 20% 0.2 ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv , levofloxacin 500 mg / 100 ml 100 ml ffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 ml 100 ml ffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 100 ml / 200mg bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose , total parenteral nutrition 1000 ml with 763 kcal , tpn ( total parenteral nutrition ) including carbohydrate + proteins , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumaro / nicoumalone 2 mg tab , acetazolamide 250 mg tab ( dimox ) , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipne 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atiomoxetin 10 mg tab , atiomoxetin 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen od 20 mg , baclofen od 30 mg , baclofen od 40 mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonameserire 2 mg , blonameserire 4 mg , buprinoprhin 4mg , buprinoprhin 8 mg , bupropion150 mg , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate tab , calcium d3 / 500mg , calithromycin 250 mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine tab. 5mg , ciprofloxacin500 mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , cloimipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine100 mcg , clonidine 100 mg tab , clopidogrel75 mg , clopidogrel aspirin , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , crizotinib 250mg , cyclophosphamide 50 mg tab , deferasirox dispersible 500 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratuioeotudase 10mg , diclofenac 50mg + paracitamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , dosatinib 100mg / 50 mg , doxophylline400 mg , dudrogesterone 10mg , duloxetine 20 mg tab , duloxetine 30 mg tab , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , famutaz 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , flebuxostat 40mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluoxetine 40 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 10mg / 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+10mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , mag. oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mcg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyephendate 10 mg , methyephendate 20 mg , methyephendate 5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 , methyldopa 250 mg tab , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil 100 mg tab , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , , mycophenolate mofetil, 500 mg , n acetylcysteline 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxnide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , pacitane 2mg tab , palbociclib 100 mg , palbociclib 125 mg , palbociclib 75 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , piogliatazone 15 mg tab , piogliatazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubtril plus valsartan , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valporate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin$dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine sodium 100mg , thyroxine sodium 25 mg , thyroxine sodium 50mg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenidyl 2 mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , verapamil40 mg , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.3 mg tab , voriconazole 200 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , doxycycline 100 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , temozolamide 100 mg , temozolamide 250 mg , sildenafil 20mg , vit. e400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , hypersol s ( 5% ) , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution , pilocarpine eye drops 2% , polyvinyle alcohol 1.4% 5 ml , prednisolon eye / drop. , proparacaine , sodium chloride 5% eye drop ( nacl 5% ) , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of , prostaglandin e2 , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethosome valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , mct oil 100ml bottle , lactobacillus, 150 million spores, , arginine sachet 10gm , hmf lactocex plus sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 , antiseptic hospital concentrate contdaining 20% chlorohexidine , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam , formaldehyde ( formalin ) 37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enima , hand wash.sol . ( sol.isoprapanol, propanol, mecetronium, skin care , hydrogen peroxide soln 20% 500 ml bottle , hypo solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant , aluminium hydro gel syp ( antacid ) 100ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 ml , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondenstrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , nasoclear nasal mist spray 20 ml spray , nasoclear nasal gel 15 gm tube , nasoclear nasal wash 3gm kit , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , mouth paint clotrimazole 1%15 ml , absorable cotton roll, net 500gm , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorbable gelatine spangstron ip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , ag ion impregnated central venous double lumen , ag ion impregnated central venous triple lumen , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, , air bed matterses with complete set , airway size 3, 4, 5, 5.5 , airway size 6, 7.5 , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , antimicrobial incise drape 3 m , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps , biopsy gun , bipap mask , biploar forceps cable , bipolar cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set , bone marrow aspiration needles ( 14 ) ( medevolution ltd ) , bone marrow aspiration needles ( 15 ) ( medevolution ltd ) , bone marrow aspiration needles ( 16 ) ( medevolution ltd ) , bone marrow aspiration needles13 g ( medevolution ltd ) , bone marrow biopsy needle , bone wax , bp cuff adult & pead. , camera cover , cannula fixer set , carbolic acid 500 ml , c arm cover , catheter mount adult size , catheter mount peadiatric size , cautery pencil , cautery plate ( reusable ) , central line double luman 16g , central line singal luman , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , chlorhexidine gauze dresssing b.p antiseptic tulle gas dressing , collagen patch 30x30 , colostomy kit , computer radiography x ray film ( fuji ) 10x12 pkt , computer radiography x ray film ( fuji ) 14x17 pkt , computer radiography x ray film ( fuji ) 8x10 pkt , condom catheter , card clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crape bandage 2 , crape bandage 4 , crape bandage 6 , cvc line double lumen polyurethane catheter ( flexon , cvc line triple lumen polyurethane catheter ( flexon material ) with , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dengue card test 100 test kit , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or , disp paper gloves , dispo cap , dispo face mask triple layer ( standard ) , dispo hivfull protecatin kit , dispo. n95 mask , disposable needle 18g ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx1 / 2 , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , distilled water 5 lit. , double lumen peripherally inserted central venous silicon , double lumen peripherally inserted central venous silicon , drap sheeth 120cm x 210cm sterile , ear buds , ecg disposabile electrode , ecg paper ( wax coated ) 50mmx30 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed4 , endotracheal tube cuffed5 , endotracheal tube cuffed 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 9 , endotracheal tube cuffedsize 9.5 , endotracheal tubes plain without cuff size 2, , endotracheal tubes plain without cuff size2.5, , endotracheal tubes plain without cuff size3 , endotracheal tubes plain without cuff size3.5, , endotracheal tubes plain without cuff size 4 , endotracheal tubes plain without cuff size 4.5 , endotracheal tube with secondary lumen for , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination glovesmedium pair , examination glovessmall pair , examination gloves large pair , exchange transfusion catheter with four way adaptor size 4cm, l , extention line 10cm , extention line 50cm , extention line 100cm , extention line 150cm , extention line 200 cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluroscein strips pkt , fogharty cathetor 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley triway no 20 two way , foley urinary catheter size 8 10 pediatrics , gigli saw wire , glass slide , glass tube 125x150 , glucometer strips , gudel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hickman catheter double lumen7.7 no , hickman catheter single lumen4.7 no , hickman catheter single lumen6.6 no , hickman catheter single lumen7.7 no , hme filter , humbeysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain , insulin syringe , intravenous drip set adult size , intravenous drip set pediatric size , iv .regulator set ( control drop set ) , iv cannula size 16 g , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , juglarcatheter 12 fr ( adult ) , juglar catheter 8fr ( pediatric ) , k 90 catheter , kallis pad disposable , liga clip 200, 300, 400 , long length quincke spinal needle for pain management, size – g , lung excersizer , lysol ( cresol with soap solution ) 5ltr jar , mackintosh double colour water proof , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , mesure volume set soft chamber, with bulb latex 110ml , micro drip set with bulb latex , micropore 6” , monopolar coutry wire , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , nebulazation mask ( set ) adult & pediatric , neonatal urine collection and measurement bag , niv mask venti cpap ( large & medium ) , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural , non sterile surgical rubber gloves 7 no. ( pair ) made of natural , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural , o maya large / small , oxygen catheter , oxygen connection for central line , oxygen connection for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , paediatric double lumen polyurethan cvc line, 3 fr, l , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g , paediatric triple lumen polyurethan cvc line with nitinol j guide , paper adhesive plaster microporous surgical tape 2inch x 10mt , paper adhesive plaster microporous surgical tape 3inch x 10mt , paper adhesive plaster microporous surgical tape 4inch x 10mt , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm peadiatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , pt vial / tube ( prothrombin vial / tube ) , radial a catheter , rectified sprit 4.5 ltr. , ryles tube size 10, 12, 14, 16, 18 , schirmer strips , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes. , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , sterilant cold disinfectant for dialysis containing peraetic acid , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile gauze swab / pad packets , sterile hypodermic syringe with needle 03 ml , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 2ml , sterile hypodermic syringe with needle 50ml / 60ml , sterile hypodermic syringe with needle 5ml , sterile luerlock syringe 10 ml , sterile luerlock syringe 5 ml , sterile leurlock syringe 20ml , sterile leurlock syringe 50ml , sterlie gloves isi 6.5 made of natural latex, micro rough finish , sterlie gloves isi size7.5 made of natural latex, micro rough , sterlie gloves isi size8 made of natural latex, micro rough , sterlie gloves isi size 7 made of natural latex, micro rough , sterlie powder free glovessize6.5 made of natural latex, micro , sterlie powder free glovessize7 made of natural latex, micro , sterlie powder free glovessize7.5 made of natural latex, micro , sterlie powder free glovessize8 made of natural latex, micro , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tegaderm ( cvl dressing ) 10 cm*12 cm , tegaderm ( cvl dressing ) 7 cm* 8.5 cm , tegaderm ( samll ) i / v , thermometer , thomas splint , transducer set for invasive b.p. , three way stop cock , tmt paper , tounge depresser , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula paed. , urine collecting bag , urine collecting bag with urometer , urine sugar diagnostic stick , vaccum jar 1000 ml , vaccum jar 2000 ml , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt , x ray films size 12x15 50film per pkt , x ray films size 8x10 50film per pkt , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankar suction catheter ( complit set ) , pacing leads 6 fr , introducer sheath 6fr , pigtail catheter 6 fr ( 150 cm ) , j tip 0.035 mm guidewire , black braided silk eyeless needled suture usp, code 5036 size 2 , black braided silk eyeless needled suture usp, code 5082 size 4 , black braided silk eyeless needled suture usp, code 5333 size 2 , blackbraided silk eyeless needled suture usp, size 5 0 , blackbraided silk eyeless needled suture usp, size 6 0 , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 , braided synthetic absorbable eyeless needled suture usp code , braided synthetic absorbable eyeless needled suture uspbraided , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , braided synthetic absorbable polyglactin 910 eyeless needled , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in , oxidized regenerated cellulose based topical absorbable hemostar , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , oxldlzed regenerated cellulose; rayon fiber with 18% to 21% w / w , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbable eyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbableeyeless needled suture usp, code , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlizedabsorbable polyglycolic acid eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polyamide eyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropyleneeyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized monofilament polypropylene eyeless needled suture , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , sterlized surgical chromic gutsutue eyeless needied usp, code , surgical silk braded ( sutupack ) sterile foilover wrappack code 213 , surgical silk braded ( sutupack ) sterile foilover wrappack code 214 , surgical silk braded ( sutupack ) sterile foilover wrappack code 215 , vicryl 2.0 round body needle , 20g round body cutting needle 1 / 2 circle , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , monofilament glycomer 631* 3 0 75cm, undyed24mm3 / 8 , monofilament glycomer 631* 3 0 75cm, violet22mm1 / 2 , monofilament glycomer 631* 1 , 90cm, violet40mm1 / 2 circle , monofilament glycomer 631* 2 0 , 75cm, violet27mm1 / 2 , monofilament glycomer 631* 0, 90cm, violet40mm1 / 2 circle , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , ( coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 , poliglecaprone 25 undyed with irgcare mp3 0, 3 / 8 circle reverse , polydioxanone lrgacare mp coated 150cm usp1 0 rb ctx, 1 / 2 , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle , 180 absorbablepolyglyconate knotless wound closure device with , 180 absorbablepolyglyconate knotless wound closure device with , 90 glycomer 631knotless wound closure device with , 90 glycomer 631knotless wound closure device with , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and , synthetic absorbable surgical suture , polyglactin 910 with irgacare , synthetic absorbable surgical suture irgacare coated monofilament , absorbable unidirectional barbed device symmetric anchoring , absorbable adhesion barrier in the form of off white knitted fabric , polyster braided polybutylatecodated 1 / 2 circle tapercut double , triclosan antibacterial coated polyglactin 910 with 23 mm needle , protective disk with chg hydrophilic polyurethane absorptive foam , protective disk with chg hydrophilic polyurethane absorptive foam , self gripping polyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , self grippingpolyester monofilament mesh pre cut with pla grips , absorbable intraperitoneal umbilical patch of polyester mesh with , absorbable intraperitoneal umbilical patch of polyester mesh with , ada kit , aluminium ammonium sulphate powder 500gm , ana 96 well , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera , anti ab sera , anti a lactin , anti b sera , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , diagnostic strip for urine ( sugar and albumin ) , diamond pencil , dpx mount 250ml ( urgent ) , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , glass slide iso mark no 12mm , haematoxylene 5gm ( urgent ) , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , m .p elisa , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , mp antigen test kit rapid , n / 10 hcl 500ml , nitrile gloves size small / medium / large , p t tubes 3.8% sodium citrate , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test strip , vdrl rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , surgical blade 22 no carbon steel , sugar albumin uristics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for pediatric ( bac t / alert pf , blood culture media anaerobic for pediatric ( bac t / alert , ki67 / mib 106 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close , disposable circular stapler 26mm diameter , disposable circular stapler 29mm diameter , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable linear stapler with fixed staple height 55mm 60mm , disposable linear stapler with fixed staple height 75mm , reload 55 60mm for thin / vascular tissue white compatible , reload 55 60mm for medium thick tissue blue compatible , reload 75 80mm for medium thick tissue blue compatible , reload 75 80mm for thick tissue green compatible with , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposble skin stapler with pins , disposable hemorrhoidal stapler with detachable anvil. , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 35mm 45mm , reload for linear stapler with fixed staple height 55mm 60mm , reload for linear stapler with fixed staple height 55mm 60mm , disposable curved cutter stapler , polycearbonte bladeless frocar with reducer seal 5mm , polycearbonte bladeless frocar with reducer seal 10mm , polycearbonte bladeless frocar with reducer seal 12mm , reload for linear cutter 55mm 60mm size blue , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload for linear cutter 90mm 100 mm size blue , reload forlinear cutter 90mm 100 mm size green , reusable laparoscopic clip applicator for medium large titanium , reusable laparoscopic clip applicator for large titanium clips with , mesh fixation device with non absorbable titatinum tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , mesh fixation device with 30 poly ( lactide co glycolide ) , mesh fixation device with 15 poly ( lactide co glycolide ) , partially absorbable mesh with absorable & semi , partially absorbable mesh with absorable & semi absorbable , polyprplene with polyglecaprone 25 partially absorbable mesh , polyprplene with polyglecaprone 25 partially absorbable mesh , skin staple remover with plastic handle , distal tip closure titanium ligation clip small size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip medium large size , distal tip closure titanium ligation clip large size , reusable laparoscopic clip applicator for large titanium , reusable laparoscopic clip applicator for medium large , reusable laparoscopic clip applicator for large titanium , dispoable trocar 05mm , dispoable trocar 10mm , dispoable trocar 12mm , dispoable trocar 15mm , disposable curved cutter stapler , reload compatible with curved cutter , endoscopic cutter & staplter60mmlong , endoscopic cutter & staplter60mm , reload endoscopic cutter & staplter60mm white / , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter45mm blue , endosuturing device 10mm with toggle lever , absorbable 2 0 endo suture cartridge 48 length , non absorbable 2 0 endo suture cartridge 48 length , disposable clip applier medium 5mm with 16 clips , disposable clipapplier medium 10mm with 20 clips , multifire clip applier small size 20 clip , multifire cliip applier long size 15 clips , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , suture locking , plastic locking clip applicator medium / large , locking clip cartridge medium / large , open clip appkicator 100 lt / 200 lt / 300 lt / 400 lt , titanium clip 100 lt / 200 lt / 300 lt / 400 , instrument tray 8×6 inch , instrument tray 9×6 inch , instrument tray 10×8 inch , instrument tray 11×7 inch , instrument tray 12×10 inch , instrument tray 14×10inch , instrument tray 15×12 inch , instrument tray 18×12 inch , instrument / dressing drum 9×5 inch , instrument / dressing drum 9×9 inch , instrument / dressing drum 10×8 inch , instrument / dressing drum 11×9 inch , instrument / dressing drum 14×9 inch , instrument / dressing drum 15×12 inch , formalin chamber 20 inch ( 20x8x8 ) 3 tray , formalin chamber 14inch 3 tray , formalin chamber 10 inch 2 tray , kidney tray set ( 150mmx200mmx250mmx300 mm ) , stainless steel cidex box with lid 10 lits ( 27x6x5 “ ) , ulv fogging machine , sanishieldsolution , ot slipper orthopedic soft , s.s sterilization autoclave , square box 20cmx20cm , s.s sterilization autoclave , square box 20cmx10cm , ent surgical micromotor drill system , micro ear burr tungsten carbide cutting 70mm , micro ear burr tungsten carbide cutting 0.5 mm , micro ear burr tungsten carbide cutting 0.60mm , micro ear burr tungsten carbide cutting 1 mm , micro ear burr tungsten carbide cutting 1.50 mm , micro ear burr tungsten carbide cutting 2.00 mm , micro ear burr tungsten carbide cutting 2.50 mm , micro ear burr tungsten carbide cutting 3.00 mm , micro ear burr tungsten carbide cutting 3.50 mm , micro ear burr tungsten carbide cutting 4.00 mm , micro ear burr tungsten carbide cutting 4.50 mm , micro ear burr tungsten carbide cutting 5.00 mm , micro ear burr tungsten carbide cutting 5.50 mm , micro ear burr tungsten carbide cutting 6.00 mm , micro ear burr tungsten carbide cutting 6.50 mm , micro ear burr tungsten carbide cutting 7.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 0.60 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 1 mm , micro ear burr tungsten carbide diamond / polishing 70mm length1.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 2.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length2.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length3.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 3.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 4.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.00mm , micro ear burr tungsten carbide diamond / polishing 70mm length 5.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.00 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 6.50 mm , micro ear burr tungsten carbide diamond / polishing 70mm length 7.00 mm , bulls lampstand &100watt bulbs , head mirror , otoscope ( heine fibro optic ) , thudicum nasal speculum , lac’s tongue depressor ( metalic reuseable ) , in direct laryngoscopy mirrors , st clairs tompsons posterior rhinoscopy mirrors , hartmann aural speculum , shea aural speculum , tumarkin aural speculum , verhoeven micro ear suction tip , ear microsuction tip adapter , nasal suction tip , suction apparatus , siegles speculum , tuning fork ( 256hz, 512hz, 1024hz ) , bayonet forceps , jobson horne probe , steilizer ( boiler ) , bp apparatus , stethoscope , tilleys nasal dressing forcep , hartman nasal packing forcep , loop vectix wire , instrument tray 10inch x 15 inch , ent opd led head light , metalic washerless aural syringe ( simpson’s ) , tilley lichwitz s trocar&canula , tongue tie release butterfly forcep all size , sprit lamp , barany noise box , ear vectis with cerumen spud , hartmann aural forceps , trocltsch aural forceps , lucas curved aural forceps , eustachian tube catheter , mac ewen cell seeker and curette , alligator forceps , nasal foreign body hook , higginson syringe , tilleys antral harpoon , myle nasoantral perforator , st clair thompson quinys forceps , cidex box 45 cm and 35 cm and 24 cm , formalinchamber ( 35 cm & 45 cm ) , cheatle sterilizerforceps , cheatle forceps jar , bandage cutting scissors , x ray view box , opd sterlizing fogger machine , ultrasonic instrument cleaner , curved scissor 6 inch , formalin chamber 24 cm , savalon solution , bowl , romposon suction tube , nasal suction tip , tilleys forcep , lidocaine 4% solution 30 ml , gauze cloth 91 cm / 20 m , macintos 20×1 mtr , surgical mopping pad , adk drain 24 no , adk drain 28 no , chest tube with trocar 20 no , chest bag under waterseal 26 no , romovac suction drain 16 no , romovac suction drain 14 no , romsons corrugated drain , harnia mesh kit 3×6 inch , intraoclar lens ( 15 no to 27 no ) , viscoelastic substance , balanced salt solution , formalin solution , acetone solution , inj. hylase ( hyluronidase ) , lignocaine 2%+ adrenaline , inj.gentamicin , inj. phenylephrine 10 mg / 1 ml , cuticell10*10 cm , cuticell 10*30 cm , hand wash soln 500 ml , microgen d 125 , iv ns3 % 100 ml , iso p 500 ml , iv ns 0.45% 500 ml , guedal airway size 000, , guedal airway size 00, , silicon mask adult size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , ansthesia work station disposable circuit ( adult ) , laryngoscope ( paedeatric ) a machintosh size 00, , laryngoscope ( paedeatric ) b miller blade size , 0, , laryngoscope ( paedeatric ) a machintosh size , 1, , laryngoscope ( paedeatric ) b miller blade size size , 1, , laryngoscope ( paedeatric ) b miller blade size , 2 , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , maccoy laryngoscope with bladesize 5 , lma ( proseal ) size 1, , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , lma ( i gel ) size 1 , lma ( i gel ) size 1.5 , lma ( i gel ) size 2 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 6.5 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating bougie , ventilating bougie , ansathesia face mask silicone transparentsize 00 , ambu bag ( padeatric ) 150 ml , micropore 0.5inch , micropore 1 inch , magill forcep ( adult ) , magill forcep ( padeatric ) , video laryngoscope with blade 2 ( c mac ) , video laryngoscope with blade 3 ( c mac ) , video laryngoscope with blade 4 ( c mac ) , centralvenous catheterkit ( paedeatric ) , pressure bag 1000 ml , pressure bag 500 ml , nebulizer machine , head ring ( peadia ) , head ring ( adult ) , hot air warmer , 3 way extension 25 cm , needle cutter , 3 way extension 100 cm , electric surgical instrument boiler ( 24*8*8 ) inch , electric surgical instrument boiler ( 20*8*7.5 ) inch , tee oxygenator ( t piece ) , tub big50 litr , detergent powder 500 gm , rubber sheet macintos20m roll , capmask / cloth based , towels ( small ) , towels ( large ) ) , shoe cover / cloth based , disposablesurgical gown , combined epidural spinal set ( 18g ) , hernia mes ( polypropylene ) 3*6 inch , north & southpole indotracheal tube ( rate tube ) size 3.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 04 ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 4.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 05, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 5.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 06, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 6.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 07, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 7.5, ( ring adair elwiny ) , north & southpole indotracheal tube ( rate tube ) size 08 ( ring adair elwiny ) , betadine scrub ( 500 ml ) , betadine solution ( 500 ml ) , nylon 2.0 ( cutting needle ) suture , ethilone 2.0 , condom , g bone , mirena 50 , bupevacine inj ( 20 ml ) , pregnancy kit , infrared thermometer gun , nebuliser mask ( paedia ) , needle cutter electrical , steam disinfectant system, ( fumigation machine ) , surgical poly wrap , tripple lumen central line adult , uroflometer , pulse oxymeter , nasopharyngealairway size 5.5 , nasopharyngealairway size 6 , nasopharyngealairway size 7 , nasopharyngealairway size6.5 , nasopharyngealairway size7.5 , steel scissor 10 no , steel tray ( small ) , steel tray ( large ) , steel tray ( medium ) , bb splint , disposable catheter mount , tooke corneal knife ( num ) , inj. adenosine 6 mg / 2 ml , inj. adrenaline 1 mg / ml , inj. adrenaline 1 mg , inj. alamine 200 ml , inj. albumin iv 20% 100 ml , inj. amikacin500 mg , inj. amikacin ( 250mg / 2ml ) , inj. amiodarone 150 mg , inj. amoxycillin + clav. acid1.2 g , inj. amoxycillin + clavulanic acid 1.2 gm , inj. amoxycillin 500 + clavulanic acid 100 mg , inj. amphotericin b 50 mg , inj. anti rabis immunoglobulin ( inj. arv ) , inj. antisnake venom 10 ml , inj. artemether 80 mg , inj. artesunate 60 mg , inj. artesunate 60mg , inj. arv / antirabies vaccine , inj. atracurium50 mg ( 5 ml ) , inj. atracurium 10 mg ( 2.5ml ) , inj. atropin 1 ml / 0.6 mg , inj. atropine 0.6 mg , inj. bupivacaine 0.5 % 20 ml , inj. bupivacaine 0.5 % 4 ml ( heavy ) spinal , inj. bupivacaine hydrochloride 0.25% 20 ml , inj. calcium gluconate 10% ( 10 mg ) , inj. calcium gluconate 10% 10ml , inj. carboprost 250 mg , inj. cefazolin1 gm , inj. cefoperazone 1000mg + sulbactam 1000mg , inj. cefotaxime sodium500 mg , inj. cefotaxime sodium500 mg / vial , inj. cefotaxime sodium 1 gm , inj. ceftriaxone500mg vial , inj. ceftriaxone ( 250mg vial ) , injection , inj. ceftriaxone+ sulbactam , inj. chlorpheniramine 25 mg , inj. ciprofloxacin 200 mg , inj. clindamycin 600 mg , inj. clindamycin 300 mg , inj. clindamycin 900 mg , inj. colistin3 miu , inj. colistin4.5miu , inj. colistin 2miu , inj. colistin 9miu , inj. deriphyline , inj. dexamethasone 8 mg , inj. dexmeditomidine 100 mcg / 1 ml , inj. diazepam 10mg , inj. diazepam 5mg , inj. diclofenac 25 mg , inj. dicyclomin 10 mg , inj. dicyclomine 10 mg , inj. digoxin 0.5 mg / 2 ml , inj. dilitiazemiv 25 mg , inj. dobutamine 250 mg , inj. dobutamine 250 mg ( 5ml ) , inj. dopamine 40 mg , inj. dopamine 5ml , inj. enoxaparine 40 mg , inj. enoxaparine 60 mg , inj. ephedrine30 mg / 1 ml , inj. esmolol 100 mg , inj. ethamsylate250mg , inj. etomidate 10 ml ( 2 mg / ml ) , inj. fentanyl 2 ml ( 50 mg / ml ) , inj. flumazenil 0.5 mg , inj. fortwin ( pentazocin ) 30mg , inj. frusemide 10 mg , inj. furosemide 40 mg , inj. gentamicin 80 mg , inj. gentamicin40 mg / ml , inj. gentamicin 40 mg , inj. gentamycin 80 mg / 2 ml , inj. glargin insulin 100 iu / ml , inj. glucagon 1 mg , inj. glycopyrrolate 1 ml / 0.2 mg , inj. haloperidol 2mg / ml , inj. hydralazine 10 mg , inj. hydrocortisone 100 mg , inj. hyoscine 20 mg / ml , inj. hyoscine butyl bromide 20 mg , inj. hyydrocortisone 100mg , inj. insulin nph , inj. insulin regular , inj. iron sucrose 100 mg iv 5 ml , inj. iron sucrose 50 mg / ml iv , inj. kcl 10 ml / 150 mg , inj. ketamine10 ml ( 50 mg / ml ) , inj. labetalol20 mg , inj. levetiracetam 500 mg , inj. levofloxcillin100 ml , inj. lignocaine 2 % ( 21.3 mg / ml 30 ml vial , inj. lignocaine 2%iv ( 30 ml ) , inj. linezolid 600 mg , inj. linezolid 600 mg 300 ml , inj. l orithine l asportate 5 gm , inj. loxicard 2% 20 ml iv , inj. mannitol 100 ml , inj. mannitol 100 ml , inj. mephentermine 30 mg / 1 ml , inj. meropenam + sulbactam1 gm , inj. methargine 0.5 mg , inj. methotrexate 100mg / ml , inj. methylcobalamin 500 mcg / 3ml , inj. methylprednisdone 500 mg , inj. methylprednisolone 1 gm , inj. metoclopramidehcl 5 mg / ml , inj. metoclopramide 5 mg / ml , inj. metoprolol 1 mg / ml ( 5 ml ) , inj. metoprolol 1mg / 5mliv , inj. metrogyl 100 ml , inj. mgso4 1 gm / ml ( 50% ) , inj. midazolam 1 mg / ml ( 5ml ) , inj. midazolam 1mg / 5ml , inj. mixtard insulin 100 iu / 10 ml , inj. morphine 1 ml / 10 mg , inj. moxiflox 400 mg iv , inj. multivitamin iv , inj. nalaxone 400 mg , inj. nefenamic acid 500 mg , inj. neostigmine +glycopyrrolate ( 2.5mg + 0.5mg ) 5 ml , inj. neostigmine 1 ml / 0.5 mg , inj. nitroglycerin25 mg / 5 ml , inj. noradrenaline 1ml , inj. noradrenaline 2 mg , inj. ondansetron2 mg / ml , inj. ondensetrone 8 mg / 2 ml , inj. oxytocine 10 iu , inj. pantaprazole 40 mg , inj. paracetamol 150 mg , inj. pheniramine 75mg ( 2ml ) , inj. phenylephrine 10 mg / 1 ml , inj. phenytoin 50mg , inj. phenytoin 50mg / ml , inj. pilocarpine nitrate ip 0.5 % w / v ( 1 ml ) , inj. piperacillin +tazobactam4.5 gm , inj. potassium chlorideiv 150 mg / 10 ml , inj. promethazine25 mg / 7.84 ml , inj. promethazine 25mg , inj. propofol 20 ml ( 10 mg / ml ) , inj. protamine sulfate 10 mg , inj. quinine 600 mg , inj. regular insulin 100 iu , inj. ropivacaine 0.7 % / 20 ml , inj. sodabicarbonate 10 ml , inj. streptokinase 1.2 mu , inj. succynyl choline 10 ml ( 50 mg / ml ) , inj. tecoplanin 200 mg , inj. tecoplanin 400 mg , inj. terlipressiniv 1 mg / 10 ml , inj. tetanns toxcid 5 ml , inj. thiopentanil sodium 500 mg , inj. tramadol 50 mg , inj. tranexamic acid 500 mg , inj. tranexamic acid injection bp / ip ( 100mg / ml ( 5ml amp ) ) , inj. triamcinolone acetate 40mg / ml , inj. triamcinolone acetate 40mg / ml , inj. valethamate 10 mg , inj. vancomycin 1 gm , inj. vecuronium 10 mg , inj.botropase ( ( haemocoagulase 1cu ) 1ml ) , inj. verapamil 5 mg , inj. vit d33 l , inj. vit d3 6l , inj. vitamin k 10 mg , inj. xylocaine 2% intravenous , inj.adrenaline 1 ml , inj.dmpa 150 mg , tabmethyl prednisolone 16 mg , tab deriphylline ( etophylino 77mg + theophyline 23mg ) , tab fluconazole150 mg , tab fluconazole 100 mg , tab fluconazole 200 mg , tab fluconazole 300 mg , tab fluconazole400 mg , tab fluconazole 50 mg , tab hydroxyzine25mg , tab hydroxyzine 10 mg , tab.acebrophyllin + n acetyl cystine , tab.aceclofanc + paracetamol , tab.aceclofenac 100 mg , tab.amlodipine2.5 mg , tab.amlodipine5 mg , tab.amoxycillin + clavulanic acid625 mg , tab.amoxycillin 500mg , tab.aspirin 75 mg , tab.atorvastatin20 mg , tab.azithromycin 500 mg , tab.azithromycin 500mg , tab.buscopan 10 mg , tab.carvedilol 3.125 mg , tab.cefixime 200mg , tab.cepodoxime 200mg , tab.cepodoxime+clavulanic acid 325 mg , tab.cinnarizine + dimehydrate , tab.cinnarizine 25 mg , tab.clopidogrel 75 mg , tab.diclofanac+ paracetamol , tab.diclofenac 50 mg , tab.digoxin0.25 mg , tab.ethamsylate 250 mg , tab.fluconazole 150 mg , tab.furazolidone100mg , tab.glimeperide2mg , tab.glimeperide 1mg , tab.iron folic acid 400 mg , tab.lefulonamide10mg , tab.lefulonamide20 mg , tab.levocetrizine + montelukast , tab.levofloxacin 500 mg , tab.metformin 500 mg , tab.metoprolol 50 mg , tab.metronidazole 400mg , tab.nifedipine 10 mg , tab.nitrofurantoin 100 mg , tab.ofloxacine + ornidazole , tab.ofloxacine 200mg , tab.paracetamol 500mg , tab.paracetamol 650mg , tab.pheniramine maleate4 mg , tab.rabeprazole 20 mg , tab.telmisartan 40 mg , tab.thyroxine 25mg , tab.thyroxine 50mg , tab.thyroxine 75mg , tab.vildagliptin 50 mg , tab. acebrophyllin 100 , tab. acetazolamide 250mg , tab. acetylcysteine ( mucinac ) 600 mg , tab. acyclovir 800mg , tab. alprazolam0.5mg , tab. alprazolam 0.25 mg , tab. alprzolam 0.25mg , tab. amiodarone 100 mg , tab. amitriptyline 10 mg , tab. amitriptyline 25 mg , tab. amlodipin 5 mg , tab. amoxycillin + clavulanic acid625 mg , tab. arltemrthev+ lumefantrine , tab. ascorbic acid ( vitamin c ) 500mg , tab. asprin 150 mg , tab. asprin 75 mg , tab. atorvastatin 40mg , tab. azathioprine 100 mg , tab. azithromycin 500mg , tab. betahistine 8mg , tab. cabergoline 0.5 mg , tab. calcium + vit d3 500 mg , tab. carbamazepine 400mg , tab. carbimazole 10 , tab. cefelexin 500 mg , tab. cefixime 200 mg , tab. cefpodoxime200 mg , tab. cetrizine5mg , tab. cetrizine 10 mg , tab. chlordiazepoxide 10 mg , tab. chloroquine 500 mg , tab. cinnarizine ( 25 mg ) , tab. ciprofloxacin500 mg , tab. ciprofloxacin 250 mg , tab. clonazepam 0.5 mg , tab. clonazepam 0.25 mg , tab. cyclophosphamide 50 mg , tab. dapsone 100 mg , tab. dexamethasone 2 mg , tab. dexamethasone 4 mg , tab. dexamethasone 8 mg , tab. diclofenac + serratiopeptidase 10 mg , tab. dicyclomine 10 mg , tab. dicylomine 20 mg , tab. diltiazem 30 mg , tab. divalprox sodium 250 , tab. domperidone 10 mg , tab. drotaverine 40 mg , tab. escitalopram 10 mg , tab. etiophyllin + theophyllin 50 mg , tab. etizolam0.5mg , tab. etizolam 0.25 mg , tab. fexofenadine 120 mg , tab. fexofenadine 180 mg , tab. fluconazole 150mg , tab. furosemide 10 mg , tab. haloperidol 0.5mg , tab. hydrocortisone 100 mg , tab. hyoscine butyl bromide 10 mg , tab. ibuprofen 400 mg , tab. iron folic acid ( 100 mg +5 mg ) , tab. ivabradin 5mg , tab. labetalol 100 mg , tab. labetalol 200 mg , tab. levetriacetam 500 , tab. levocetrizine 10 mg , tab. levocetrizine 5 mg , tab. levocetrizine 5mg , tab. levofloxacin 250 mg , tab. levofloxacin 500 mg , tab. linezolid 600 mg , tab. mala n , tab. metformin 500mg , tab. methargine 0.2mg , tab. methotrexate 10mg , tab. methotrexate5mg , tab. methotrexate7.5 mg , tab. methotrexate 2.5 mg , tab. methyl prednisolone 32mg , tab. methylcobalamin / mecobalamin 500 mcg , tab. metoclopramide 10 mg , tab. metoprolol 25 mg , tab. metoprolol 50 mg , tab. metorolol 25mg , tab. metronidazole 200 mg , tab. misoprostol200 mg , tab. misoprostol 25 mg , tab. mv / b complex , tab. nefenamic acid&diclocylomine ( 500mg+ 20 mg ) , tab. nifidipin10 mg , tab. nintedanib 100 mg , tab. nintedanib 150 mg , tab. nitrofurantion 100 mg , tab. norethisterone 5mg , tab. norfloxacin 400 mg , tab. ofloxacin 200 mg , tab. olanzapine10 mg , tab. olanzapine 10mg , tab. olanzapine 5 mg , tab. ondensetron 4 mg , tab. oremeloxifene ( chhaya ) 30 mg , tab. oseltamivir 30mg , tab. oseltamivir75mg , tab. oseltamivir 45 mg , tab. pantaprazole+ domperidone , tab. pantaprazole 40 mg , tab. pheniramine 25mg , tab. phenytoin 100 mg , tab. pirfenidone200 mg , tab. pirfenidone400 mg , tab. prednisolone20 mg , tab. prednisolone 10mg , tab. prednisolone 10 mg , tab. prednisolone 5 mg , tab. prednisolone 5mg , tab. pregabatin + methylcobalamin 75 / 1500 , tab. pregasterone susline 200 mg , tab. propanolol 40 mg , tab. pyoridoxine sr 100 mg , tab. pyroxicame 10 / 20 mg , tab. pyroxicame 20 mg , tab. ramipril 2.5 mg , tab. ramipril 5 mg , tab. ranitidine 150 mg , tab. roflumilast 250 mg , tab. roflumilast 500 mg , tab. sodium valproate 500 , tab. thyrox12.5mg , tab. thyrox 100 mg , tab. thyrox 25 mg , tab. thyrox 75mg , l arginine + proanthocinidin ( argipreg ) sachet granules , tab. tramadol 100 mg , tab. toclizumab5 mg , tab. torsemide 10 mg , tab. tramadol50mg , tab. trypsin / chymotrypsine colloidal / sessatiopeptidase 100000 au , tab. ursodeoxycholic acid 300 mg , tab. verapamil 40 mg , tab. vitd3 60 k , tab. vitamin. b complex ( nfi ( prophylactic ) ) , tab. zinc oxide 20 mg , tab.doxyllamine+pyridoxine , tab.dydrogesterone 10 mg , tab.misoprostol 600 mcg , tab.ofloxacin+ornidazole , tab.thyrox 50mg , betadine pessary 200mg , tab. mtp kit ( mifepristone 200 mg+misoprostol 200 mg ) , tab.trenexa+ethamsylate , ors sachet , chlorhexidine gluconate mouthwash 0.2% w / v solution ( 50ml bottle ) , glucose powder , hiv kit / hbs ag ( surgical ppe kit ) , ketopatch , diclofenac patch , cholecalciferol granules 60000 iu , cap. ampicillin ( 250 mg ) , cap. b complex minerals with zinc , cap. doxycycllin 100 mg , cap. itraconazole200 mg , cap. methylcobalamin + alpha lipoic acid ( 1500 mcg + 100 mg , cap. itraconazole 100 mg , cap. vit e 200 , cap. vit e 400 , cap. vitamin a 1 lakh iu , creamliquidparaffin , cream clotrimazole 1% 30 gm tube , cream soframycin , creambeclomethasone 30 gm tube , creambetamethasone20 gm tube , creamfusidic acid 15 gm tube , creamketoconazole 15 gm tube , cream clobetasol propionate0.5 % , cream acyclovir 5% ( 5gm ) , cream estriol 1% ( 1.5 gm ) , diclofenacgel 30 gm tube , dinoprostron gel 0.5 mg , neomycin sulphate+bacitracin zinc5mg+500 iu / gm ointment15gm tube , neomycin sulphate+bacitracin zinc ( 5mg+500 iu / gm ointment 15gm tube , oint. choline salicylate + benzalkonium chloride9% + 0.02% ( 10 gm ) , oint acyclovir. 5g , oint soframycin 10 gm , oint. chloramphenicol +dexamethasone ( 1%+0.1% ) , oint. choline salicylate + lidocaine , oint. clobectasol + salycylic acid 3 % , oint. mupirocin 2% , oint. neosporin5 gm tube , oint. povidone15 gm tube , oint. silver nitrate 15g , oint.mupirocin ( 2% w / w ( 5 gm tube ) , oint. mupirocin ( 2% w / w ( 5 gm tube ) , oint. lignocaine hydrochloride ( 2% w / v ( 30 gm tube ) , ointment betadine 2% 5gm , placenta extract gel 20g , eye ointment ciprofloxacin0.3% ( 3gm tube ) , oint. clindamycin gel 5 gm , oint. gentamycin sulphate 0.1% ( 15gm tube ) , , ointment metrogyll p 2% , xylocaine spray 10 % , eye drop cyclopentolate 1% w / v ( 5 ml ) , , eye drop dexamethasone + gentamycin 0.1%+0.3% , eye drop carboxymethylcellulose sodium 0.5% ( 10ml ) , eye drop sodium chloride ( ophthalmic ) 5% ( 10 ml ) , eye drop timolol maleate0.5 %w / v ( 5 ml vial ) , eye drop gatifloxacin 0.3% 5ml , eye drop. phenylepherine hcl & tropicamide 5% + 1% 5 ml , eye drop tobramycin ( 0.3% 5ml ) , eye drop proparacaine 0.50% 5 ml / vial , eye drop. carboxymethylcellulose ip 1% w / v 10ml vial , hydroxypropyl methylcellulose ophthalmic solution 2% , hydroxypropyle methyle cellulose opthalmic solution ( 2% 2ml pfs ) , eye drop , eye drop olopotadine antiallergic ( 0.1% w / v ( 5 ml vial ) ) , , eye drop providone iodine 1% ( 5 ml ) , eye drop fluconazole 3 mg ( 10 ml vial ) , eye drops pilocarpine 4% , eye drops pilocarpine hydrochloridebp 2% , eye drop ciprofloxacin+ dexamethosone ( 0.3%+0.1% ) , eye drop ofloxacin 0.3% w / v ( 5 ml vial ) , eye drop. lignocaine hydrochloride ( 4% ( 5 ml vial ) , eye dropmoxifloxacin + prednisolone 5 mg + 3 mg / 5 ml , eye dropmoxifloxacin 0.5% w / v ( 5 ml ) , , ear wax cerumenolyticeach 10 ml , nasal drop xylometazoline ( 0.1%w / v 10 ml vial , nasal spray calcitonin30 mcg , bss solution for opthalmic use ( 500ml ) , solution , eye drop atropine sulphate 1% ( 5 ml vial , ear drops gentamycin + hydrocortisone 0.3% + 1% , eye drophomatropine 2 % ( 5 ml ) , , eye drop ciprofloxacin 0.3% ( 5ml vial ) , ciprofloxacin eye ointment 0.3% ( 3gm tube ) , syp.b complex 100 ml , syp. alkacitral ( disodium hydrogen citrate ) 1.4g / ml , syp. cyproheptadine 100 ml , syp. dextrometharphin 100 ml , syp. lactulose 150 ml , syp. liv 52250 ml , syp. prednisolone 10 mg , syp. prednisolone 20 mg , syp. prednisolone 5 mg , syp. vitamin a ( 10000o iu ) 100 ml , syrp. paracetamol 125 mg ( 60ml bottle ) , syringe 50 ml , syrp. alkalizer100 ml , syrp. anti oxidant lycopen 200 ml , syrp. dextromethorphan + chlorpheniramine , syrp. dextromethorphan 10mg / 5ml ( 100ml bottle , syrp. lactulose 60 ml , syrp. potassium chloride 100mg / ml , syrp. potassium chloride 200 ml , syrp. sucralfate + oxetacaine , syrp. ambroxol hcl 15mg+terbutaline sulphate 1.25mg+guaiphenesin 50mg 5ml 100ml , syrp. amoxicillin and clavulanic acid i.p. ( 200+28.5mg ( 30 ml bottle ) , syrup antacid , clotrimazole pessary 100 mg , clotrimazole pessary 500 mg , budecort inhaler200 mcg , budesonide inhaler ( foracort ) 0.5 mg , budesonide respules 0.5 mg , buprenorphine patch , tiotropium 18ugmdi / dpi , tiotropium 9ugmdi / dpi , xylocaine viscoussolution 4% , total parentral nutrition ( tpn ) 1 litr. , total parentral nutrition ( tpn ) 500mlperiferal , sporolac sachet ( 5 millions lactobacillus ) , soda lime granule5 kg , sodium phosphateenema 100 ml , hydrogen peroxide 3% ( 500 ml ) , surgical spirit500 ml , sevoflurane inhalation , salbutamol respules 5ml ( asthalin ) , sanitizer 500 ml , savlon solution500 ml , povidonelotion10 % 500 ml , povidonelotion5 %500 ml , povidonelotion7.5% 500 ml , peglec sachet , nebul.levosalbutamol+ipratopium bromide , liquid paraffin500 ml, bottle ) , solution , lignocaine 2% + adrenaline 5 mcg / ml ( 30 ml ) , vial , lignocaine 2% jelly , iv d10% 500 ml , iv d25% 100 ml , iv ns3 % 100 ml , iv ns 0.45% 500 ml , iv. fluiddns 500ml , iv. fluidringer lactate500ml , iv fluid normal saline 500 ml , iv infusion volulyte 6 % ( hestarch ) 500 ml , iv. normal saline 0.9 % 100 ml , iv isolyte m 500 ml , iv isolyte p 500 ml , iv intralipid 20 % 100 ml , iv. intraocular irrigating solution sodium chloride 0.49 % w / v, potassium chloride 0.075 % w / v, calcium chloride 0.048 %, magnesium chloride 0.03 % w / v, sodium acetate 0.39 % w / v, sodium citrate 0.17 % w / v. 500 ml ffs , isoflurane refiller 250 ml , insulin syring 40 iu 1 ml , hydrogen peroxide soln 100 ml , iv. hexa starch / voluvin 500 ml , hand sanitizer 1 ltr. , glutraldehyde 2.45 % , iv glycerine ip ( 100ml bottle ) , iv. glycerine / acriflaxin 100 ml , formetrol6 mcg + budesonide400 mcgmdi / dpi , formetrol6 mcg + budesonide 200 mcgmdi / dpi , formalin soln37 to 41 % ( 5 litr ) , enterogermina , disposable syringe 10 ml , disposable syringe 20 ml , disposable syringe 5 ml , disposablesyringe2 ml , disposable syringe50 ml , disposable needles26g , disposable needles24g , disposable needles22g , disposable needles20g , disposable needles18g , disposable needles16g , double arm nylon monofilament with 8 0 ( 3 / 8circle taper point needle ) , , disposable surgicalgloves6 no , disposable surgicalgloves6.5 no , disposable surgicalgloves 7no , disposable surgicalgloves 7.5no , disposable surgicalgloves 8no , latex examination gloves large , latex examination gloves medium , dynaplast 2 inch adhesive bandage , dynaplast 3 inchadhesive bandage , dynaplast bandage 10 cm * 4 m , disposable surgical mask , dustbin big 60 litr ( red / blue / black ) , dustbin small 30 litr ( red / blue / black ) , cotton cloth guaze than , cotton crape bandage 10cm x 4m , cotton crape bandage 15cm x 4m , cotton khadi curtain, 1.75 mt, , cotton khadi matress, 3x6 feet, 10.0kg, , cotton roll 500 gm , chadar check rangeen 84 inch x 48 inch , chadar rangeen 60 inch x 90 inch , blanket jammu woolen plane, 54x90 inch, , endotracheal cuff pressure manometer , endotracheal tube introducer ( stylet ) adult , endotrachial tube ( protex ) size 6, ( cuffed ) , endotrachial tube ( protex ) size 6, ( uncuffed ) , endotrachial tube ( protex ) adult size , 7 ( cuffed ) , endotrachial tube ( protex ) adult size , 6.5 ( cuffed ) , endotrachial tube ( protex ) adult size 7.5 ( cuffed ) , endotrachial tube ( protex ) adult size 8, ( cuffed ) , endotrachial tube ( protex ) adult size 8.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size 5.5 ( cuffed ) , endotrachial tube ( protex ) padeatric size , 3 ( uncuffed ) , endotrachial tube ( protex ) padeatric size 2.5, ( uncuffed ) , endotrachial tube ( protex ) padeatric size 5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 3.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4, ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 4.5 ( uncuffed ) , endotrachial tube ( protex ) padeatricsize 5, ( cuffed ) , epidural needle with catheter ( mini pack ) size 18 g , et tube ( cuffed ) 7no , et tube ( cuffed ) 6.5 no , et tube ( cuffed ) 7.5 no , et tube ( cuffed ) 8no , et tube ( cuffed ) 8.5 no , et tube 6 no. uncuffed , et tube 7 no. uncuffed , ethibond ( polyster suture ) 1 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 2 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 3 0 round body 1 / 2 circle 75 cm , ethibond ( polyster suture ) 5 0 round body 1 / 2 circle 75 cm , nylon clear monofilament 1 024 mm reverse cutting 75 cm , nylon clear monofilament 2 0 24 mm reverse cutting 75 cm , nylon clear monofilament 3 0 24 mm reverse cutting 75 cm , nylon suture, macrofilment spatulated, micropoint double armed size 10 0 ( 12 foils / pkt ) , poly propylene monofilament 0, 30mm 1 / 2 circle75 cm , poly propylene monofilament 1, 30mm 1 / 2 circle75 cm , polyamide size 8 / 0, 12 foils / pkt ( 3 / 8 cir micro point spatulated 6 mm, length 38 cm ) , polyglactin 0, 31mm 1 / 2 circle 70 cmreverse cutting , polyglactin 1 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 2 0, 31mm1 / 2 circle 90 cm round bodied , polyglactin 2 0, 31mm 1 / 2 circle 70 cm reverse cutting , polyglactin 3 0, 31mm 1 / 2 circle 70 cm round bodied , polyglactin 4 0, 31mm 1 / 2 circle 70 cm round bodied , polyglecaprone with curved 5 / 0 reverse cutting needle ( 16 mm ) , catgut 1 0 round bodied 1 / 2 circle 76 cm , catgut 2 0 round bodied 1 / 2 circle 76 cm , polypropylene monofilament sterile precut cd reverse ( cutting needle 6 0 ) , b.b silk with 1 / 2 cir rb needle size:4 / 0 20 mm length 75 cm, 12 foils per packet , b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical suture , synthetic absorbable suture 4 / 0 with 1 / 2 cir rb needle size:4 / 0 20mm length 70cm poly glycolic acid ( pga ) ( 12 foils / pkt ) , silk suture 1 01 / 2 round circle black braided 24 mm 76 cm , silk suture 2 01 / 2 round circle black braided 24 mm 76 cm , silk suture 3 01 / 2 round circle black braided 24 mm 76 cm , absorbable ( 6 0 ) braided coated polyglactin aw violet 8mm 1 / 2 circle spatulated micro point doublw arm ( 45 , silk suture 4 01 / 2 round circle black braided 24 mm 76 cm , roll bandage 05 cm x 05 m , roll bandage 10 cm x 05 m , roll bandage 15 cm x 05 m , roll bandage 7.5 cm x 05 m , ryles tube10 no. , ryles tube 12 no. , ryles tube size 14 , ryles tube size 16 , ryles tube size 18 , schantz pin 4 mm , schantz pin 4.5 mm , schantz pin 5mm , romo vac set 14 , romo vac set 16 , rubber sheet ( small ) , rubber sheet ( large ) , silicon mask adult size 0 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 01 with connection tube, reservoir bag and valve, high concentration ( bains circuit ) , silicon mask adult size 02 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 03with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 04with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask adult size 05 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask paediatric size 00 with connection tube, reservoir bag and valve, high concentration, ( bains circuit ) , silicon mask size 0 paediatric with connection tube, reservoir bag and valvepaediatric ( jackson rees circuit ) , silicon mask size 1 paediatric with connection tube, reservoir bag and valve, paediatric ( jackson rees circuit ) , , oxygen mask adult , non rebreathing mask , sics blade cresent ( 15 degree ) , simcoe i / a cannula, direct , skeletal traction kit , skin grafting blade ( downys blade ) , skin traction kit , spinal needle size 25 g , spinal needle size 26 g , spinal needle size 27 g , ss wire20g , ss wire 18 g , ss wire 22g , st pin 4 mm , st pin5 mm , st pin 4.5 mm , suction catheter 10 no , suction catheter 12 no , suction catheter 14 no , suction catheter 16 no , suction catheter 18 , suction tube10no , suction tube12no , suction tube14no , suction tube 8no , surgical steel drum 11*9inch , surgical steel drum 12*10inch , surgical steel drum 15*12 inch , surgical steel drum 6*6inch , surgical steel drum 6*9inch , surgical steel drum 9*9inch , surgical bladesize 15 , surgical blade , size 22 , surgical bladesize 23 , surgical blade , size 24 , surgical blade, size 11 , surgical cap disposable , ultrasoundjelly 250 gm , ecg jelly 250 gm , echo cardiography250 gm , view box size 14x17 , view box size 8x17 , weighingmachine mechenical , white ( sharp container ) 10 litr , whole sheet 35 inch x 35 inch , wound suction catheter ( no 18 ) , each , laryngoscope ( adult ) with bladesize , 3, , laryngoscope ( adult ) with bladesize , 4 , laryngoscope ( adult ) with bladesize 2, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 1, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 0, , laryngoscope ( paedeatric ) a machintoshb miller blade size , 2 , laryngoscope ( paedeatric ) a machintoshb miller blade size 00, , laryngoscope ( paedeatric ) a machintosh blade size 0, , laryngoscope ( paedeatric ) a machintosh blade size , 1, , lma ( i gel ) size 1.5 , lma ( i gel ) size 2.5 , lma ( i gel ) size 3 , lma ( i gel ) size 4 , lma ( i gel ) size 5 , lma ( i gel ) size 1 , lma ( i gel ) size 2 , lma ( proseal ) size , 1.5, , lma ( proseal ) size , 2, , lma ( proseal ) size , 2.5 , lma ( proseal ) size , 3, , lma ( proseal ) size 1, , lma ( proseal ) size , 4, , lma ( proseal ) size , 5 , maccoy laryngoscope with bladesize 3, , maccoy laryngoscope with bladesize , 4 , ( c mac ) video laryngoscope with complete blade set , maccoy laryngoscope with bladesize 5 , magill forcep ( adult ) , magill forcep ( padeatric ) , iv cannula ( two way ) size 24 , iv cannula 16 no. , iv cannula 18 no. , iv cannula 20 no. , iv cannula 22 no. , k wire1.6mm , k wire2mm , k wire2.5 mm , k wire 1 mm , k wire 3mm , kit 1 , kit 2 , kit 6 , intubating lma ( i lma ) fastrac 6 , intubating lma ( i lma ) fastrac 7 , intubating lma ( i lma ) fastrac 7.5 , intubating lma ( i lma ) fastrac 8 , intubating lma ( i lma ) fastrac 6.5 , intubating bougie , hernia mesh 15x15 , hernia mesh 3x6 , head ring ( adult ) , head ring ( peadia ) , guedalsairway size , 0, , guedalsairway size , 2, , guedalsairway size , 5 , guedalsairway size 00, , guedalsairway size 000, , guedalsairway size 1, , guedals airway size , 4, , guedals airway size 3, , glucometer , glucometer strips , hmef, filter, heat and moisture exchanger with viral filter ( hmef ) , formalin chamberthree tray ( 24*8*8 ) inch , formalin chamber three tray ( 20*8*8 ) inch. , formalin chamber two tray ( 16*8*8 ) inch. , foley catheter 20 no. 3 way , foley catheter 22 no. 3 way , foley’s catheter 16 no. , foley’s catheter12 no. , foley’s catheter14 no. , foleys catheter size10 , foleys catheter size18 , foldable iol sterile lens + 19.5d , foldable iol sterile lens + 19d , foldable iol sterile lens + 20.5d , foldable iol sterile lens + 20d , flexometallictube ( armored tube ) , 6.5 , flexometallictube ( armored tube ) , 7 , flexometallictube ( armored tube ) , 7.5 , flexometallictube ( armored tube ) , 8 , flexometallictube ( armored tube ) 6, , flexometallictube ( armored tube ) 8.5 , electric surgical instrument boiler ( 20*8*7.5 ) inch , electric surgical instrument boiler ( 24*8*8 ) inch , ecg paper a4 size , echo cardiography rollpaper , 3 way cannula ( triway ) , 3 way extension 100 cm , 3 way extension 25 cm , abdominaldrain adk drain no. 28 , abdominaldrain adk drain no. 30 , ansathesia face mask silicone transparentsize , 4 , ansathesia face mask silicone transparentsize , 5 , ansathesia face mask silicone transparentsize 0 , ansathesia face mask silicone transparentsize 00 , ansathesia face mask silicone transparentsize 1 , ansathesia face mask silicone transparentsize 2 , ansathesia face mask silicone transparentsize 3 , ansthesia work station disposable circuit ( adult ) , ansthesia work station disposable circuit ( paedeatric ) , centralvenous catheterkit ( adult ) , centralvenous catheterkit ( paedeatric ) , ambu bag ( padeatric ) 150 ml , ambu bag ( padeatric ) 250 ml , stethograph , analytical digital balance , perimeter ( priestley smith ) s / lp.984 b & t , long knee brace , knee cap , finger splint , wrist hand stabillizer , cock up splint , thumb spica splint , arm pouch , universal shoulder immobillzer , clavicular brace , neck collar soft , nack collar hard , l s belt , forearm brace , anklet , crepe bandage 4 inch , crepe bandage 6inch , dynaplast , stockinette / soft roll , walker , sodium borate 1 kg , sodium citrate 1 kg , pipracelline+tezobactum inj ( 4.5 gm ) , inj. tranexamic acid 500 mg , inj. lebetalol 5 ml , inj. magnesium sulfate , kelleys pad , povidone solution 5% 500 ml , inj methergine 0.2 mg , inj mgso4 50% , catgut 1 no suture , vicryl 1 no ( round bodied needle ) suture , inj epidosin , inj drotaverine , urine for albumin strip , cerviprime gel 0.5 mg , inj anti d ( 300 microgram ) , edta vial , b.p. instumanet with all size cuf , anterior vaginal wall retractor , ovum forceps ( medium size 05 ) ( small size 05 ) , blakes uterine curette , karmans cannula set ( 05 no ) , karmans cannula set ( 06 no ) , karmans cannula set ( 08 no ) , karmans cannula set ( 12 no ) , hegars cervical dilator set , mva syringe along with cannula , uterine sound , vullselum , tab. tranexa , tab. misopristol , cotton guaze pad , nylon suture 3 0 , nylon suture 4 0 , suction catheter 06 no , suction catheter 07 no , suction catheter 08 no , iv metronidazole 100 ml , iv ringer lactate 500 ml , iv normal saline 100 ml , mackintosh sheet , laryngo scope neonate blade size 0 / 1 , cidex solution 5 ltr , surgical drum 12×15 , surgical drum 11×13 , surgical drum 9×11 , surgical tray medium , surgical tray large , povidone onitment 250 gm , digital fuji x ray film 8*10 ( 1×150 ) , posterior chamber intra ocular lens ( pciol ) ( pmma, single piece, size 6mm optics total 13mm ) 10 d , pciol / / 12 d , pciol / / 14 d , pciol / / 16 d , pciol / / 17 d , pciol / / 17.5 d , pciol / / 18 d , pciol / / 18.5 d , pciol / / 19 d , pciol / / 19.5 d , pciol / / 20 d , pciol / / 20.5 d , pciol / / 21 d , pciol / / 21.5 d , pciol / / 22 d , pciol / / 22.5 d , pciol / / 23 d , pciol / / 23.5 d , pciol / / 24 d , pciol / / 25 d , pciol / / 26 d , pciol / / 27 d , pciol / / 28 d , pciol / / 29 d , pciol / / 30 d , anterior chamber intra ocular lens ( aciol ) , kelman multiflex model ( pmma, single piece, size 6mm optics total 13mm ) 16 d , aciol / / 17 d , aciol / / 18 d , aciol / / 19 d , aciol / / 20 d , viscoelastic substance ( pre filled syringe ) , trypan blue dye , hylase injection , lignocaine 4% drops , pilocarpine injection , epitrate injection , virgin silk suture6 0 , monofillanent nylon suture ( double ended ) , surgical blade 15 number , vicryl suture 6 0 , keratome blade , crescent blade , side port , tab. diamox , spirit lamp , r.o. machine for washing and scrubings , formiline chamber , white and green cloth , uv sterilizer , color vision chart – original ishihara , near vision chart with different languages , torch with yellow light , maddoxrod , maddox wing , diplopia goggles , bipolar wetfield cautry , placido disc , prism bar , cryo unit , non contact tonometer , multi media projector with screen , hess screen chart , usg –a scan , corneal loupe , indirect ophthalmoscope with +20 and +30 volk lenses , direct ophthalmoscope , snellen’s chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , streak retinoscope , keratometer , synaptophore , chalazion set , autoclave , drum ( large, medium, small ) , kidney tray ( large , medium , small ) , bowl , infrared thermometer , chittle forceps , boiler ( small and large ) , stainless steel traywith cover ( small and large ) , schiotz tonometer , intraocular lens 15 no to 27 no , intraocular lens 27 no , methylene blue dye , balancde salt solution , dextrose 5 % , dextrose 10 % , inj. epitate , inj.derriphyline , inj.botroclot , xylocaine jelly , inj.mitomycin c , thread ( 100 no ) , ethilon suture ( 4 0 ) , ethilon suture ( 6 0 ) , i / v set , needle ( 26.5 ) , syringes ( 5 ml ) , syringes ( 10 ml ) , syringes ( 20 ml ) , syringes ( 5 ml ) , n 95 mask , disposable eye drape , eye towel , intracatheter , inj mannitol , inj avil , chlorine solution 500 ml , betadene solution , ppe kit , betadene scrub , hydrogen peroxide solution , inj. betamethasone 4 mg , inj oxytocin 10 iu , drotaverine 40 mg / 2ml , inj. vit k , inj. dizepam , inj iron sucrose , tab. misoprostol 200 mg ( 4 tab. pack ) , baby tag , tab. tranexamic acid 500 mg , umblical cord clamp large size , rubber catheter plain , yankurs suction tube , weight machine neonatal , weight machine adult , dressing steel tray 12×15 , dressing steel tray medium , dressing steel tray small , dressing drum 12×15 , dressing drum 13×11 , electric sterlizer 20×8×6 , dettol shop 20 gm , polyglycolic acid absorbable surgical suture ( 12 foils / pkt ) ( 1 / 2 cir rb needle 40 mm length 90 cm size 1 ) vicryl , prolene 1 rb 1 / 2 circle 30 mm l 70 cm ( 12 foils / pkt ) needle , ethicon 2 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , ethicon 3 0 black clear monofilament rc 45 mm 75 cm needle ( 12 foils / pkt ) , b.b silk ( 12 foils / pkt ) ( 1 / 2 rcut needle 45 mm length 76 cm size 2 / 0 ) , stylet ( adult ) , stylet ( paedia ) , enema port , phosphate enema , methanol ( 50 ltr. per container packing ) , glycerin ( 50 ltr. per container packing ) , phenol , thymol crystals , 1 % eosin , winter green perfume ( oil of winter green ) , gasket , microbiological filter , printer paper , heater , hepa filter , printer ink ribbon , bowie & dick test strip , biological indicator , documentation label ( 1 roll of 750 ) , packaging indicator , cleaning indicator , ink roll labelling gun , chemical indicator ltsf , biological indicator ltsf , sterilization reel 50×200 mtrs ltsf , sterilization reel 75×200 mtrs ltsf , sterilization reel 100×200 mtrs ltsf , sterilization reel 200×200 mtrs ltsf , sterilization reel 250×200 mtrs ltsf , sterilization reel 300×200 mtrs ltsf , cartridge filter , antiscalant chemical ( cane of 40 ltr ) , calcitonin nasal spray 30 mcg , tab. lefulonamide 10 / 20 mg , tab. pyroxicame 10 / 20 mg , tab.toclizumab 5 mg , k wire 1 mm , k wire 1 .5 mm , k wire 1 .5 mm , k wire 2 mm , k wire 2.5 mm , k wire 3 mm , st pin 4 mm , st pin 4.5 mm , st pin 5 mm , ss wire 18 g , ss wire 20 g , ss wire22 g , stirrup , vicryl 2.0 rc , vicryl 3.0 rc , vicryl os 8 , vicryl os 6 , ethibond 2 no , ethibond 5 no , ethilone 1.0 , ethilone 2.0 , ethilone 3.0 , nylon 1.0 , nylon 2.0 , nasal prong , infant feeding tube 5 , infant feeding tube 6 , infant feeding tube 7 , infant feeding tube 8 , infant feeding tube 9 , diaper , identification band , disposable sheets , umblical catheter , centralline 3 fr , centralline 4 fr , centralline 5 fr , peadia set , alcohol based hand rub , formalin ( 50 ml bottel ) , phenyl ( 500ml ) , liquid handwash ( 500ml ) , disposable mark , disposable cap , sleeper , oxygen connecting tube , steel spoon , steel bowl , inj. normal saline ( 500 ml ) , inj. normal saline ( 200 ml ) , inj. isolyte p ( 500 ml ) , inj. ringer lactate ( 500 ml ) , inj. adreraline , inj. sodium valproate , inj. levepril ( levetirautam ) , inj. cefotaxim ( 250 mg ) , inj. cefepine , inj. pantop , inj. aciloc , ivig , inj. methyprednisolone , inj. mepropencm ( 235 mg ) , inj. sodabicarb ( 10ml ) , inj. capnea , inj. metronidazol ( 100 ml ) , inj. fluconzole , inj.botropose , inj. ampicilin , inj. teicoplanin , inj. 3% normal saline , inj. aminoveir , levosalbutamol respule , budecort respule , inj. amphotericin , syp paracitamol ( 5ml=125 mg ) , syp. ibuprofen , syp. dextromethorphen , syp. bromohexine , syp. calcium , drop multivitamin , syp. phenobarbitone , syp. cefixim ( 5ml=50 mg ) , drop domperidone , drop paracetamol , saline nasal drops , tobramnycin eye drop , hmf sachet ( lactodex ) , tab paracetamol , tab. amoxyclav , syp. amoxycalv , syp cetrizine , syrup zinc ( 20 mg ) , syrup phenytoin , syrup multivitamin , formalin ( 5 ltr packing ) , formalin ( 1 ltr packing ) , formalin ( 50 ltr per container packing ) , color vision chart —original ishihara , near vision chart with different languages , torchwith yellow light , maddox wing , diplopia goggles , placido disc , corneal loupe , snellens chart / snellen drum with or without remote control , trial set with trial frame ( adult and children ) , chalazion set , stainless steel tray with cover ( small and large ) , schiotztonometer , cotton absorbent ( 1 / 2 kg ) , blood group antisera ( abd ) , potassium nitrate , potassium acetate , sodium acetate , inj. acyclovir , inj. surfactant ( serventa ) ...

Department Of Heavy Industry - Madhya Pradesh

30218079 bids are invited for hcl,32% hydrochloric acid (hcl), minimum 32% by mass , hno3,69% nitric acid ( hno3),minimum 69 % by mass , nacl, 99.5% sodium chloride, minimum99.5% by mass , chloro benzene chloro benzene, minimum 99% by mass , n heptane n heptane, minimum 99% by mass , methanol methanol specially dried (water 0.02%), minimum99.8% by mass , acitic acid acetic acid glacial, minimum99.7% by mass , petrolium ether petroleum ether, distillation range 60 80° c, 0.68 gm/ml at 20° c , glycerol glycerol, minimum 85% by mass , diethyla mine diethylamine, 99% by mass , universal indicator universal ph indicatior (ph range 4 to 11) , acetone acetone, minimum99% by mass , h2so4 sulphuric acid (h2so4), minimum98% by mass , toluene toluene, ar grade , acetonitrile acetonitrile, ar grade , iso propyl alcohol iso propyl alcohol, ar grade , xylene xylene, ar grade , hcl, 0.1 n hcl (0.1 n), ampules , hcl, 1.0 n hcl (1 n), ampules , naoh, 0.1 n naoh solution (0.1 n), ampules , naoh, 1.0 n naoh solution (1 n), ampules total quantity : 1...

Police Department - Madhya Pradesh

29596076 supply of chemicals 1 δ9 tetrahydrocannabinol 2 1 chlorobutane 3 2,1 dichoro quininone 4 chloro imide (dqc) 4 4(4 nitrobenzyl)pyridine 5 5,5 diethyl barbituric acid 7 7 amino 4 hydroxy 2 napthalenesulphonic acid ( j acid) 8 absolute alcohol 11 acephate 12 acetaldehyde 13 acetamiprid n desmethyl 14 acetic acid 15 acetic acid glacial 17 acetone 21 acetone hplc 22 acidic alumina powder 23 acifloufen 24 agarose 25 agarose low eeo 26 alizarin red 27 alizarin s 28 allethrin 29 alpha napthlyl phosphate 30 alpha napthyl amine 32 aluminon (tri ammonium aurine tricarboxylate) 33 aluminone 34 ammonia 37 ammonium acetate 38 ammonium carbonate 39 ammonium hepta molybdate 40 ammonium nitrate 41 ammonium sulphate 42 ammonium vanadate 43 amonia trihydric 44 aniline 45 aniline sulphate 46 anthracene 47 antimony sulphide 48 arsenic sulphide 49 atrazine 50 barbitone 52 barium chloride 53 barium nitrate 54 basic alumina powder 55 basic fuchsin 57 bentaminephas blue salt 58 benzene 59 benzidine 60 benzidinediamino dip 61 beta cyfluthrin 62 bifenthrin 63 bismuth subnitrate 51 bis(trimethylsilyl) acetamide bsa 10 ml 64 bleaching powder 66 bromoform 67 brucine sulphate 68 brucine 69 buffer solution ph 9 (borate) 70 buffer tablet ph 4 (1 tablet to be dissolved to 100 solution) 71 buffer tablet ph 7 (1 tablet to be dissolved to 100 solution) 72 buffer tablet ph 9 (1 tablet to be dissolved to 100 solution) 73 cadmium chloride 74 caesium nitrate 75 calcium hydroxide 76 calcium lactate 77 calcium oxide 78 calcium sulphate 80 carbamate pesticide mixture (common carbamate pesticide) 81 carbofuran 82 carbon disulphide 83 carbon tetrachloride 84 chlormequat chloride 85 chlorobenzene 86 chloroform 87 chloroplatinic acid 88 chlorpyrifos 89 chromotropic acid disodium salt 98% extra pure 90 chromotropic acid or , sodium salt of chromotropic acid 91 clodinafap propargyl 92 cobalt nitrate 93 cobalt thiocynate 94 cobaltous acetate 95 codeine hydrochloride 96 conc, hcl 97 conc.sulphuric acid 98 copper strips 99 copper sulphate 100 cresol red indicator 101 cupric cloride 102 cupron grade 103 cyclohexane 104 cypermethrin 105 deltamethrin 106 diacetylmorphine 107 diafenthiuron 108 dichloromethane 109 diethyl amine 110 diethyl ether 111 di hidrad alcohol 112 dimethoate 113 dimethyl formamide dmf 114 dimethyl sulphoxide dmso 115 dimethyl yellow 116 dioxane 117 diphenyl carbazide 118 diphenyl carbazone 119 diphenylamine 121 dithiazone 123 dpx 124 emamectin benzoate 125 eosin (water solution for microscopy) 126 eosine (spirit soluble) 127 ethanol (methanol free) 128 ethanol absolute 129 ethephon 130 ethion 131 ethyl acetate 132 ethylene diamine hydrochloride 133 ethylenediamine tetraacetic acid edta 134 fast blue b salt 135 fenvalerate 136 ferric sulphate 137 ferric chloride 138 ferrous sulphate 139 fipronil 140 flubendiamide 141 formaldehyde 142 glacial acetic acid 143 glycerin 144 glycerol 145 glyphosate 146 hand disinfectant 147 handwash 148 heamotoxyline 149 hexaconazole 150 hexamine 151 hydrochloric acid 154 hydrogen peroxide 156 hydroxyl amine hydrochloride 157 imazethapyr 158 imidacloprid 159 indole 160 indoxacarb 161 iodine 162 iodoplatinate 164 iso octane 165 iso propyl alcohol 166 iso amyl alcohol 167 lambda cyhalothrin 168 lead acetate 169 liquid soap 170 magnesium sulphate 171 malathion 172 mangnous sulphate 173 mercuric sulphate 174 metadinitrobenzene 175 methanol hplc 176 methanol,2.5 litre 177 methonol 178 methyl red indicator 179 methylene blue indicator 180 molybdic acid 181 molybdic acid 85% ar/acs 182 morphine hydrochloride 183 morrin reagent 184 n/10 h2so4 185 n/10 h2so4 ampoule 186 n/10 naoh ampoule 187 nesslers reagent 188 n heptane 189 n hexane 190 ninhydrin 191 nitric acid 194 nitrobenzene 49 n heptane 5 ml ga 50 n decane 5 ml ga 195 n octane 196 n pentanol 198 organochlorine pesticide mixture (common oc pesticide) 199 organophosphorus pesticide mixture (common op pesticide) 201 oxalic acid 202 p aminophenol 203 para dimethyl amino benzaldehyde 204 paraquat dichloride 205 parifin wax 206 perchloric acid 207 petroleum ether ( 60 800c) 209 ph indicator paper range 1 14 210 phenol 211 phenolphthalein 212 phenolphthelin 213 phorate 214 phosphoric acid 215 p nitrobenzene azo resorcinol or megneson i 216 potassium dichromate 217 potassium iodide 218 potassium iodide grade 219 pottasium hydroxide 220 pottasium iodide 221 pottasium iodoplatinate 222 pottassium ferricyanide 224 pottassium chlorate 225 pottassium chromate 226 pottassium dichromate 227 pottassium nitrate 229 pretilachlor 230 profenophos 231 pyrethroid standard mixture (common pu pesticide) 232 pyridine 233 quinalizarin 234 quinalphos 235 resorcinol 236 rhodamine b 237 salicyclic acid 238 schiff’s reagent 239 scorpion venom antiserum (antivenin) 240 selenous acid 241 silica gel g 60 f254 precoated tlc plate aluminium sheets (20 x 20 cm) 242 silica gel g for tlc ( merk) 243 silica gel g powder 244 silver chloride 245 silver nitrate 246 snake venom antiserum (antivenin) 247 sodium acetate 248 sodium barbitone 249 sodium bicarbonate 250 sodium bicarbonate 251 sodium bisulphate 252 sodium carbonate 253 sodium chloride 254 sodium chloride 255 sodium cobaltinitrite 256 sodium dihydrogen phosphate 257 sodium hydrogen sulphite 258 sodium hydroxide 259 sodium hydroxide pellets 260 sodium molybdate 261 sodium nitrite 262 sodium phosphate dibasic heptahydrate 263 sodium phosphate monobasic monohydrate 264 sodium rhodizonate 265 sodium sulphate 267 sodium tungstate 269 soluble starch 273 stannous chloride 275 starch soluble 276 strontium nitrate 277 sulfanilic acid 278 sulphamic acid 279 sulphanilic acid 280 sulphur pure 281 sulphuric acid 282 surface dis infectane 283 surface sanitizer 284 tartric acid 285 tetramethylammonium hydroxide 286 thiamethoxam 287 toulene 288 trichloro ethylene 289 tris buffer 290 universal ph indicator solution, ph 4 to 11 291 vanadyl trioxychloride 292 vanilin 293 xylene 294 zinc acetate 295 zinc dust 297 zinc sulphate heptahydrate 298 zinc uranyl acetate 299 zincon 300 antisera a polyclonal...

Directorate Of Medical Education - Madhya Pradesh

29207351 tender for medicine / surgical item / i.v. fluid / surgical suture / kits chemical and surgical stapler , medicine, surgical item, i.v. fluids, surgical suture, kits chemical and surgical stapler , 5 fluro uracil 250mg 10 ml amp , 5 fluro uracil 500mg 10 ml amp , acyclovir 250 mg inj , acyclovir 500 mg inj , acyclovir 750 mg inj , adalimumab 20mg inj , adalimumab 40mg inj , adenosine 3 mg / ml 2 ml amp , ado trastuzumab emtansine 100 mg inj , adrenalin inj 1mg / ml 1ml amp , alamine 8.2gm+l glutanic acid 13.46gm 100 ml bottle i / v , alteplase 50mg inj , amidotrizoate meglumine; sodium amidotrizoate ( 76% ) dye 50 ml bottle , amikacin250mg / 2 ml 2 ml vial , amikacin500mg / 2 ml 2 ml vial , aminophylline 25 mg / ml 10 ml vial , amiodarone 50 mg / ml 3 ml amp , amoxicillinmg + clavulanic acid mg 1.2 gm vial , amoxicillin 500 mg + clavulanic acid100mg, inj , amphotericine b ( liposomal ) 50 mg inj , amphotericine b 50 mg inj , ampicillin500 mg vial , anti d. immunoglobulin ( monoclonal ) ( 150mcg / vial ) human anti d, , anti d. immunoglobulin ( monoclonal ) ( 300mcg / vial ) , human anti d , anti hemophillic factor viii 250 iu ( vial ) , anti hemophillic factor viii 500 iu ( vial ) , anti human thymocyte immunoglobulin 25 mg , anti rabies vaccine inj , anti scorpion venominj <120mg total protein and >150 ld50 [ mouse ] neutralizing units / vial , anti snake venom ( liquid form ) 10ml ( polyvalent ) , artesunate 60 mg / vial , ascorbic acid 100mg / ml 5ml amp ( vitamin c ) inj , atracurium25mg / ml 2.5ml amp , atropine sulphate 0.6mg / ml2ml amp , azithromycin 100mg / 5ml inj , azithromycin 500mg / 5ml inj , bendamustine 100 mg vial , benfothiamine + folic acid + mecobalamin + pregabalin + vit b6 inj , benzathine penicilline 12 lac iu / vial , betamethasone sodium phosphate 4 mg / ml 1 ml amp , bevacizumab 100 iu vial , bleomycin 15 unit vial , bortezomib 2 .5 mg vial , bortezomib 2 mg / vial , bortezomib 3 .5 mg vial , bupivacaine hcl0.5% 20 ml vial , bupivacaine hcl for spinal anaesthesia 0.5% ( heavy ) amp 4 ml amp , buprenorphine hydrochloride0.3mg base / ml 1ml amp inj , busulfan 60mg vial , butorphanol 1mg / ml 1ml amp , caffeine citrate 20 mg / ml 3 ml vial , calcium carbonate 10% 10ml amp , calcium chloride 10% 100mg / ml 10ml vial , calcium gluconate 10% 10 ml vial , carboplatin 150 mg inj , carboplatin 450 mg inj , carboprost tromethamin 250 mcg / ml 1ml amp , carmustine 100 mg vial , cefaparazone with salbactum 1.5gm ( cefaparazone 1000 mg with salbactum 500 mg ) vial , cefazolin 500 mg vial , cefepime 500 mgvial , cefepime 500mg +tazobactum 625 mg vial , cefoperazone + sulbactam 1000 mg +500 mg vial , cefoperazone 1gmvial , cefotaxime + sulbactam 1000 mg + 500 mg vial , cefotaxime sodium 1 gm / vial , cefotaxime sodium 500mg vial , ceftazidime 1gm vial , ceftazidime 250 mg inj vial , ceftazidime 500mg vial , ceftriaxone + sulbactum 1.5gm vial , ceftriaxone + tazobactum inj 1.125gm vial , ceftriaxone 1 gm / vial , ceftriaxone 500 mg / vial , cetuximab 2mg / ml 100mg / 50ml vial , cetuximab 2mg / ml 200ml / 100 ml vial , cetuximab 50mg vial , chloroquine phosphate 40mg / ml 5ml amp , chlorpheniramine maleatevial , chlorpromazine ip 25mg vial , cisplatin 10 mg vial , cisplatin 50 mg vial , cladribine 10 mg inj , clindamycin 150 mg / ml 2 ml vial , clindamycin 600mg / 4ml solution for injection 150mg / ml 4ml amp , clonidine100 mcg / ml 10 ml vial , colistimathate sodium for injection 1 million iuvial , colistimathate sodium for injection 2 million iuvial , crystalline insulin 40 iu / 10ml regular insulin 10 ml amp , cyclophosphamide 200 mg / vial , cyclophosphamide 500 mg / vial , cyclophosphamide ip 1 gm vial , cytrabine 100 mg inj , dactinomycin 0.5 mg inj , dacarbazine 200 mg inj , dacarbazine 500 mg inj , daunorubicin 20 mg / vial , daunorubicin 50 mg / vial , decitabine 50mg inj , dexamethasone sodium phosphate 4mg / 2mlinj , dexamethasone sodium phosphate ( 8mg / 2ml ( 2ml vial ) , dexmedetomidine100 mg / ml ( 1 ml amp ) , diatrizoate meglumine & diatrizoate sodium ( 37% ) vial , diatrizoic acid 60% amp , diatrizoic acid 65% amp , diazepam5 mg / ml 2 ml amp , diclofenac sodium 25 mg / ml 3 ml amp , diclofenac sodium inj for intravenous use surfactant free 1 amp , dicyclomine 10mg / ml 2 ml vial , digoxin i.p. 0.5mg / 2 ml amp , diltiazem 25mg / 5ml vial , diphtheria antitoxin1000 iu vial , dobutamine 50 mg / ml 5 ml amp , docetaxel 120mg inj , dopamine hydrochloride 40 mg / ml 5 ml amp , doxorubicin ( lyophilized ) 10 mg / vial , doxorubicin 50 mg / vial , drotaverin 40mg / 2ml amp , edaravone60 mg inj , enalapril maleate inj 1.25 mg per ml 2ml vial , enoxaparin 40mg inj , enoxaparin 60mg inj , ephedrine 30mg / ml 1ml inj , epirubicin 100mg inj , epirubicin 50mg inj , erythropoetin 4000 iuinj pfs , erythropoietin 10000iu inj 1ml pfs , erythropoietin 2000 iu inj 1ml pfs , esmolol / 40mg / ml 5 ml vial , etanercept 25mg inj , etanercept 50mg inj , ethamsylate 2ml / 125mg / amp , etiophylline + theophylline inj 220mg / 2ml amp , etomidate 2 mg / ml emulsion with mct 10ml vial , etoposide 100 mg inj , fat emulsion 20% 250 ml bottle , fentanyl 100 microgran2 ml amp , fentanyl 50 microgran 2 ml amp , filgrastim 300 mcg 1ml pfs , fludarabine 50 mg vial , fluorescein 20% 5 ml amp , flupentixol 20 mg inj , flupentixol 25 mg inj , fluphenazine 25 mg / ml 1 ml amp , frusemide 10mg / 2ml amp , g.c.s.f. 300 unit inj , ganciclovir 500 mg vial , gas gangrene antitoxin 10, 000 iu / ml 40000 iu 4ml amp , gatifloxacin vial , gemcitabine 1 gm vial , gemcitabine 1.4 gm vial , gentamycin 80mg / 2ml amp , glargine 100iu / 3ml amp , glycopyrrolate 0.2 mg / ml 1 ml amp , glycopyrrolate 0.5mg + neostigmine 2.5mg 5ml amp , haemocoagulase 1 iu inj , haloperidol 5 mg / ml 1 ml amp , haloperidol 50 mg / ml 1 ml inj , heparin5000 iu ( 1000 iu / ml5 ml vial ) , heparin 25000 iu ( 5000 iu / ml5ml vial ) , hepatitis b vaccine / 1ml , hepatitis immunoglobulin 100iu vial , human albumin 20 % / 100ml bottle , hyaluronidase 1500 iu / 2ml amp , hydrocortisone dry powder 100 mg / vial ( hydrocortisone sodium succinate inj ) , hydroxyprogesterone caproate 250mg / ml 2ml inj , hydroxypropylmethylcellulose 2% inj pre filled syringe , hyoscine butyl bromide / 20mg / 2ml amp , ifosfamide1 gm vial , ifosfamide2 gm vial , ifosfamide + mesna 1gminj , imipenem 1g vial , imipenem 1gm+cilastatin sodium 500 mg vial , infliximab 100mginj , iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml 100 ml bottle , irinotecan 100mg inj , irinotecan 40mg inj , iron sucrose 20 mg / ml 5 ml amp , isobaric levobupivacaine 0.5% inj , isoprenalin inj 1ml amp , isoxsuprine hcl5mg / ml 2ml amp , iv human immunoglobulin 5% iv ig ( 5gm / 100ml bottle, injection , ketamine hydrochloride 50 mg / ml 10 ml , labetalol 20 mg ( 5mg / 1 ml 4 ml amp ) , l asparaginase 5000iu inj , leucovorin calcium 50 mg / 5 ml vial , levetiracetam 100mg / ml 5ml amp , levosulpride inj amp , lignocaine ( preservative free ) 2% 50 ml vial , lignocaine for spinal anaesthesia lignocaine 5% +destrose 7.5% 2 ml amp heavy , lignocaine hydrochloride + adrenaline 2% + 0.005 mg / ml 30 ml vial , lignocaine hydrochloride 2% 21.3 mg / ml 30 ml vial , lignocaine / lidocaine 4%, 30 ml vial , liposomal doxorubicine 2mg / ml inj , lorazepam 2 mg / ml, 1 ml vial , lorazepam 2 mg / ml, 2 ml vial , l ornithine l aspartats10ml inj , low molecular weightdextran 40000 vial , magnesium sulphate inj50% w / v 10ml amp , meningococcal polysaccharide vaccine groupe a, c, y and w 135 combined vial , mephentermine 30 mg / ml 10 ml , meropenem 1 gm / vial , meropenem 500 mg / vial , methacarbamol 100 mg. / 10ml vial , methotrexate 15 mg / ml ( preservative free ) inj , methotrexate 50 mg / 2 ml, 2 ml vial , methyl ergometrine maleate 0.2 mg / ml, 1 ml amp , methylcobalamine ( vitamin b12 ) 500 mcg / ml, 3 ml amp , methylene blue 1% 10ml inj , methylprednisolone125mg10 ml vial , methylprednisolone 1 gm vial , methylprednisolone 40 mg / vial , methylprednisolone sodium succinate 500 mg / vial , metoclopramide 5mg / ml 2ml amp , metoprolol 5mg / ml 5ml vial , micronised progesterone 50mg / ml 2ml amp , micronized progesterone 100mg / ml2ml amp , midazolam 1mg / ml, 1 ml amp , midazolam 1mg / ml 5ml vial , milrinone 1mg / ml solution for injection / infusion , mitomycin c 40mg inj , mitoxantrone 15 mg inj , mixed.25 / 75 ( 25% insulin lispro+75% lispro insulin protamin ) 100iu / ml , mixed.30 / 70 insullin biphasic isophane40 iu / ml 10 ml vial , morphine sulphate 10mg / ml 1ml amp , multivitamin 10 ml amp , nab paclitaxel 100mg / vial , n acetyl cysteine inj 200mg / ml 10 ml amp , naloxone 0.4 mg / ml, 1 ml , neostigmine 0.5 mg / ml, 1ml amp , nikethamide amp , nitroglycerine ( glyceryl tri nitrate ) 25 mg / 5 mlamp , noradrenaline bitartrate2 mg base / 2 ml amp , octreotide 100microgram / ml solution for injection 1 ml amp , octreotide 50 microgram / ml solution for injection 1 ml amp , olanzapine10 mg inj , olanzapine depot inj , ondansetron 2 mg / ml 2 ml amp , ondansetron 2 mg / ml 4 ml amp , oxaliplatin 100mg inj , oxaliplatin 50mg inj , oxytocin 5 iu / ml, 1 ml amp , paclitaxel 100mg inj , paclitaxel 260mg inj , panitumumab 100mg / 5ml inj , pantoprazole 40 mg / vial , paracetamol 150mg / ml 2ml amp , paracetamol 2ml amp for i / v use , peg gcsf 6 mcg , pembrolizumab 100mg / 4ml ( 25mg / ml ) , pemetraxed 100 mg inj , pemetraxed 500 mg inj , penicillin v 125 mg inj , pentazocin lactate 30mg / ml 1ml amp. , pentoxiphylline 20 mg / ml , pertuzumab 30mg / ml ( 420mg / 14ml ) , pheniramine maleate ip 22.75 mg, 2 ml amp , phenobarbitone100mg / ml 1ml amp. , phenobarbitone200mg / ml 1ml amp. , phenytoin sodium50mg / ml 2ml / amp , pilocarpine 0.5 % / 1ml amp , piperacillin 4 gm + tazobactum 500 mg, vial , piperacillin tazobactum 1.125 gm vial , pneumococcal vaccine 10 ml vial , potassium chloride inj. 150mg / 10ml amp , pralidoxime20 ml vial , pregabalin inj , progesterone b.p.100mg vial , promethazine 2 ml / 2.5% vial , propofol sodium with mct / lct 1% w / v 10 mg / ml, 20 ml vial , protamine sulphate 1%, 10mg / 5ml amp , quinine sulphate 300 mg / ml, 2 ml amp , rabeprazole 20 mg vial , rabies immunoglobulin inj 300 iu / 2 ml , ranitidine 50mg / 2ml amp , remdesivir inj 100mg / vial , rituximab 100mg inj , rituximab 500mg inj , ropivacaine 0.5% 20 ml vial , ropivacaine 0.75% 4ml amp , ropivacaine 10mg / ml 2.5ml vial , ropivacaine hydrochloride0.2% 40mg / 20ml vial ( 2mg / ml ) , ropivacaine hydrochloride0.75% 150 mg / 20 ml vial ( 7.5mg / ml ) , sargramostim 500 mg inj , soda bicarbonate 10ml, 7.5% inj , sodium valproate 100 mg / ml, 5 ml , streptokinase 150000iu ( 15 lac ) amp , streptomycin 0.75 mg vial , succinyl choline 50 mg / ml, 10 ml vial , surfactant bovine ( 135 mg phopholipid per 5 ml / 5ml vial ) , tecoplanin 400mg vial , terbutaline 0.5mg / ml aml amp , teriparatide 600mcg 3 ml amp , terlipressin 1 mg / 10 ml amp , tetanus immunoglobulin usp 500 iu / vial , tetanus toxide 0.5ml ampoule , thiamine hydrochloride inj.100mg / ml 2ml vial multiple dose ( vit.b1 ) , thiopentone sodium 0.5gm powder / vial, 20 ml vial , thiopentone sodium 1 gm / vial , tigecycline, 50 mg, vial , tobramycine 80 mg vial , tocilizumab 400 mg inj , torsemide inj 2ml amp , tramadol 100 mg inj50 mg / ml, 2 ml amp , tramadol 50 mg inj , tranexamic acid 100mg inj , tranexamic acid 500 mg / 5 ml, 5 ml amp , trastuzumab 440mg inj , triamcinolone acetate 40 mg / ml 1 ml amp , trypan blue opthalmic solution 0.06% pre filled syringe , urokinase 500000 iu vial , vancomycin hydrochloride 1000 mg / vial , vancomycin hydrochloride 500 mg / vial , vasopressine40 iu / ml amp , vasopressine 20unit amp , vecuronium bromide 2 mg / ml, 2 ml amp , verapamil hydrochloride 2.5 mg / ml amp , vinblastine 10 mg / 10 ml amp , vincristine 1 mg / ml, 1 ml vial , vinorelbin 10 mg inj , vinorolbine 50mg inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg + ascorbic acid inj , vit. cynocobalamin 500mcg +folic acid 15mg+niacinamide 200 mg inj , vit. methylcobalamin 1500 mcg +folic acid 0.7mg+ niacinamide12 mg inj , vitamin b complex inj , vitamin k 1ml, 10mg / ml , voriconazole 10 mg / ml, 200 mg / vial , water for injection 10 ml amp , zoledronic acid 4 mg / 100 ml vial , zuclopenthixol acuphase 50 mg inj , zuclopenthixol decanoate 200 mg inj , amino acid infusion 5 %100 ml , amino acids 10% w / vin glass bottle 500ml, , aminoacid ( essential ) 10% 100 ml ffs bottle , balanced crystalloid solution 500 ml bottle , ciprofloxacin200 mg / 100 ml ffs bottle , dextrose 40% 100 ml bottle , dextrose 5 % with normal saline 0.45% 500 ml glass bottel with rubber cork , dextrose saline ( dns ) 5% + 0.9% 500 ml ffs bottle , dextrose, 25% 100 ml ffs bottle , dextrose, d 10 10% 500 ml ffs bottle , dextrose, d 5, 5% 500 ml ffs bottle , dextrose, d 50 50% 100 ml ffs bottle , electrolyte m ( multi electrolyte with 5% dextrose iv injection type iii ip ) , type iii ip 500 ml ffs bottle , electrolyte p ( multiple electrolytes & dextrose injection type i ip ) type i ip 500 ml ffs bottle , fat emulsion 20% ( 250 ) ml , fluconazole 100ml bottle. 2mg / ml. , glutamine dipeptide 100ml bottle , glycine irrigation solution ip 3000 ml bottle , hydroxyethylstarch 6% solution with sodium chloride 0.9% iv infusion 500 ml ffs bottle , levofloxacin 500 mg / 100 mlffs bottle , linezolid 200 mg / 100ml 300 ml bottle , mannitol20%100 ml ffs bottle , mannitol 20% 350ml , metronidazole 500 mg / 100 mlffs bottle , normal saline 0.9% 100 ml ffs bottle , normal saline 0.9% 3 ltrs bottle , normal saline 0.9% 500 ml ffs bottle , normal saline 1.6% 500 ml bottle , normal saline 3% 100 ml ffs bottle , normal saline glass bottle 100ml , normal saline glass bottle 500ml , ofloxacin 200mg / 100 ml bottle , omega 3 fatty acid 100 ml bottle , paracetamol1000 mg 100 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml ffs bottle , ringer lactatei / v 0.24 % v / v of lactic acid ( eq. to0.32% w / v of sodium lactate ) , 0.6 % w / v sodium chloride, 0.04 %w / v potassium chloride and 0.027 % w / v calcium chloride 500 ml glass bottle , sodium chloride hyper tonicn / 2 ( 0.45% ) 500 ml ffs bottle , sodium chloride ( 1 / 2 n ) + dextrose 0.45% + 5% 500 ml ffs bottle , total parenteral nutrition 1000 ml with 763 kcal dextrose 15% w / v, amino acids 10% w / v with electrolytes & intravenous fat emultion triglycerides 20% w / v ) ( all in one inthree chamber bag ) , 1000ml , tpn ( total parenteral nutrition ) including carbohydrate + proteins + fats solution ) 15% dextrose 10% amino acids 2000 ml , budesonide respules 0.5mg , desflurane 240ml bottle , formeterol + budesonide 120 mdi respules , ipratropium bromide 250 mcg / ml amp , ipratropium bromide 40 mcg + levosalbutamol200 mcg respules , isofluran 250 ml bottle , salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml ( 2.5 ml amp ) , ampule , salmeterol 25 mcg + fluticasone 250 mcg 120 mdi , sevoflorane 250ml. , 6 mercaptopurine , 50mg , acamprosate, 333 mg , aceclofenac 100mg tablet , aceclofenac 100mg+paracetamol 325mg , tablet , aceclofenac 100mg+paracetamol 325mg + chlorzoxazone 250mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab ( ) , tablet , aceclofenac 100mg+paracetamol 500mg , tablet , acenocoumarol2 mg tab , acetazolamide 250 mg tab , acyclovir400 mg , acyclovir800 mg , afatinib 40 mg , agomelantine 025 mg tab , albendazole 400 mg , albendazole 400 mg + ivermectin 6 mg tab , alendronate 70 mg , alfuzocin hcl 10mg , alfuzosin 10mg+dutasteride 0.5 mg , allopurinol 100 mg , alprazolam 0.25 mg , amiodarone 200 mg , amisulpride 100 mg , amisulpride 200 mg , amisulpride 50 mg , amitriptyline 25 mg , amitriptyline 50 mg , amitriptyline 75 mg , amlodipine 2.5 mg , amlodipine 5 mg , amlodipine 10 mg tab , amolodipine 5mg +atenolol 50mg , anastrozole1mg , aripiprazole 10 mg , aripiprazole 15 mg , aripiprazole 30 mg , artesunate 50 mg+sulphadoxine 500 mg+pyrimethamine 25 mg tab , aspirin 150 mg , aspirin 75 mg , atenolol 25 mg tab , atenolol 50 mg , atomoxetine 10 mg tab , atomoxetine 25 mg tab , atorvastatin 10 mg , atorvastatin 20 mg , atorvastatin 40 mg , axitinib 5mg , azathioprine 50 mg tab , azithromycin500 mg , azithromycin 250 mg tab , azithromycin+fluconazole+secnidazole ( 1gm+150mg+1gm ) tab , baclofen 10 mg , baclofen extanded release40 mg , baclofenextanded release 30 mg , baclofen extanded release 20 mg , benfothiamin 150mg , betahistine 16 mg tab , betahistine 8 mg tab , betamethasone 0.5 mg , bicalutamide 50 mg , bisacodyl5 mg , blonanserin 2 mg , blonanserin 4 mg , buprinorphine 4mg , buprinorphine 8 mg , bupropion150 mg , bupropion300 , buspirone 10 mg , buspirone 5 mg , cabargolin 0.25 mg , calcium acetate 667 mg tab , calcium carbonate 500 mg tab , calcium d3 / 500mg , capecitabine 500mg , carbamazepine200 mg , carbamazepine sr100 mg , carbamazepine sr200 mg , carbamazepine sr400 mg , carbimazole 5mg , carvedilol6.5 mg. , carvedilol 3.125 mg tab , cefixim 200 mg + clavulanic acid 125 mg , cefixime 100 mg , cefixime 200 mg , cefodoxime 200mg tab , cefpodoxime50 mg , cefuroxime 200 mg , cefuroxime 500 mg , cetirizine10 mg , chlordizepoxide 10mg , chlordizepoxide 25mg , chloroquine phosphatetab. 250 mg , chlorpheniramine maleate tab 4 mg , chlorpromazine50mg , chlorpromazine 100 mg , chlorthalidon 50 mg tab , chymotrypsin & trypsin tab , cinnarizine 25 mg tab , cinnarizine 5 mg tab. , ciprofloxacin500 mg , clarithromycin 250 mg , clindamycin 300mg , clindamycin 600mg , clobazam 10 mg , clobazam 5 mg , clomipramine 50mg , clonazepam 0.25 mg tab , clonazepam 0.5 mg tab , clonazepam 1 mg , clonazepam 2 mg , clonidine 100 mcg tab , clopidogrel75 mg , clopidogrel 150mg+ aspirin 75 mg , clotrimazole vaginal 500mg tab , clozapine 100 mg , clozapine 25 mg , clozapine 50 mg , coenzyme q , crizotinib 250mg , cyclophosphamide 50 mg tab , dasatinib 50 mg , deferasirox dispersible 250 mg tab , deferasirox dispersible 500 mg tab , deflazacort 30 mg tab , dexamethasone 4 mg tab , diazepam10 mg , diazepam5 mg , diclofenac 50mg + paracetamol 325mg + serratiopeptidase 10mg tab , diclofenac 50mg + paracetamole 500mg , diclofenac 50mg + serrtiopeptidase , diclofenac sodium 50 mg , dicyclomine tab 10 mg. , digoxin 0.25 mg , diltiazem 30mg , diphenylhydramine 50 mg , disulfiram 250 mg , divalproex sodium 250 mg , domperidone 10 mg tab , domperidone+ranitidine 150mg tab , donepezil10 mg , donepezil 5 mg , doxophylline400 mg , duloxetine 20 mg tab , duloxetine 30 mg tab , dydrogesterone 10mg , empagliflozin 25mg tablet , enalapril maleate 2.5 mg , enalapril maleate 5 mg , erlotinib 100mg , erlotinib 150mg , escitalopram 10 mg , escitalopram 20 mg , escitalopram 5 mg , ethamsylate 500 mg , etizolam 0.5mg , etophylline 77 mg+ theophyllin 23 mg , etoposide 50 mg , everolimus 2.5mg / 5mg / 10mg , farmalin 1gm tab ( 100 tab per box ) , febuxostat 40 mg , ferrous ascorbate 100 mg tab ( elemental iron +folic acid 1.5 mg tab , ferrous sulphate tab. 200mg ( equivalent to 60mg elemental iron ) , flavoxate hcl 200mg , fluconazole 150 mg , fludrocortisone 0.1mg tab , flunarizine 10 mg , flunarizine 5 mg , fluvoxamine 50 mg , folic acid 5 mg , frusemide40 mg , gabapentin 300 mg. , gabapentine 100 mg , gefitinib 250mg , glibenclamide 2.5mg tab , glibenclamide 5mg tab , gliclazide 80 mg , glimeperide2 mg , glimeperide 1 mg , glimipride 1mg+metformine 500mg , glucagon 0.1mg tablet , glyceryl trinitrate 0.5 mg sublingual tab , haloperidol 1.5 mg , haloperidol 10 mg , haloperidol 5 mg , hydrochlorothiazide 12.5 mg , hydrochlorothiazide 25 mg , hydrocortisone 10 mg , hydroxychloroquine sulphate 400 mg , hydroxychloroquine ( 200 mg ) , tablet , hyoscine butylbromide tab 10mg , ibuprofen400 mg , ibuprofen 400 mg + paracetamol 325 mg , imatinib 100mg , imatinib 400 mg , imipramine hcl 25 mg , imipramine hcl 75 mg , iron folic acid tab ferous sulphate dessicated ip 333 335mg equivalent to 100mg of elemental iron +folic acid ip 0.5mg tab ferrous sulphate of elemental iron +folic acid ip 0.5tab ferrous sulphate dessicated ip mg equivalent to 20mg , iso sorbitrate dinitrate sublingual5mg , isosorbide 5 mononitrate20 mg , ivermectin 12 mg , l carnosine , labetalol 100mg , lacosamide 50 mg tab , lactobacillus tab 60 million spores , lamotrigine 100 mg , lamotrigine dt 50 mg tab , lapatinib 250 mg , lenalidomide 10 mg , lenalidomide 25mg , letrozole 2.5mg , levetiracetam 250 mg , levetiracetam 500 mg , levocetirizine 5mg tab , levocetirizine 5mg+ monteleukast 10 mg tab , levodopa + carbidopa 100+25mg , levofloxacin tab 500mg , linezolid600mg , lithium carbonate 300 mg , lithium carbonate 400 mg , lorazepam1 mg , lorazepam 2mg tab , lorcaserine 10 mg tab , losartan 50 mg tab , losartan 50 mg+hydroclorothiazide 12.5 mg tab , lurasidone 20 , lurasidone 40 , magnesium oxide 200 mg , mebendazole 100 mg tab , mefenamic acid + dicyclomine tab ( 250 mg + 10 mg ) , tablet , mefenamic acid + drotaverine hcl tab ( 250 mg + 80 mg ) , tablet , megestrol acetate 40mg , melatonin 3mg , melatonin 6mg , memantine 10 mg , mesalamine ( 5 aminosalicylic acid ) 400 mg tab , metformin 500 mg , metformin sr 1gm tablet , metformine 500 mg + glimipride 2 mg tab , metformine 500 mg+ gliclazide 80 mg tab , metformine 500 mg+glibenclamide 5 mg tab , methimazole 10 mg tab , methocarbamol500 mg. , methotrexate10 mg , methotrexate2.5 mg , methotrexate7.5 mg , methyl prednisolone16 mg , methyl prednisolone 4 mg tab , methyl prednisolone 8 mg tab , methylcobalamin500 mcg , methyldopa 250 mg tab , methylphenidate 10 mg , methylphenidate 20 mg , methylphenidate 5 mg , metoclopramide05 mg , metoclopramide 10 mg , metolazone 5 mg , metoprolol tab 50 mg , metronidazol 400mg , mifepristone 200mg ( 1 tab ) +misoprostol 200mcg ( 4 tab ) ( combipack ) , tab. mtp kit , mirtazapine15 mg , mirtazapine30 mg , mirtazapine7.5 mg , misoprostol 200 mg , modafinil200 , modafinil 100 , morphine 10 , multivitamin tab nfi formula sugar coated vita 2500 iu, vit b12 , vit b 6, 0.5 mg, vit c 50mg vit d3 200iu, niacinamide 25mg folic acid 0.2mg ( with approximateoverages ) , mycophenolate mofetil, 500 mg , n acetyl cysteine 600 mg , naltrexone, 50 mg , nicorandil 5 mg tab , nicoumalone 2mg tab , nifedepine 10mg , nifedepine r 20mg , nilotinib 200mg , nitazoxanide 200 mg , nitrofurantoin ip , 100 mg , norfloxacin400 mg , norfloxacine 400 mg + tinidazole 600 mg , ofloxacin 200mg +tinidazole 600mg tab , olanzapine 5 mg , olanzapine10 mg , olanzapine2.5 mg , olanzapine20 mg , olanzapine7.5 mg , olmesartan40mg , ondansetron 4 mg , ondansetron 8mg , orlistate 120 mg tab , orlistate 60 mg tab , ornidazole500 mg , oxcarbazapine 300mg tab , oxcarbazapine 600mg tab , oxcarbazepine 150 mg , paliperidone 1.5 mg , paliperidone 3 mg , pantoprazole 40 mg , pantoprazole 40 mg+ domperidon 10 mg , paracetamol 500 mg , paracetamol 650mg tab , paroxetine cr 12.5 mg , pazopanib 200mg / 400mg , penicillin v 250 mg tab ( phenoxymethyl penicillin potassium ) , pentoxifylline 400mg , perampanel 4mg , phenobarbitone 30 mg. , phenobarbitone 60 mg. , phenytoin sodium100 mg , pioglitazone 15 mg tab , pioglitazone 30 mg tab , piracetam 400 mg , piracetam 800 mg , pramipexol 0.26 sr , pramipexol 0.50mg , prazosin 5 mg , prednisolone 10 mg , prednisolone 5 mg , pregabalin 75 mg tab , primaquine7.5 mg , primaquine 15 mg tab , procyclidine 5 mg , promethazine 2 5 mg , propranolol la 40 mg , propranolol10 mg , propranolol20 mg , propylthiouracil 50mg , pyridoxine 40 mg tab , quetiapine 100 mg , quetiapine 200 mg , quetiapine 50 mg , quinine sulphate 300 mg , rabeprazole 20 mg tab , racecadotril 100mg , ramipril 2.5 mg tab , ramipril 5 mg tab , ranitidine 150 mg tab , resperidon 0.5mg , resperidon 2 mg , resperidon 4 mg , rivaroxaban 20 mg tab , rosuvastatin. 10 mg , sacubitril plus valsartan 50mg , secnidazole 500 mg tab , sertraline 100 mg , sertraline 50 mg , sildenafil 50 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sodium valproate 300 mg , sodium valproate200 mg , sodium valproate 500 mg , sorafinib 200mg , spironolactone 100 mg tab , spironolactone 25 mg , spironolactone+frusemide 20mg +50mg , sulfamethoxazole and trimethoprim ( 100mg+ 20mg ) tab , sulfamethoxazole and trimethoprim ( 800mg+ 160mg ) tab , sunitinib 50 mg , tadalafil 10 mg , tadalafil 20 , tamoxifen 10 mg , tamoxifen 20mg , tamsulosin 0.4mg , tamsulosin+dutasteride 0.4mg+0.5mg , telmisartan40 mg. , telmisartan hydrochlorthiazide 40mg+12.5mg tab , terbutaline sulphate 2.5mg tab , tetrabenazine 20 mg tab , thiamine 100mg , thiamine 75mg , thyroxine 88mcg tablet , thyroxine sodium12.5 mcg , thyroxine sodium 137 mcg , thyroxine sodium150 mcg , thyroxine sodium 62.5 mcg , thyroxine sodium 100 mcg , thyroxine sodium 25 mcg , thyroxine sodium 50 mcg , thyroxine sodium 75 mcg , tianeptine 12.5 mg , topiramate 100 mg tab , topiramate 25 mg , topiramate 50 mg , topotecan 1 mg , torasemide10 mg , tramadol – 100 mg tab , tramadol – 50 mg , tranexamic acid500 mg , trifluoperazine5 mg , trihexyphenydyl hydrochloride 2mg , ursodeoxycolic acid300 mg , venlafaxine sr 150 mg , venlafaxine sr 75 mg , venlafaxine 37 , venlafaxine 75 , verapamil40 mg , vilazodon 20 , vilazodon 40 , vildagliptin 50 mg +metformin 500 mg tab , vildagliptin 50 mg tab , vit b complex tab. nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg, niacinamide 25mg, calciuym pantothenate 1mg ( with appropriate overges ) , vit d3 60000 k tab , vitamin c 500 mg ( ascorbic acid ) , voglibose 0.2mg tablet , voglibose 0.3 mg tab , voriconazole 200 mg , vortioxetine 20mg , vortioxetine10mg , vortioxetine5 mg , warfarin 5 mg tab , zinc sulphate ( dispersible ) 20 mg , zolpidem 10 mg tab , zonisamide 100 mg tab , zonisamide 50 mg tab , zyloric acid 100 mg , aceborophylline 100 mg , amoxicillin 250 mg cap , amoxycilline – 500 mg , amoxycilline + clavulanic acid 375 mg cap. , amoxycilline + clavulanic acid 625 mg cap. , ampicillin 250mg+ cloxacillin250mg , ampicilline – 500 mg , cyclosporine 100 mg , cyclosporine 50 mg , deferiprone 500 mg cap. , doxycycline 100 mg , fluoxetine 40 mg , fluoxetine bp 20 mg , hydroxy urea 500 mg cap. , imatinib mesylate 100 mg , itraconazole 100 mg , ivabradin 5mg , methylcobalamin 1500 mcg+alpha lipoic acid 100 mg+folic acid1.5 mcg thiamine mononitrate 10 mg ( pyridoxine hcl 3 mg ) cap. , omeprazole 20 mg , oseltamivir ( 45mg ) , capsule , oseltamivir ( 75mg ) , capsule , palbociclib 100 mg cap , palbociclib 125 mg cap , palbociclib 75 mg cap , pregabalin 75 mg + methylcobalamin 750 mcg , rifaximine 400 mg , sildenafil 20mg , temozolamide 100 mg , temozolamide 250 mg , vitamine400 mg , acyclovir 3% , atropine sulphate 1% 5 ml vial , carboxymethylcellulose solu. eye drop 1% , carboxymethylcellulose solu. eye drop 0.5% , ciprofloxacin eye drop 0.3% 10 ml , fluromethanol eye drop , gentamycin eye drop , homotropine drop 2% eye drop , lignocaine hcl 4% eye drop , loteprednol eye drop , natamycin eye drop , nepafenac ophthalmic solution , methyl cellulose / visco elastic , moxifloxacin 0.5% eye drop , moxifloxacin +prednisolone eye drope , ofloxacin 0.3% 5 ml vial , polyethelene glycol 400 & propylene glycol ophthalmic solution 10ml , pilocarpine eye drops 2% , polyvinyl alcohol 1.4% 5 ml , prednisoloneeye / drop. , proparacaine , sodium chloride opthalmic solution 5% eye drop , timolol maleate 0.5% 5 ml vial , tobramycin 0.3% 5ml eye drop , tropicamide 1% 5 ml vial , topicamide +phenylephrine eye drop , olopatidine hydrochloride ophthalmic solution 0.1% , benzocaine 2.7 w / v + chlorbutol 5% w / v +paradichlorobenzene 2% w / v+ turpentine oil 15% w / v ear drop , beclomethasone ( 0.025% ) + clotrimazole 1% +neomycin sulphate 0.5%5 ml ear drop , tobramycin eye oint.3gm tube , acyclovir 3% eye oint.5 gm tube , atropine eye oint. 3gm tube , chloramphenicol eye ointment 5 gm tube , ciprofloxacin eye ointment 5 gm tube , hydroxypropylmethylcellulose 2% w / v ophthalmic solution ocular lubricant 5gm ointment , diclofenac gel 1% 30 gm , ecg gel 250ml bottle , lignocain jelly 2% , oxetacaine 10mg + aluminium hydroxide 291mg + milk of magnesia 98 mg per 5ml 200 ml bottle , prostaglandin e2 0.5 mg 3 gm pre filled syringe , ultra sonograph gel 250ml bottle , white petroleum jelly kg , acyclovir5%, 5 gm , beclomethasone+ clotrimazole +neomycin sulphate cream , betamethasone valerate ointment 0.1%, 15 gm tube , betamethasone valerate cream 0.05% 15gm , clobetasol propionate 0.05%, 15 gm tube , clotrimazole 2%w / w 15 gm , fusidic acid 2%, 15 gm , fluconazole ointment 20 gm tube , human placental extract , mupirocin 2%, 15 gm , magnesium sulphate, sulphacetamide, urea, proflavin ( in glycerine base ) ointment75 gm , neomycin sulphate 5 mg + bacitracin zinc 500 iu / gm, 15 gm , papin urea 15 gm tube , povidone iodine 5 % w / w + metronidazole 1 % w / w, 15 gm tube , povidone iodine 5%, 250 gm , povidone iodine 7.5%, 500 gm , salicylic acid 2%, 30 gm , silver sulphadiazine cream usp 1% w / w 250gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 250 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 100 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 50 gm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver 25 gm , papain urea and silk protein based debriding ointment and cream 100 gm , papain urea and silk protein based debriding ointment and cream 50 gm , papain urea and silk protein based debriding ointment and cream 25 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 25gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 50 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 100 gm , povidone iodine and silk protein based topical antiseptic and wound healing ointment 250gm , silver nitrate hydrogel wound dressing 25gm , centella asiatica extract based skin moisturization and antiscar gel 30gm , mct oil 100ml bottle , mct oil 100ml bottle , paracetamol suppository , lactobacillus, 150 million spores, , l arginine sachet 10gm , hmf1 gm sachet , orodispersible probiotic sachet , ors who powder glucose anhydrous 13.5g / l, sodium chloride 2.6g / l, potassium chloride 1.5g / l, trisodium citrate 2.9g / l , formula milk for infants 500gm , potassium permegnet powder 400 gm pkt , neomycin sulphate powder 5gm , povidone iodine powder 5% , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 100 gm , silk protein andnano silver based microbicidal sterile wound dressing dusting powder 50 gm , silk protein and antimicrobial nano silver based surgical particle wound dressing 5ml vial , silk protein and antimicrobial nano silver based surgical particle wound dressing 10ml vial , framycetin sulphate 1% w / w 30 gm tube , permethrin5% w / v 30gm , permethrin 5% 60 ml lotion , calamini lotion 50 ml bottle , alcoholic handrub with triple action:50%2 propano+25%1.propanol+2.5% chx+0.5 triclosan.500 ml , antiseptic hospital concentrate contdaining 20% chlorohexidine soln ip 7.5% v / v cetrimide ip 15%w / v iso peopyl alchohol 6 8% 1000ml. , citric acid 500 ml bottle , compound benzointincture, benzoin, aloe, storax, tolu balsam and enough alcohol to make a tincture ( 74 80% alcohol ) , 100 ml , feracrylum solution 1% 100 ml , formaldehyde solution37% acq. 450 ml bottle , glutaral dehyde solution 2% w / v stabilized 5 ltr cans , glycerine 500ml bottle , glycerine enema , hand wash solution ( sol.isoprapanol, propanol , mecetronium, skin care additives ) 500 ml bottle , hydrogen peroxide solution 20% 500 ml bottle , sodium hypochloride solution 5% 5 ltr , liquid paraffin ip 500ml bottle , povidone iodine ( surgical scrub ) , 7.5%, 500 ml bottle , povidone iodine, 5 %, 500 ml bottle , surface & environmental disinfectant each 100 gm contains: 1.6 dihydroxy, 2 5 dioxahexane 11.2 g. glutaraldehyde 5.0 g. benzalkonium chloride ip 5.0 g.5 ltr , topical heparin solution 5ml vial , aluminium hydro gel syp 100ml bottle , albendazole suspension 200 mg / 5ml bottle , ambroxol 15mg + terbutaline 1.25mg+ guaiphenesin 50mg, 100ml bottle , amoxicillin 125mg / 5ml 30ml bottle syp , amoxicillin and clavulanic acid 200+28.5mg suspension 30 ml bottle syp , azithromycin 200mg / 5ml suspension 15 ml bottle , bromhexine hydrochloride syp. 4 mg / 5ml ( bottle ) , calcium carbonate with vitamin d3 and minerals like phosphorus, zinc, magnesium syp 100ml bottle , calcium phosphate, 2:1 ratio, 100 ml bottle , cefixime , 100 mg / 5 ml, 30 ml bottle , cetirizine, 5 mg / 5 ml , 60 ml bottle , chloroquine phosphate , 160 mg / 10 ml ( 50 mg / 5 ml base ) , 60 ml bottle , ciprofloxacin 125mg / 5ml syp 60 ml bottle , co trimoxazole 30 ml , cyclosporine 50 ml syp , cyproheptadine hcl 2 mg + tricholine citrate 275 mg, 200 mlbottle , dextromethorphan 100 mg ( bottle ) , diphenhydramine 14.08mg+ammonium chloride 138mg +sodium citrate 57.03mg / 5 ml , di sodium hydrogen citrate 200ml bottle , domperidon suspension 1mg / ml 30 ml bottle , etiophylline + theophylline pediatric syp. ( 46.5+14mg / 5ml ) 60 ml bottle , glycerol 100ml , ibuprofen+paracetamol 60ml , iron200ml , lactulose , 3.35 gm / 5 ml , 100 ml bottle , levetiracetam 100 ml bottle , metronidazole 200mg / 5ml suspension 60ml bottle , milk of megnasia + liquid paraffine 100 ml , nitazoxanide 100mg / 5ml 30 ml bottle , norfloxacine suspension ( 30 ml bottle ) , ofloxacin suspension 50mg / 5ml 60ml , ondansetrone 30ml. 2mg / 5ml. , paracetamol oral solution 150mg / ml 15 ml bottle with dropper , paracetamol syrup / suspension 125 mg / 5ml ( 60ml bottle ) , phenobarbitone syp 30ml. 20mg / 5ml. , phenytoin sodium suspension 30mg / 5ml 100 ml bottle , potassium chloride syp 100 ml bottle , salbutamol sulphate , 2 mg / 5 ml , 60 ml bottle , sodium valproate , 200 mg / 5 ml , 100 ml bottle , sucralfate100 ml , sulfamethoxazole and trimethoprim suspension ( 200mg+ 40mg / 5ml ) 100 ml bottle , vitamin a syp 100000 unit / ml ( 100 ml bottle ) , vitamin b complex, nfi formula, 100 ml bottle , zinc 20mg / 5ml 30 ml bottle , multivitamin multimineral with antioxidant syp200 ml , budesonide nasal spray , fluticasone nasal spray , lignocaine spray 10% , xylometazolin 0.1% nasal drop 10 ml vial , saline nasal spray 20 ml , methylcobalamin nasal spray 250 mcg , saline nasal gel 15 gm tube , saline nasal wash 3gm kit , h2o2 mouth gargle 3% , povidone iodine mouth gargle 2% w / v 100 ml , chlorhexidine mouth wash 50 ml bottle , mouth wash 0.2% 50 ml , kmno4 mouth wash , mouth paint clotrimazole 1%15 ml , abdominal binder no 34 , abdominal drain set 28 no. , abdominal drain set 32 no , absorable cotton roll, net 500gm , absorbable gelatine spongip 80mmx50mmx10mm , accessory spikes , adhesive plaster 7.5 cm x 10 mtrs , adult diaper size l & xl , ag ion impregnated central venous double lumen polyurethane catheter, 7.5 fr, g 16x18 length 16cm , ag ion impregnated central venous triple lumen polyurethane catheter, 7.5 fr, g 14x18x18 length 16cm , ag ion impregnated triple lumen catheter for haemodialysis, fr 12, l 15cm, with polyurethan extention tube, flow rate per lumen – 320ml / min , air bed mattress with complete set , alcohal based hand sanitizer 500ml bottle with dispenser ) , ambu bag adult , ambu bag pediatric , anesthesia kit spinal & epidural with balloon indicator lor syringe type 16g / 25g ( 80mm*113mm / 90mm*123mm ) , 18g / 27g ( 80mm*113mm / 90mm*123mm ) , antimicrobial , liquid parafin based silver sulphate / chlorhexidineantiseptic tulle10cmx12cm , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 18x18, l 15 / 16cm. peadiatric , antimicrobial double lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 18x18, l 15 / 16cm. , antimicrobial incise drape 3 meter , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 3 5, g 16*18x18, l 15 / 16cm. peadiatric , antimicrobial triple lumen polyurethane cvc catheter kit with rollerson syringe, fr 5 7, g 16*18x18, l 15 / 16cm. , armored cuffed tube made of 100% silicon, radio opaque, should have prefilled stylet mounted connector, piot balloon with universal port. size. fr 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5 6, 6.5, 7, 7.5, 8, 8.5, 9 should be fda / ce approved , artery catheter , av blood lines with av pressure transducer ( acceptable for fitting to all standard dialyzer ) with side tubing ( for heparinization and av pressure monitorig ) blood tubing set dialysis , barium sulphate powder susp 95% w / v powder ( hd ) 95% 400gm , bionet connector , biopsy forceps type with / without spike / hot biopsy, length : 110cm / 160 cm / 210 cm, sterile for single use only, diameter – 1.8 mm / 2.5 mm as ordered , biopsy gun 16 20 gauze , bipap mask size large , bipap mask size medium , bipap mask size small , bipolar cable , bipolar forceps cable , bis monitor electrode , black thread ( stitching ) big , bleaching powder gr ii 25 kg bag , blood administration ( transfussion ) set , blood bag double 350 ml , blood bag double 350 ml cpd solu , blood bag double 350 ml with sagam , blood bag quadruple 350 ml top bottom with cpd sagam solu , blood bag quadruple 450 ml top bottom with cpd sagam solu , blood bag single 350 ml , blood bag transfer 350 ml , blood bag triple 350 ml , blood bag triple 350 ml sagam , blood collection tube clot activator with rubber cap , blood culture bottles , blood transfusion set double moldedchamber without airway , blood transfusion set single molded chamber without airway , bone marrow aspiration needles ( 14 ) , bone marrow aspiration needles ( 15 ) , bone marrow aspiration needles ( 16 ) , bone marrow aspiration needles13 g , bone marrow biopsy needle , bone wax , bp cuff adult & pediatric , camera cover disposable , cannula fixer set , carbolic acid 500 ml , c arm cover disposable , catheter mount adult size , catheter mount pediatric size , catheter single lumen4.7 no , catheter single lumen6.6 no , catheter single lumen7.7 no , catheter double lumen7.7 no , cautery pencil disposable , cautery platedisposable , central line double lumen 16 fr , central line single lumen , cerebral catheter reservoir 12mm dia chamber , cerebral catheter reservoir 18mm dia chamber , chest drainage catheter size: fg20 to fg40 , chest drainage catheter size: fg20 to fg40 with trocar , colostomy kit , condom catheter , cord clamp , craniotomy cutter blade , craniotomy drape ( 1.6 x 3.2 mtrs ) , crepe bandage 2 , crepe bandage 4 , crepe bandage 6 , cresol with soap solution5ltr jar , cvc line double lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7fr, g 16x16 length 15cm , cvc line triple lumen polyurethane catheter ( flexon material ) with bls introducer and nitinol j guide wire, 7.5 fr, g 14x18x18, length 15cm, 20cm ( anti microbial coated ) , cvl dressing10 cm*12 cm pad for central line , cvl dressing7 cm* 8.5 cm for central line , cvp manometer , cylinder connection nut , cylinder key , cylinder spanner , d.j.stent 5 fr, 6 fr , 3fr, 4fr , dialyser 1.5 / 1.6 dialyzers multiple use made of polysulphone or polyethersulfone low / middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps ( for dialysate inlet utlet for safer storage openable caps ( red and blue ) hi quality sterilisation procedure using gamma radiation , disposable eye shield u / v light protector for infants & neonates. sterile single pack. , disposable face mask triple layer ( standard ) , disposable hivfull protection kit , disposable n95 mask , disposable needle 18g ( single use ) , disposable needle 18g 1 1 / 2 ( single use ) , disposable needle 20g ( single use ) , disposable needle 22g ( single use ) , disposable needle 23g ( single use ) , disposable needle 24g ( single use ) , disposable needle no 26gx 1 1 / 2 , disposable needle no 26gx1 / 2 , disposable paper gloves , disposable spinal needle 18 , disposable spinal needle 22 , disposable spinal needle 23 , disposable spinal needle 24 , disposable spinal needle 25 , disposable sterile gown , disposable suction catheter all size , disposable surgeon cap , distilled water 5 lit. , double lumen peripherally inserted central venous silicon catheter ( 3fr, 4fr, 4.5fr, 5fr ) length 60cm , double lumen peripherally inserted central venous silicon catheter ( 7fr, 9fr, 11fr, 14fr ) length 90cm, with subcutaneous cuff for long term venous access , drap sheeth 120cm x 210cm sterile , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 10x10cm. , dry collagen patch , non adhesive absorbalbe porus lyophilized fish origin collogen 30x30cm. , ear cotton swab , ecg disposable electrode , ecg paper 80mmx20 mtr roll , ecg paper computerized triple channel 20m , edta tube , elastic adhesive bandage 10cm x 4 , elastic adhesive bandage 10cm x 6 , elastomeric pump for post operative analgesia , endotracheal tube cuffed4 , endotracheal tube cuffed5 , 5.5 , endotracheal tube cuffed6 , endotracheal tube cuffed6.5 , endotracheal tube cuffed7 , endotracheal tube cuffedsize 9.5 , endotracheal tube cuffedsize7.5 , endotracheal tube cuffed 3.0 , endotracheal tube cuffed 3.5 , endotracheal tube cuffed size8.5 , endotracheal tube cuffed size 8 , endotracheal tube cuffed size 9 , endotracheal tube with secondary lumen for surfactant therapy, size 2, 2.5, 3, 3.5, 4, 4.5 , endotracheal tubes plain without cuff size 2, 2.5, 3, 3.5, 4, 4.5 , epidural kit ( needle & catheter 16g, ) , epidural kit ( needle & catheter 18g ) , epidural kit ( needle & catheter 19g, ) , epidural needle , examination gloves sizesmall ( 100 pcs / pkt ) , examination gloves size large ( 100 pcs / pkt ) , examination gloves size medium ( 100 pcs / pkt ) , exchange transfusion catheter with four way adaptor size 4cm, l 40 cm , extention line 100cm , extention line 10cm , extention line 150cm , extention line 200 cm , extention line 50cm , extra ventricular drain ( evd ) , feeding tube size 3, 4, 5, , feeding tube size 6, 7, 8, 9, 10, 12, 14 , flexo metallic tube no 6, 6.5, 7, 7.5, 8, 8.5 , fluorescein strips pkt , fogharty catheter 5fr , foley balloon catheter three way ( a ) fg 16, 18, 20, 22 , foley catheter size 12 2 way , foley catheter size 14 two way , foley catheter size 16 two way , foley catheter size 18 two way , foley catheter size 20 two way , foley urinary catheter size 8 10 pediatrics , gasket for humidifier bottel , gasket forvaccume jar 1000 ml , gasket forvaccume jar 600 ml , gigli saw wire , glass slide iso mark no 12mm , glass tube 125x150 , glucometer strips pkt ( 50 strip / pkt ) , guedel airway all size soft and smooth , guide wire 0.35 no , guide wire 0.38 no , guide wire 150cm staight tip , guide wire 80cm. , halogen bulb holder ( heavy duty ) , hemodialysis fluid for bicarb made ( part a 10 ltr + part b 500gm ) , hernia flat mesh size: 10x15 , hernia flat mesh size: 15x15 , hernia flat mesh size: 15x20 , hernia flat mesh size: 3x5 , hernia flat mesh size: 6x6 , hme filter , humbysknife disposable blade , hydrocephalus shunt medium pressur ( vp shunt ) , icd bag , implantable pain port with epidural catheter for long term pain management , incubating laryngeal mask airway 4, 5 , insulin syringe , intraocular lens 14 30d dioptre , intravenous drip set adult size , intravenous drip set pediatric size , introducer sheath 6fr , iv .regulator set ( control drop set ) , iv cannula size18g , iv cannula size20g , iv cannula size22g , iv cannula size24g , iv cannula size26g , iv cannula size 16 g , j r c bag 1.5 ltr , 1 ltr , j r c bag 1 / 2 ltr 500ml , j tip 0.035 mm guidewire , jugularcatheter 12 fr ( adult ) , jugular catheter 8fr ( pediatric ) , k 90 catheter , kellys pad disposable , laryngeal mask airway classic 1, 1.5, 2, 2.5, 3, 4, 5 , liga clip 200mm, 300mm, 400mm , lma reusable pro seal second generation with gastric drain tube and reinforcement airway tube. size 1, 1.5, 2, 2.5, 3, 4, 5. , long length quincke spinal needle for pain management, size – g 22, length – 120mm & 150mm , low adherent absorbent wound dressing with a polyester perforated wound contact layer size 50cm 7mtr roll , lung excersizer , mackintosh double colour water proof roll ( 20 meter per roll ) , malecot rubber catheter no 12 , malecot rubber catheter no 16 , malecot rubber catheter no 20 , malecot rubber catheter no 22 , malecot rubber catheter no 24 , medical dry imaging film 10x12 , medical dry imaging film 14x17 , medical dry imaging film 8x10 , mesure volume set soft chamber, with bulb latex 110ml , methacrylate based oxygen permeable non adherent 3 dimensional transforming powder dressing size 4 x 4 , micro drip set with bulb latex , microlaryngeal surgery tube no 5 , monopolar cautry wire disposable , mucous extractor with connector for bronchoscope capacity 70 ml , mucus extractor , multifunctional mask with the attachment of nebulizer mask, venture mask, oxygen mask, aerosol mask, with 7 oxygen tube.adult and paediatric. , naso pharyngeal airway adult all size , naso pharyngeal airway paediatric all size , nebulization mask ( set ) adult & pediatric , neonatal urine collection and measurement bag 100 ml , nitrile gloves size small / medium / large , non rebreathing mask ( oxygen mask with reservoir bag , non sterile surgical rubber gloves 6.5 no. ( pair ) made of natural latex micro rough finish for better grip , non sterile surgical rubber gloves 7 no. ( pair ) made of natural latex micro rough finish for better grip , non sterile surgical rubber gloves 7.5 no. ( pair ) made of natural latex micro rough finish for better grip , oxygen adaptor 5 type , oxygen catheter , oxygen connection with flow meter for central line , oxygen connection with flow meter for cylinder , oxygen high pressure hose pipe , oxygen mask adult & pediatric , oxygen penal regulator for oxygen liquied tank ( 1 25 kg ) , oxygen regulator for control penal board ( oxygen pipe line ) , oxygen tailpipe ( flexible metalic ) , p t tubes 3.8% sodium citrate ( prothrombin tube ) , pacing leads 6 fr , paediatric double lumen polyurethan cvc line, 3 fr, l 10cm, 15cm, , paediatric double lumen polyurethane cvp catheter, 4.5 fr, g – 20x20 length – 6cm, 12.5cm , paediatric epidural set ( with 19g needle with matel stylet 22gcatheter 0.22 micron epidural catheter andsyringes , paediatric triple lumen polyurethan cvc line with nitinol j guide wire, 4.5 fr, g 20*23*23, l 6cm, 8cm, 10cm, 12.5cm , paper adhesive plaster microporous surgical tape 2inch x 10mt roll , paper adhesive plaster microporous surgical tape 3inch x 10mt roll , paper adhesive plaster microporous surgical tape 4inch x 10mt roll , paper adhesive plaster microporous surgical tape 6inch x 10mt roll , pec haemostatic patch for post renal dialysis size 5cm x 7cm , pediatric diapers , pediatric ventilator circuit complete set , peripheral inserted central catheter 4 fr , peripheral inserted central catheter 5 fr , peritonial dialysis catheter 200mm pediatric , peritonial dialysis catheter 280mm adult , peritonial dialysis fluid 1ltr. , pigtail catheter 6 fr ( 150 cm ) , pigtail catheter no 10 , pigtail catheter no 14 , plain vial with screw cap12x75 , plaster of paris bandage 3 , plaster of paris bandage 4 , plaster of paris bandage 6 , plaster of paris powder ip 1 kg pkt , plastic apron disposable , plastic nozel cap , plastic test tube 3 , post exposure prophylaxis kits ( pep kits ) , probe for oxygen , proseal lma ( plma ) 1, 1.5, 2, 2.5, 3, 4, 5 , radial a catheter , rectified sprit 4.5 ltr. , reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. , ryles tube size 10, 12, 14, 16, 18 , self adhering silicon external catheter should be built in band, clear odorless single sterilized pack, 100% latex free. size 25 / 29 / 32 / 36 / 41mm. , semi automatic core biopsy instrument set with 2 throw length of 10 mm and 20 mm in a single device along with a throw length indicator window and a fire ready indicator mark compatible adjustable coaxial and a blunt tip stylet. should be usfda approved 18g*10cm, 18g*16cm & 18g*20cm, 20g*10cm, 20g*16cm , short catheter with straight / j tip guide wire ( l 20, fr 2, g 22 ) , short pencil point spinal needle g 25 / 22, l 38mm. , should have dual hook for zero migration post deployment should have the option of repositioning after deployment should have dustable twisted wire construction for durability. 20g*107mm , sics kit ( small incision cataract surgery ) , silicon / double nasal prong with universal connector. all sizes , silicon cautery plate , silicon mask size 0, 1, 2, 3, 4 & 5 , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgicalwound dressing sheet 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 10 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 25 cm , silk protein and antimicrobial nano silver based sterile surgical mesh wound dressing 20 cmx 40 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 10 cmx 10 cm , silk protein and antimicrobial nano silver based sterile surgical pu foam dressing 20cmx20cm , silk protein based sterile surgicalwound dressing sheet20 cmx 40 cm , silk protein based sterile surgical pu foam dressing 20cmx20cm , silkolatex nasopharyngeal airway, with adjustable flange and widen end. sterilizedsizes 20, 22, 24, 26, 28, 30, 32, 34, 36 fr , soda lime for anesthesia workstation 5kg , soft roll 15cm x 3 meter , spatula for papsmear , spring loaded automatic biopsy gun one handed cocking machanism with non roll handle design. angle sample notch for enhance needle action choice of two firing buttons.should be usfda approved 16g* 10cm, 16g* 16 cm, 18g* 10cm, 18g* 16cm, 18g* 20cm, 18g* 25cm , sterilant cold disinfectant for dialysis containing peraetic acid hydrogen peroxide acetic acid 5 ltr. , sterile adhesive iodine drape large , sterile alcohol swabs , sterile disposable syringe 1ml , sterile disposable syringe with needle 03 ml , sterile disposable syringe with needle 2ml , sterile disposable syringe with needle 5ml , sterile gauze swab / pad , sterile gloves isi 6.5 made of natural latex, micro rough finish for better grip , sterile gloves isi size7.5 made of natural latex, micro rough finish for better grip , sterile gloves isi size8 made of natural latex, micro rough finish for better grip , sterile gloves isi size 7 made of natural latex, micro rough finish for better grip , sterile hypodermic syringe with needle 10ml , sterile hypodermic syringe with needle 20ml , sterile hypodermic syringe with needle 50ml , sterile leur lock syringe 20ml , sterile leur lock syringe 50ml , sterile luer lock syringe 10 ml , sterile luer lock syringe 5 ml , sterile powder free glovessize6.5 made of natural latex, micro rough finish for better grip , sterile powder free glovessize7 made of natural latex, micro rough finish for better grip , sterile powder free glovessize7.5 made of natural latex, micro rough finish for better grip , sterile powder free glovessize8 made of natural latex, micro rough finish for better grip , supreme lma ( slma ) , surgical blade size 11 , surgical blade size 15 , surgical blade size 22 , surgical blade size 24 , t.piece circuit with oxygen tubing set ( complete set ) , tear test strip ( 100 strips in box ) , thermometer digital , thomas splint , three way stop cock , tmt graph paper , tounge depresser wooden , tracheostomy tube cuffed plastic 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5 , transducer set for invasive b.p. , triway with extention 10, 50, 100, 150, , turp set , twin nasal cannula adult , twin nasal cannula padiatric , urine collecting bag 2 ltr. , urine collecting bag with urometer 1 ltr. , urine sugar diagnostic stip , vaccum adaptor 5 type , vaccum jar 1000 ml with regulator , vaccum jar 2000 ml with regulator , vaccum pump belt , vaccum pump oil , vaccum regulator , vaporizer , ventilator catheter mount , ventilator circuit , ventilator circuit ( heated wire ) , ventilator circuit ( neonatal ) , ventilator circuit full kit ( tubing+hmf+filter+catheter mount+bacteria filter ) , ventilator mask , ventilator nebulization kit with t piece , ventilator single tubing circuit ( adult ) , water bed , wipes , wound suctionset no 11 / 12 / 14 / 16 / 18 , x ray casset12x15 , x ray casset 10x12 , x ray casset 8x10 , x ray developer 22.5 lit. , x ray films size 10x12 50film per pkt blue sensitive , x ray films size 12x15 50film per pkt blue sensitive , x ray films size 8x10 50film per pkt blue sensitive , x ray fixer 22.5 lit , x ray hangers ( clip type ) 10x12 , x ray hangers ( clip type ) 12x15 , x ray hangers ( clip type ) 8x10 , x ray screen high speed 12x15 , x ray screen high speed 8x10 , x rayscreen highspeed 10x12 , yankauer suction catheter ( complet set ) , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 030cm , green37mm1 / 2 circletaper point , 180 absorbablepolyglyconate knotless wound closure device with unidirectional 2 0 30cm , green37mm1 / 2 circletaper point , 20g round body cutting needle 1 / 2 circle , absorbable adhesion barrier in the form of off white knitted fabric prepared by oxidized regenerated cellulose indicated for both open and laparoscopic procedures size , absorbable gelatin based topical absorbable flowable hemostat with 6cc syringe pre filled with hemostatic matrix. with 14.3 cm white applicator tip & 14.6 cm blue flexible applicator tip , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 6 cm circle fda approved , absorbable intraperitoneal umbilical patch of polyester mesh with collagen barrier and having absorbable pgla expanders with size 8 cm circle, fda approved , absorbable unidirectional barbed devicepolydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed devicesymmetric anchoring pattern, triclosan coated polydioxanone size 1, 40 mm 1 / 2 circle taper point needle 45 cm , absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle taper point needle, 45 cm , black braided silk eyeless needled suture usp, size 8 0 suture length76cm, needlelength & description 3 / 8 circle round bodied 30mm , black braided silk eyeless needled suture usp, code 5036 size 2 0 suture length in cm 76cm, needle length & description 3 / 8 circlereverse cutting 45mm , black braided silk eyeless needled suture usp, code 5082 size 4 0 suture length76cm, needlelength & description 3 / 8 circle round bodied 16mm , black braided silk eyeless needled suture usp, code 5333 size 2 0 suture length 76cm, needle length & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 5 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, size 6 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , blackbraided silk eyeless needled suture usp, code 5049 size 4 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 16mm , blackbraided silk eyeless needled suture usp, code 5070 size 3 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 25mm , blackbraided silk eyeless needled suture usp, code 5087 size 3 0 suture length76cm, needle length & description 1 / 2 circle round bodied 20mm , blackbraided silk eyeless needled suture usp, code 5334 size 1 0 suturelength 76cm, needlelength & description 1 / 2 circle round bodied 30mm , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer ) dermal regeneration template 4 in x 5 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 2 in x 2 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 10 in , bovine collagen and glycosaminoglycan ( chondroitin 6 sulfate ) and silicone layer ( bilayer mashed ) mashed dermal regeneration template 4 in x 5 in , braided synthetic absorbable eyeless needled suture usp code 2423, size 1 0 suture ( os ) , braided synthetic absorbable eyeless needled suture uspbraided ab. suture 6 0 rc 1 / 4 circle 45cm needle 8 mm , braided synthetic absorbable polyglactin 910 eyeless needled suture size6 0 round body needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2341, size 2 0 suture length in 70cm 1 / 2 circle round bodied 30mm , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2346, size 1 0 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2347, size 1 suture length in 90cm 1 / 2 circle40mm heave , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2421, size 1 suture length in 90cm 1 / 2 circle rc 40mm os needle , braided synthetic absorbable polyglactin 910 eyeless needled suture usp code 2534, size 1 0 suture 90cms, 1 / 2 circle rc 36mm, os6 needle , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 20mm length 75cm size 3 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 30mm length 100cm size 2 / 0. , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 36mm length 90cm size 3 / 0 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 , coated braided polyglctin 910 with triclosan coating sut. ) with 1 / 2 cir rb needle 40mm length 100cm size 1 / 0 , complete absorbable mesh fixation device with minimum strap length 7.0 mm2 point fixation to hold the mesh and device with 25 tacks only. , copolymer of glycolied and e caprolactone, 1 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 2 0 ct 1 needle and 45cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 20cm suture length unidirectional spiral. , copolymer of glycolied and e caprolactone, 3 0 rb 1 needle and 45cm suture length unidirectional spiral. , knotless wound closure device with unidirectional 2 0 45cm , undyed24mm3 / 8 circlereverse cutting , knotless wound closure device with unidirectional 3 0 58cm, undyed24mm3 / 8 circlereverse cutting , macro porus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber ( 6 0 ) and poliglecaprone 25 monofilament fiber ( 5 0 ) with pore size 2.7 mm having a weight of 39 g / m2 and containing blue orientation stripes of polypropylene.15cmx15cm , monofilament glycomer0, 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer1 , 90cm, violet40mm1 / 2 circletaper point , monofilament glycomer2 0 , 75cm, violet27mm1 / 2 circletaper point , monofilament glycomer3 0 75cm, undyed24mm3 / 8 circlereverse cutting , monofilament glycomer3 0 75cm, violet22mm1 / 2 circletaper point , non absorbable pre shaped polypropylene mesh large size , non absorbable pre shaped polypropylene mesh medium size , non absorbable pre shaped polypropylene mesh small size , oxidized regenerated cellulose ( absorbable hemostat fibrillar ) 1 in x 2 in ( 2.5cm x 5.1cm ) , oxidized regenerated cellulose based topical absorbable hemostar thicker weave 4x8 , oxidized regenerated cellulose based topical absorbable hemostat, fibrillar / layer form, with bactericidal property. fibril material ( 7layers ) for broad surface area coverage. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 2x4 inch , oxidized regenerated cellulose based topical absorbable hemostat, structured non wovenmaterial, with bactericidal property. ease of use in both open and minimally invasive procedures. size 4x4 inch , oxldlzed regenerated cellulose; rayon fiberas per us phrmcopela standards enforceable by us fda with bactericidal property 2x3 , oxldlzed regenerated cellulose; rayon fiber as per us phrmcopela standards enforceable by us fda with bactericidal property 3x4 , patient return electrode with current limiting nature & hence eliminate patient pad site burns based on capacitive coupling principle & made of akton polymer can be used for all patient’s weight >350 grams, radiolucent & latex free, no adhesive related irritation to patient skin.can be used any side up for easy handling in or andus fda approved compatible to any electrosurgical generator, size: 36” l x 20”w x 1 / 8”thickness. , pistol grip curved coagulating shears with ergonomic handle in the following shaft length 36cm. can seal blood vessel up to and including 5mm in diameter compatible with ultrasonic vessel sealing dissector system , poliglecaprone 25 undyed 3 0, 3 / 8 circle reverse cutting26mm 70cm. , polyamide black size 10 / 0 3 / 8 circle spachula needle 6mm , polyamide black size 8 / 0 3 / 8 circle revers cutting needl 6mm , polydioxanone122cm , no 1 size loop sgle with 65 mm needle and 1 / 2 circle tp needle. , polydioxanone150cm usp1 0 rb ctx, 1 / 2 circle, 48mm , polyester suture no. 2 x 100 45mm hc tc , polyester suture no. 5 x 75 55mm hc tc , polyglactin 910 1 x 100 45mm hc rb , polyglactin 910 fast und 0 x 110 40mm hc rb , polyglactin 910 fast und 2 0 x 100 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 36mm hc rb , polyglactin 910 with triclosan no. 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 100 55mm hc rb , polyglactin 910 with triclosan no. 1 x 90 36mm hc tc , polyglactin 910 with triclosan no. 1 x 90 40mm hc rb , polyglactin 910 with triclosan no. 1 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 x 90 40mm hc rb , polyglactin 910 with triclosan no. 2 x 90 40mm hc rc , polyglactin 910 with triclosan no. 2 0 x 90 30mm hc rb , polyglactin 910 with triclosan no. 2 0 x 90 40mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 20mm hc rb , polyglactin 910 with triclosan no. 3 0 x 90 36mm hc tc , polyglactin 910 with triclosan no. 4 0 x 70 20mm hc rb , polyglactin 910 with triclosan no. 5 0 x 45 16mm hc rb , polyglactin 910 with triclosan no.1 0x 90 36mm hc rc , polyglactin 910 with triclosan no.1 0x 90 40mm hc rb , polyglactin 910 with triclosan no.1 0x 90 40mm hc tc , polyglycolic acid no. 1 x 180 50 / 40mm cu rb hc tc dn , polypropylene 6 0x60 10mm hcrb dntp3 , polypropylene 7 0x60 09mm hcrb dntp3 , polyster braided1 / 2 circle tapercut double needle with 17 mm needle and suture lenght 90cm , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 4.0 mm center hole with radial slit usfda approved , protective disk with chg hydrophilic polyurethane absorptive foam with 92 g chlorhexidine gluconate ( chg ) 1 disk ( 2.5 cm ) 7mm center hole with radial slit usfda approved , scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand position in the following shaft length 17cm. can seal blood vessels up to & including 5mm in diameter with ultrasonic vessel sealing dissector . , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for left side , fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 14 x 09 cm for right side, fda approved , self grippingpolyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for left side, fda approved , self gripping polyester / polypropylene monofilament mesh pre cut with pla grips with size 12 x 08 cm for right side, fda approved , sterlizedabsorbable eyeless needled suture usp, code 2341, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlizedabsorbable eyeless needled suture usp, code 2345, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm , sterlizedabsorbableeyeless needled suture usp, code 2304, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbableeyeless needled suture usp, code 2317, size 2 0 suture length in cm 90cm needle length & description 1 / 2 circle round 30mm , sterlizedabsorbableeyeless needled suture usp, code 2437, size 3 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 20mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2303, size 5 0 suture length in cm 45cm needle length & description 1 / 2 circle round bodied 16mm , sterlizedabsorbable polyglycolic acid eyeless needled suture usp, code 2442, size 5 0 suture length in cm 45cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3317, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polyamide eyeless needled suture usp, code 3318, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circlecutting cutting 16mm , sterlized monofilament polyamide eyeless needled suture usp, code 3328, size 3 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 26mm , sterlized monofilament polyamide eyeless needled suture usp, code 3336, size 2 0 suture length in cm 70cm needle length & description 3 / 8 circlereverse cutting cutting 45mm , sterlized monofilament polyamide eyeless needled suture usp, code 3347, size 1 suture length in cm 100cm needle length & description 1 / 2 circleround bodied 40mm heavy , sterlized monofilament polyamide eyeless needled suture usp, code 7003, size 10 0 suture length in cm 30cm needle length & description 3 / 8 circledouble arm 6mm heavy , sterlized monofilament polyamide eyeless needled suture uspsize 6 0 suture length in cm 70cm needle length & description 3 / 8 circle reverse cutting cutting 12mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 829, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 13mm double armed. , sterlized monofilament polypropyleneeyeless needled suture usp, code 841, size 2 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropyleneeyeless needled suture usp, code 842, size 1 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 30mm , sterlized monofilament polypropylene eyeless needled suture usp, code 823, size 6 0 suture length in cm 70cm needle length & description 3 / 8 circle slim blade cutting 15mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 843, size 1 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 40mm heavy , sterlized monofilament polypropylene eyeless needled suture usp, code 849, size 4 0 suture length in cm 70cm needle length & description 1 / 2 circle round bodied 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 870, size 4 0 suture length in cm 70cm needle length & description 3 / 8 circle cutting 16mm , sterlized monofilament polypropylene eyeless needled suture usp, code 881, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm. , sterlized monofilament polypropylene eyeless needled suture usp, code 882, size 5 0 suture length in cm 70cm needle length & description 3 / 8 circle round bodied 16mm.double 16mm armed , sterlized surgical chromic gutsutue eyeless needied usp, code 4201, size3 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle cutting 22mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4216, size2 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4217, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 30mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4221, size1 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle round bodied 40mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4227, size 1, suture length in cm 100cm needle length & descriptio 1 / 2 circle round bodied 45mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4237, size3 / 0, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 20mm. , sterlized surgical chromic gutsutue eyeless needied usp, code 4259, size1, suture length in cm 76cm, needle length & description 1 / 2 circle round bodied 40mm heavy. , sterlized surgical chromic gutsutue eyeless needied usp, code 4268, size5 / 0, suture length in cm 76cm, needle length & description 3 / 8 circle reverse cutting 12mm. , surgical silk bradedsterile foilover wrappack code 213 size 2 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 214 size 1 0 suture length in 2 x 75cm , surgical silk bradedsterile foilover wrappack code 215 size 1 suture length in 2 x 75cm , suture dyed polyester poly ( p dioxxanone ) 1 0, 24x4cm, 1 / 2 circle 36mm rb 20 anchors / inch bidirctional. , synthetic absorbable surgical suturetriclosancoated violet monofilament polydioxanone suture with 70 cm size 2 0 with 1 / 2 circle taper point sh, 25mm to 26 mm needle usfda approved , synthetic absorbable surgical suture , polyglactin 910 with triclosancoated undyed 2 0, 1 / 2 circle round body taper point ct 1 36 mm , 90 cm undyed , synthetic absorbable surgical suture , polyglactin 910 with triclosancoated, undyed 3 0, 3 / 8 circle cutting ps1 prime, multi pass ethalloy, 24 mm, 70 cm undyed , synthetic absorbable surgical suture triclosancoated monofilament poliglecaprone 25 suture, length 70 cm, size 2 0 with 3 / 8 circle oval round body visi black jb needle 26 mm , synthetic absorbable surgical suture triclosancoated violet monofilament polydioxanone suture with 90 cm size 1 with 1 / 2 circle taper point ct 1 40 mm needle usfda approved , synthetic absorbable surgical suture, polyglactin 910 with triclosancoated undyed1, 1 / 2 circle round body taper point ct 1 36mm, 90cm undyed. , transducer with unlimited counts compatible with ultrasonic vessel sealing dissector system , triclosan antibacterial coated polyglactin with 23 mm needle suture length 70cm, reverse cutting portt heavy needle size 1 no. , v shape clip applicators large , v shape clip applicators medium , v shape clip applicators medium large , v shape clip applicators small , v shape ligation clip large , v shape ligation clip medium , v shape ligation clip medium large , v shape ligation clip small , ada kit , aluminium ammonium sulphate powder 500gm , ana test kit , anti a lactin 05ml , anti ab sera 10ml , anti d igg+ igm 10ml , anti d igm 10ml , anti hlactin 05ml , anti human globulin ( ahg ) 05ml , anti a sera 10 ml , anti b sera 10 ml , banded use in blood bank , benedict reagent5 lit cane , blotting paper sheet , blue tip 2ml , bovine albumin 22%05ml , buffer solution for hiv 50ml , ca 125 , calcium chloride 05ml / vail , capillary tube , couplin jar , cover slips size 18x18mm , cover slips size 22x22mm , cyto fix spray , dengue card test , dpx mount 250ml , ehlrich aldehyde reagent 125 , fouchet reagent 250ml , haematoxylene 5gm , hbsag elisa test kit 4th generation 96 test , hbsag rapid test kit50 test , hbv elisa test kit 4th generation96 test , hbv rapid test kit , hcv elisa test kit 4th generation 96 test , hcv rapid test kit , hiv elisa test kit 4th generation 96 test , hiv rapid test kit , i.d. microtyping abd card , i.d. microtyping gel card ahg , immersion oil , iso propyl alcohol , leucoreductionfilter ( bed side ) , liss diluent for gel card , malaria parasite elisa test kit , mercuri oxide 25gm , methanol 2.5lit , mgg 480ml , malaria parasite antigen test kit rapid , n / 10 hcl 500ml , pandys reagent 125ml , papanicalou ea 125ml pea 030 , papanicalou og 6 125ml pea 010 , paraffin wax 58 60c , pasture pipette , polythene gloves , retic stain 125ml , slide tray , steel cassets for tissue processing , sulpho salicylic acid 500ml , tissue paper roll , vdrl elisa test kit , vdrl rapid test kit , rpr test kit , wafers cutting blade for tube welders , xylene , yellow gel tube vaccum blood collection tube , yellow tip plastic , massons trichrome stain , acetone detection kit , acetic acid solution 3%100ml , barium chloride 10 %500 ml , glacial acetic acid 100 ml , glucose kit god / pod , h2so4 25 % 500 ml bottle , leishman stain 500 ml , sharp collection containers disposable 1.5 ltrs , sharp collection containers disposable5 ltrs , total protein kits 100 ml , field stain a 500 ml , field stain b 500 ml , multi parameter urine strips ( 100 in 1 box ) , bismark brown stain 100 gm , light green stain 100 gm , disposable microtome blade ( 50 blades in one ) , csf protein kit , filter paper 12.5 cm 0.1 micron ( 50 per pkt ) , tips for auto pippets ( 2 to 100 micron yellow 1000 / pkt ) , tips for auto pippets ( 200 to 1000 micron blue 500 / pkt ) , sugar albumin urin stics ( bi parameter ) , sulpgar powder 500 gm , liquid ammonia 500 ml , nitric acid 500 ml , blotting paper 50 / pkt , pas stain , blood culture media aerobic for adult ( bac t / alert pf plus , blood culture media anaerobic for pediatric ( bac t / alert pf plus ) , ki67 / mib 1 06 ml antibody kit , glial fibrillary acidic protein ( gfap ) , s 100 , ae 1 / ae 3 , ema , nfp , synaptophysin , estrogen receptor epi monoclonal , progestron receptor monoclonal , anti her / erbb2 monoclonal , myogenin , sma , cd34 , bcl 2 , cyclin d 1 , cox 2 , p 53 , nkx 3 1 , amacr , vimentin , desmin , tris buffer gr , titriplexiii pure ( edta ) , sodium chloride for analysis , tween 20 for synthesis , hydro chloride acid about 36.46% , poly l ltsin solution p8920 , pap pen , hpr polymerr kit with dab chromogen , pricking lancet , leucoreductionfilter ( lab side ) , haemoglobin strip , single donor platelet kit make haemonotics / terumo penpol ( close system ) , absorbable 2 0 endo suture cartridge 48 length , advance rf energy hand instrument of 5 mm shaft diameter for open procedures with shaft length 14 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , advance rf energy hand instrument of 5 mm shaft diameter for laproscopicprocedures with shaft length 35 cm and should be both hand and foot activated. compatible with ultrasonic vessel sealing dissector system installed in myh , disposable circular stapler 25 / 26mm diameter , disposable circular stapler 28 / 29mm diameter , disposable trocar 05mm , disposable trocar 10mm , disposable trocar 12mm , disposable trocar 15mm , disposable circular stapler 31mm diameter , disposable circular stapler – 32mm diameter , disposable circular stapler33mm diameter , disposable circular stapleriii rows , disposable clipapplier medium 10mm with 20 clips , disposable clip applier medium 5mm with 16 clips , disposable curved cutter stapler , disposable curved cutter stapler , disposable hemorrhoidal stapler , disposable hemorrhoidal stapler iiirows , disposable hemorrhoidal stapler with detachable anvil. , disposable linear stapler with fixed staple height 75mm 90mm size , disposable linear stapler with fixed staple height 55mm 60mm size , disposble skin stapler with pins , distal tip closure titanium ligation clip large size , distal tip closure titanium ligation clip medium size , distal tip closure titanium ligation clip small size , endoscopic cutter & stapler60mmregular length , endoscopic cutter & stapler60mmlonglength , endosuturing device 10mm with toggle lever , handpiece ( blue ) compatible with ultrasonic vessel sealing dissector system installed in myh , handpiece ( transducer ) compatible with ultrasonic vessel sealing dissectorinstalled in myh , locking clip cartridge medium / large , mesh fixation device with 15 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with 30 poly ( lactide co glycolide ) absorbable tacks , mesh fixation device with non absorbable titatinum tacks 15 , mesh fixation device with non absorbable titatinum tacks 20 , mesh fixation device with non absorbable titatinum tacks 30 , multifire clip applier long size 15 clip , multifire clip applier small size 20 clip , non absorbable 2 0 endo suture cartridge 48 length , open clip applicator 100 20cm length , open clip applicator 200 20cm length , open clip applicator 300 , open clip applicator 400 , partially absorbable mesh with absorable & semi absorbable sides 15cm x 15cm , partially absorbable mesh with absorable & semi absorbable sides 10cm x 15cm , plastic locking clip applicator medium / large , polycearbonte bladeless trocarwith reducer seal 10mm , polycearbonte bladeless trocarwith reducer seal 12mm , polycearbonte bladeless trocar with reducer seal 5mm , polyproplene with polyglecaprone 25 partially absorbable mesh 10cm x 15cm , polyproplene with polyglecaprone 25 partially absorbable mesh 7.6cm x 15cm , reload 55 60mm for medium thick tissue blue compatible with linear cutter. , reload 55 60mm for thin / vascular tissue white compatible with linear cutter. , reload 75 80mm for medium thick tissue blue compatible with linear cutter. , reload 75 80mm for thick tissue green compatible with linear cutter. , reload compatible with curved cutter , reload endoscopic cutter & stapler45mm purple , reload endoscopic cutter & stapler60mm purple , reload endoscopic cutter & staplter45mm blue , reload endoscopic cutter & staplter45mm green , reload endoscopic cutter & staplter60mm / black , reload endoscopic cutter & staplter60mm blue , reload endoscopic cutter & staplter60mm gold , reload endoscopic cutter & staplter60mm green , reload endoscopic cutter & staplter60mm white , reload forlinear cutter 55mm 60mm size green , reload forlinear cutter 75mm 80mm size blue , reload forlinear cutter 75mm 80mm size green , reload forlinear cutter 90mm 100 mm size green , reload for linear cutter 55mm 60mm size blue , reload for linear cutter 90mm 100 mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size blue , reload for linear stapler with fixed staple height 35mm 45mm size green , reload for linear stapler with fixed staple height 55mm 60mm size blue , reload for linear stapler with fixed staple height 55mm 60mm size green , reusable laparoscopic clip applicator for large titanium clips with15cm 20cm length , reusable laparoscopic clip applicator for large titanium clips with non detachable jaw assembly , reusable laparoscopic clip applicator for large titanium clips. , reusable laparoscopic clip applicator for medium large titanium clips with28cm 30 cm length , reusable laparoscopic clip applicator for medium large titanium clips with non detachable jaw assembly , reusable linear cutter 55 60mm with 200 firing , reusable linear cutter 75 80mm with 200 firing , skin staple remover with plastic handle , suture locking autolock , titanium clip 100 , titanium clip 200 , titanium clip 300 , titanium clip 400 , universal reload cartridge for 55 mm / 75mm new linear cutter for tissue thickness ranging from 1 mm to 2 mm with 6 rows of staples 3 on either side of cut line, 440 grade stainless steel knife integrated in the cartridge , 88 titanium staples / 118 titanium staples. , universal stapler 55mm / 75mm new linear cutter along with staple height selector and 3d staple technology with ambidextrous firing with 6 rows of stapler height range of 1.5 mm to 2.00 m....

Directorate Of Medical Education - Madhya Pradesh

28408130 purchase of reagents chemicals and solutions 2 acetone 3 alcohol 100% 4 acetic acid 5 acetic acid glacial 6 agar agar powder no1 7 alberts stain a 8 alberts stain b 9 alpha naphthylamine solution 10 ammonium hydroxide 11 ammonium sulphate 12 ammonium oxalate 13 anhydrons sodium carbonate 14 basic fuschin powder 15 basic fuschin prepared 16 banadict’s solution 17 baritt reagent a 18 baritt reagent b 19 barbituric acid 20 barium chloride solution prepared 21 benzene 22 benzidine powder 23 bismith nitrate 24 bis acrylamide 25 bovine albumin 26 casein 27 castor oil 28 canada balsom 29 crystal violet 30 carbon tetra chloride 31 citric acid 32 chloroform 33 copper sulphate 34 corn oil 35 creatinine zinc chloride 36 diethyl ether 37 distill water 38 dinitro salicylic acid 39 drabkins solution 40 d.p.x. 41 d l aspartic acid 42 dettol 43 dextrine 44 dextrose / glucose 45 2 6 dichlorophenol indophenol 46 di sodium hydrogen orthophosphate 47 ethanol 48 ethyl alcohol 49 eithidium bromide 50 eosine ( yellow ) 51 eosine powder 52 egg albumin 53 edta powder 54 formaldehyde 55 fauchet’s reagent 56 glacial acetic acid 57 glucose powder 58 gram’s iodine 59 giemsa powder 60 glycerol 61 glycerin 62 gention voilet 63 g6 pd solution prepared 64 hydrogen per oxide 65 hydrochloric acid 66 haematoxyline prepared 67 haematoxyline harris 68 hplc grade methanol 69 hplc grade water 70 iodine crystal 71 iodine solution 72 iso propyl alcohol 73 lead acetate 74 liquid paraffin 75 liquid ammonia 76 lithium carbonate 77 leishman stain powder 78 lacto phenol cotton blue 79 lypoenlavide solution 80 l lysine monohydrate 81 l methionine 82 lithium carbonate 83 meta phosphoric acid 84 micobacteria decolourizer 85 malachite green 86 methanol 87 methelene blue powder 88 methelene blue solution 89 methyl voilet solution prepared 90 methyl voilet powder 91 mercury metal 92 mercuric chloride 93 nigrosin stain 10% w / v 94 nitric acid 95 ninhydrine 96 n / 10 hcl 97 orthophosphoric acid 98 oxidase reagent 99 oxalic acid 100 paraffin wax 101 pandy’s solution prepared 102 perchloric acid 103 phosphotungustic acid 104 potassium chloride 105 potassium iodide 106 potassium hydroxide 107 potassium dichromate 108 potassium oxalate 109 potassium dihydrogen orthophosphate 110 phenyl liquid 111 phenol 112 phenolic auramine 113 potassium permangnate 114 picric acid 115 prepared reticulocyte fluid 116 prepared pandy’s solution 117 prepared leishman stain 118 prepared concentrate 6% fauschets reagents 119 pumic stone powder 120 rectified spirit 121 r.b.c. diluting fluid 122 rotheras test reagent ( ketone body ) na. sodium nitroprusside nb. liquer ammonia nc. ammonium sulphate 123 sugars all types 124 sodium citrate 125 schaeffer & fulton spore stain a 126 schaeffer & fulton spore stain b 127 silver nitrate 128 silica gel 129 soft soap 130 sodium acetate 131 sodium citrate 132 sodium tri citrate 133 sodium chloride 134 sodium carbonate 135 sodium bicarbonate 136 sodium hydroxide 137 sodium hydroxide palet 138 sodium phosphate 139 sodium pot. tartrate 140 sodium hypo chlorite 5% 141 sodium hypo chlorite 10% 142 silver nitrate 143 sodium hypo chloride 144 sprit ammonia aromatic 145 spirit denatured 146 sulfuric acid con. 147 sulfuric acid 20% 148 sulphar powder 149 sulphosalicylic acid 150 savlon 151 tincture cardimum 152 turpentine oil 153 tri sodium citrate 154 tri chloroacetic acid 155 topffer reagent 156 tris buffer 157 tris base 158 temed 159 thymol 160 w.b.c. diluting fluid 161 xylene sulphar free 162 soft soap 163 loboline 164 phenylalanine 165 sodium hippurate 166 benzoic acid 167 list of reagent kits for semi / fully auto analyzer & other kits 168 a.s.o.test 169 c.r.p. test 170 erba wash 171 hbsag card test 172 hepatitis a 173 hepatitis e 174 malaria pf / pv antigen kit 175 montoux vaccine for adult 176 montoux vaccine for child 177 pregnancy card test 178 prothombin time kit isi 1.0 179 r.a. test 180 rapid pap kit 181 rpr test ( slide ) 182 rpr test ( tube ) 183 rpr card test 184 s.g.o.t. kit ( ast ) 185 s.g.p.t. kit ( asi ) 186 serum acid phosphate kit 187 serum albumin kit 188 serum alkaline phosphate kit 189 serum bilirubin kit 190 serum calcium 191 serum cholesterol kit 192 serum creatinine kit 193 serum hdl kit 194 serum triglyceride kit 195 sugar ( glucose ) kit 196 tlc reagent spray bottle 197 total protein ( biuret method ) 198 urea kit 199 uric acid kit 200 urine strip ( albumin / sugar ) 201 ketone body strip 202 widal slide test 203 widal tube test 204 widal card test 205 dengue kit 206 dengue card ( antigen & antibody ) 207 dengue elisa igg 208 dengue elisa igm 209 dengue elisa ns1 antigen 210 chicken gunia rapid card 211 elisa tb igm 212 elisa tb igg 213 elisa tb iga 214 cardiolipin antibody igm 215 cardiolipin antibody igg 216 cardiolipin antibody iga 217 cpkmb kit 218 g6pd kit 219 aptt kit 220 torch elisa kit igm, igg, iga 221 list of blood bank items 222 triple sagam bag 450ml. 223 quadruple bag top & bottom sagam 450ml. 224 paediatrics bags 100ml. 225 blood grouping & cross matching by gel technology 226 forward abd grouping 227 forward & reverse abd grouping 228 cross matching / or coomb’s test 229 liss solution 230 blood grouping anti sera for slide & tube method 231 anti –a titer 1:256 232 anti –b titer 1:256 233 anti –d ( igg+igm ) 234 anti ab 235 anti a1 ( lactin ) 236 anti h ( lactin ) 237 anti c ( capital ) 238 anti c ( small ) 239 anti e ( capital ) 240 anti e ( small ) 241 anti k ( capital ) 242 anti k ( small ) 243 anti fya 244 anti fyb 245 anti jka 246 anti jkb 247 anti d should be of both types: anti d ( r0 ) & anti d ( r1 ) 248 hiv elisa 249 hiv elisa ( fourth generation ) 250 hcv elisa 251 hbsag elisa 252 hiv rapid card test 253 hiv rapid card ( flow through immuno dot method ) 254 hcv rapid card test 255 hcv rapid card ( flow through immuno dot method ) 256 hbsag rapid card test 257 vdrl rapid card test 258 m.p. antigen card test with specification pf / pv 259 e. micro tips 260 5μ to 200 μ tips 261 100μ to 1000 μ tips 262 sample collection tube 263 test tube with cap ( size 12mmx75mm ) 264 edta vial ( 2ml. ) 265 plain vial ( 5 ml ) 266 list of laboratory equipment / items 267 anaerobic gas pack system 268 comparator nessler 269 centrifuge machine 08 tubes 270 centrifuge machine ( 24tube ) 271 colorimeter 272 counter 273 dissecting microscope 274 distill water plant ( glass ) 275 electronic hemoglobin meter ( 530nm filter ) 276 electronic weighing balance 0gm 210gm. 277 enamal tray 278 extraction apparatus, fat, complete filter, pasteur chamberland, complete set 279 filter, berke fed 280 hot plate 281 hydrometer spirit 282 hydrometer milk 283 hydrometer wet dry bulb 284 height measuring stand 285 harpenders calipers ( for skin fold thikness ) 286 incubator 287 incubator digital 350x350x350 ( 14x14x14 ) watt. 288 improved neubers chamber 289 inoculation hood 290 improved neubers chamber 291 lovibond comparators 292 microtome manual 293 micrometer eye piece 294 micrometer stage 295 ph determination apparatus 296 ph meter 297 sahli haemoglobin meter 298 sealing machine for blood culture bottle 299 stop watch 300 slide tray 301 slide box 302 slide holding jars 303 salters baby weighing machine 304 still for distilled water 305 sterlizer electric 306 tissue cassette steel big 307 tissue cassette steel small 308 digital thermometers 309 tube sealer 310 tube streper & cutter mannual 311 throwing water bath 312 vdrl shaker 313 vortex machine 314 water bath 315 water bath serological 560c 316 slide tray allunimium 30cmx17cm 317 needle cutter 318 list of glasswares / miselleneous items 319 autopipette imported variable 320 autopipette imported fixed 321 autopipette stand 322 autopipette imported variable 323 animal diet for rabbit, mice, guinie pigs, rats 324 autopipette multiple dispenser 325 beaker 250cc 326 beaker 500cc 327 beaker 10ml. 328 beaker 25ml. 329 beaker 50ml. 330 beaker 100ml. 331 beaker 250ml. 332 beaker 500ml. 333 beaker 1 lit. 334 beaker 2 lit. 335 burette 25 cc 336 burette stop cok 25cc 337 blue litmus 338 blue litmus paper 339 cellulose acetate strip 150x25mm 340 capillary tube 341 capillary tube ( ctbt ) 342 capillary tube ( micro capillary ) 343 centrifuse tube 344 conical flask 50cc 345 conical flask 100cc 346 conical flask 250cc 347 conical flask 1000cc 348 conical flask 2500cc 349 conical flask 5000cc 350 conical flask 250ml. 351 conical flask 500ml. 352 cover slip round / square 22x22mm 353 cover slip round / squre 22x40mm 354 cover slip round / squre 22x50mm 355 cuplling jar 356 chittel forcep small 357 chittel forcep large 358 diamond pencil 359 disposable urine container 50ml. 360 durham’s tube 361 dreyers tube ( for widal test ) 362 dropping bottle 125ml. 363 dropping bottle 125 cc 364 dropping bottle 250 cc 365 esr ( wintrobe tube ) 366 esr tube 367 felix tube ( for widal test ) 368 filter paper 369 filter paper wattman 370 filter paper sheets 371 funnel large 372 funnel small 373 glass funnel 3” 374 glass funnel 6” 375 funnel 3cm. 376 funnel 5cm. 377 funnel 10cm. 378 funnel 15cm. 379 forceps big 380 forceps small 381 glass petridish 2 inch 382 glass petridish 3 inch 383 glass petridish 4 inch 384 glass rod for staining 385 glass slide 75x25mm 386 glass rod 2mm 387 glass rod 4mm 388 glass rod 6mm 389 glass jar 390 glass beaker 391 graduated pipette 1ml. 392 graduated pipette 2ml. 393 graduated pipette 5ml. 394 haemoglobin pipette 395 haemoglobin tube 396 haemoglobin tube ( round ) 397 hypo chloride 398 k2 vial 399 lancet 400 measuring cylinder 50ml. 401 measuring cylinder 100ml. 402 measuring cylinder 500ml. 403 measuring cylinder 1000ml. 404 micro centrifuge tube 405 micro tip big 406 micro tip small 407 multichannel pipette 408 meckentosh rubber sheets 409 match stick box 410 metal loop 411 micropipette 0 50 micro 412 micropipette 0 100 micro 413 micropipette 0 500 micro 414 micropipette 0 1000 micro 415 needle 416 paper roll 52 mm 417 pasteur pippet 418 pipette graduated 01ml. 419 pipette graduated 02ml. 420 pipette graduated 05ml. 421 pipette graduated 10ml. 422 pipette one marks 1ml. 423 pipette small 424 pipette tip small 425 pipette tip big 426 pipette volumetric 10cc 427 plastic reack 428 plastic test tube screw cap size 12mmx100mm 429 plastic test tube screw cap size 12mmx75mm 430 pricking needle 431 pipette volumetric 10cc 432 plasticin 433 ph paper roll ( p 2 10 ) 434 paediatric cup 5ml. 435 palne simple vial 436 reagent bottle 250cc 437 reagent bottle 500cc 438 reagent bottle large 439 reagent bottle small 440 red litmus 441 ria vial 442 serum tube 443 serum tube 15x150 444 serum test tube stand 445 sterilim hand wash 446 separating funnel 10ml. 447 separating funnel 25ml. 448 separating funnel 50ml. 449 separating funnel 100ml. 450 sterile tube with cotton stick 451 straight wire 452 scissors small 453 scissors big 454 savlon 455 scalpal 456 serum test tube stand 457 test tube 12 ml. 458 test tube 12x100mm 459 test tube 15x125 460 test tube 15x150mm 461 test tube 13mmx100mm 462 test tube large 20cc 463 test tube 4 inch 464 test tube 5 inch 465 test tube 6x0.5 466 test tube 6x3 large 467 test tube holder 468 test tube stand for 12x100ml. 469 tuberculin syringe 1ml. 470 tuberculin syringe 2ml. 471 tourniquet 472 test tube stand 473 testing needle 474 test tube rack 475 thermal rolls 476 uronometer tube 100ml. 477 uro stick 478 urostick complete test 479 urobilinogen test reagent 480 universal ph indicators strip 481 variable pipette 01 μl to 50 μl 482 variable pipette10 μl to 2000 μl 483 variable pipette 50μl to 5000 μl 484 volumatric flask 5ml. 485 volumatric flask 10ml. 486 volumatric flask 25ml. 487 volumatric flask 50ml. 488 volumatric flask 100ml. 489 volumatric flask 1000cc 490 volumatric flask 2000cc 491 widal round tube ¼ 492 widal conical tube ¼ 493 wooden rack 494 widal rack steel 495 whatman filter paper no 1 496 list of culture media 497 agar agar 498 bile esculin agar 499 beef extract 500 brain heart infusion agar 501 brain heart infusion broth 502 corn meal agar 503 deoxycholate citrate media 504 lab lamco 505 mack conkeys agar 506 muller hinton agar 507 motility sulphite media 508 manitol salt agar 509 mr reagent 510 nutrient agar 511 nutrient broth 512 oxidase reagent 513 peptone powder 514 potato dextrose agar 515 phenyl pyruvic acid media 516 simmons’s citrate media 517 sabourds dextrose agar 518 selenite f broth 519 triple sugar iron media 520 tcbs agar 521 tsi 522 urease agar base 523 wilson and blair 524 xld agar 525 clostridium difficile agar base 526 clostridium difficile supplement 527 gaspack ( le002a ) 528 robertson cooked meat media 529 cetrimide agar 530 reinforced clostridial hi veg. tm broth 531 soyabean casein digest broth 532 list of antibiotic disc 533 amikacin 534 amoxyclav 535 ampicillin 536 azithromycin 537 bacitracin 538 cefixime 539 cefoparaznoe / sabactum 540 cefoperazone 541 cefotaxime 542 cefotaxime+ clavulanate 543 cefpodoxine 544 ceftazidime 545 ceftazidime+clavulanate 546 ceftriaxone 547 cephalexin 548 ciprofloxacin 549 cifoxitin 550 cefepime 551 doxycyclin 552 erythromycin 553 gentamycin 554 imepenam 555 impenem edta disc 556 levofloxacin 557 meropanam 558 norfloxacin 559 novabiocin 560 nitrofurantoin 561 oxacillin 562 ofloxacin 563 piperac / tazobactum 564 piperacillin 565 polymyxin 566 ticarcillin clavlanic acid 567 vancomycin 568 list of items for biochemistry nmindray, backman coulter biosystem ba 400, electrolyte analyser 569 glucose 570 calcium 571 urea 572 creatinine 573 uric acid 574 sgot 575 sgpt 576 total bilirubin 577 direct bilirubin 578 total protein 579 albumin 580 alp 581 serum amylase 582 hdl cholestrol 583 cholestrol 584 triglycerides 585 washing solution 586 ise reagents 587 ise refrence 588 ise mid standard 589 ise buffer 590 ise na+ / k+ selectivity check 591 ise internal refrence 592 cleaning solution 593 ise high serum standard 594 ise low serum standard 595 system calibrator 596 control level 1 597 control level 2 598 electrolyte pack ( cbs 400 ) 599 sample cup 600 serum tube ( red cap ) 601 rotor 602 list of close system machine heamatolyser 3 part, 5 part cell counter make mindray, erma, hemax 330, meditech dm 5200 aspan chemilumenacense machine, coagulation machine, hplc, flow cycometer etc. & combosis ii, siemens abg 603 autodil plus hsn code 38220090 604 autolyse plus hsn code 38220090 605 autoclean plus hsn code 38220090 606 cleaning solution b hsn code 38220090 607 diluent 608 lyse 1 609 lyse 2 610 probe cleaner 611 m53 diluent 612 m 53 leo i 613 m 53 leo ii 614 m53 lh lyse 615 m 53 cleaner 616 sta neoplastine cl+5 ( pt ) 617 sta cepha screen 4 ( aptt ) 618 sta thrombin 2 ( tt test ) 619 sta lia test ( d dimer test ) 620 sta liquid fib ( fibrinogen test ) 621 sta liatest control n+p 622 sta coag.control n+p 623 sta cacl 20.00 25m 624 sta owren koller 625 sta desorb u 626 sta cleaning solution 627 sta satellite cuvettes 628 white stirring bar 629 bga 3 630 bga 4 631 cal 3 632 cal 4 633 wash 2 634 po2 membrane shell 635 pco2 membrane shell 636 k+ membrane shell 637 cl membrane shell 638 ca++ membrane shell 639 ref. membrane shell 640 protein remover 641 set tubing for roller 642 po2 sensor unit 643 pco2 sensor unit 644 cl conducting system 645 printer paper roll 646 ref.membrane shell 647 pco2 membrane shell 648 po 2 membrane shell 649 ca+ membrane shell 650 k+ membrane shell 651 refernece conducting system 652 ca+ conducting system 653 k+ conducting system 654 na conducting system 655 cell diluent 656 lyse 657 cleaner 658 probe cleaner 659 measurement cartidage & wash waste 660 printer paper 661 automatic quality control 662 80 a eluent 663 80 b eluent 664 80 ct eluent 665 80 h hemolysis washing solution 666 paper roll 667 d dimer 668 trop i 669 il 6 670 pct 671 ferritin 672 t3 673 t4 674 tsh 675 wash buffer 676 lcle 677 starter 1&2 678 reaction module 679 flowcycometer...

Directorate Of Health Services - Madhya Pradesh

28373201 supply of drugs and medicines and other equipment year 2021 22 2 desflurane 240 ml in aluminum container 3 5 fluorouracil (5 fu)(250mg),injection 4 5 fluorouracil (5 fu)(500mg inj),injection 5 acamprosate(333 mg),tablet 6 acarbose(25 mg),tablet 7 acarbose tab 50mg 8 aceborophylline 100 mg cap 9 aceclofenac 100mg+paracetamol 325mg + serratiopeptidase 10mg tab(10x10),tablet 10 aceclofenac 100mg+paracetamol 325mg tab( ),tablet 11 acenocoumarol tab i.p. 2 mg 12 actinomycin d(0.5mg vial),vial 13 acyclovir 5% ointment/cream(5gm ),ointment 14 adenosine inj 6 mg/ 2ml (2ml amp) 15 adrenochrome monosemicarbazone(0.75mg /ml (2 ml amp)),injection 16 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 45cm and should be both hand(foot activated with curved tip),consumable 17 aggs(anti gas gangrene serum) 10,000 iu/ml 18 aggs(anti gas gangrene serum)40000 iu/ml 19 biotene tablet 20 agomelatine 25 mg 21 albendazole 100 mg 22 alfacalcidiol capsule(0.25 mcg),capsule 23 alkaline citrate with k oral solution each 10 ml contains sodium citric 1 gram potassium citrate 0.65 gram citric acid 1 gram syrup 24 allopurinol 100 mg tab 25 aminoacid 10% (essential) ivf 26 aminoacid 5% ivf (100ml bottle) 27 aminoacid (essential) infusion(10% 100ml ffs bottle),bottle 28 amino acid glass bottle contain amino acid 6 gm, nitrogen 0.929, essential amino acid 51%, non essential amino acid 49%, bcca 22.6%, carbohydrate 5% inj 29 amino infusions 200ml bottle 30 aminophylline inj. 25 mg/ml 10 mg vial(25 mg/ml 10 mg vial),injection solution for 31 amiodarone tab 200mg(200mg),tablet 32 amisulpride(100 mg),tablet 33 amisulpride(200 mg),tablet 34 amisulpride(50 mg),tablet 35 amitriptyline tab. ip 25 mg 36 amlodipine 5mg+atenolol 50mg tab 37 amoxicillin 100 mg /ml 10 ml with dropper 38 amoxicillin cloxacillin and lactic acid bacillus capsules 250mg 39 amoxicillin dispersible tab.usp 125 mg tablet 40 amoxycilline and clavulanic acid inj 41 amphotericin b inj ip(50 mg),injection 42 ampicilline + cloxacilline injection (250 mg + 250 mg) vial injection 5ml vial( ),injection 43 ampicilline + cloxacilline injection tablet((250 mg + 250 mg)),tablet 44 antacid syrup , 170 ml (dried alluminium hydroxide gel 200 mg, simethicon 25 mg / 5 ml, ) syrup 45 anti hemophilic factor ix complex coagulation factor ii,vii,ix,x concentrate(600 iu vial),injection 46 anti hemophilic factor viii inj. 500iu 47 antioxident capsule 48 anti rabies immunoglobulin inj.150 iu per 2 ml vial 49 aripiprazole(10 mg),tablet 50 aripiprazole 15 mg 51 aripiprazole 20 mg 52 aripiprazole 30 mg 53 artesunate tablets 50 mg + sulphadoxine 500 mg + pyrimethamine 25 mg tablets ip 54 ascorbic acid (vitamin c) tab i.p. 500mg 55 atomoxetine 10 mg 56 atomoxetine 25 mg 57 atorvastatin(5 mg),tablet 58 atracurium 10mg/ml inj 2.5ml vial 59 atropine + dexamethasone + chloramphenicol 1% + 0.1% + 0.5% 5 ml 60 azathioprine 50mg tab 61 azithromycin 1 gm, fluconazole 150 mg, secnidazole 1 gm tab tablet 62 azithromycin inj 100mg/5ml 63 aztreonam inj(500 mg),injection 64 azythromycin 1 gm + fluconazole 150 mg, + secnidazole 2 g, tablet c tablet 65 baclofen 20 mg 66 baclofen 30 mg 67 baclofen 40 mg 68 basal insulin glargin(100iu/ml (10ml vial)),injection 69 basal insulin glargine injection 300iu disposable pen 300iu with 4 needles per pen 31g needle( ),pens 70 basal insulin glargine penfill 300iu with free permanent pens one pen for each five cartridge and 10 needles per pen 71 b complex minerals with zinc cap 72 beclomethasone dipropionate, neomycin sulphate, miconazole nitrate(0.025 % + 0.5 % + 2 % (5 gm tube)),ointment 73 benzathine penicillin 24 lac iu / vial vial 74 benzoic acid + salicylic acid(6% + 3% (15 gm tube)),ointment 75 benzoyl peroxide 0.025 20 gm 76 benzyl benzoate application i.p. 25%w/w (100ml bottle) 77 benzyl benzoate emulsion( ),emulsion 78 betamethasone sodium phosphate(ml contain betamethasone na phosphate equal to 4mg of betame (1ml amp)),injection 79 betamethasone valerate cream 0.05 %(0.05%),eye drops/ ointment 80 betamethasone valerate oint 0.1%(15 gm tube),ointment 81 betamethasone valerate oint/cream ip. 0.12% 82 bevacizumab(100 iu inj (4 ml vial)),injection 83 bicalutamide(50mg ),tablet 84 bismuth iodoform paraffin paste 200 gm jar 85 black disinfectant fluid (phenyl) as per schedule o grade iii 86 bleomycin 15 mg /vial vial 87 bleomycin 15 units / vial 88 blonanserin 2 mg 89 blonanserin 4 mg 90 blood cell counter key(key),consumable 91 bortezomib(2mg),injection 92 bortezomib(3.5mg vial),injection 93 bromhexine hcl 4 mg+ guaiphensin 50 mg + terbutaline sulphate 1.25 mg/5ml syp(100 ml bottle),syrup 94 bupivacaine hydrochloride inj 0.25% (20 ml vial)(20 ml vial),injection 95 bupivacaine hydrochloride inj. 0.25mg (20 ml vial) 96 bupropion 150 mg 97 buspirone 10 mg 98 buspirone 5 mg 99 busulphan 2 mg 100 butorphanol tartrate 1mg /ml 1 ml 101 cabergoline 0.5 mg 4 tablets / strip 102 calcitriol 0.25 mcg 103 calcium acetate 667 mg 104 calcium carbonate 625 mg, vitamin d3 125 iu / 5 ml(100 ml syrup),syrup 105 calcium carbonate + vitamin d3 + zinc(200 ml syrup),syrup 106 calcium chloride inj.( ),injection solution for 107 calcium citrate 500mg with vitamin d3 200mcg tablet 108 calcium gluconate 200ml syrup 109 calcium leucovorin 50 mg/vial inj 110 calcium phosphate(2 : 1 ratio (100 ml bottle)),syrup 111 calcium syp 100ml syrup (240mg/5 ml) 112 capecitabine 500 mg tab 113 capreomycin 1000 mg / vial injection(10 ml),vial 114 carbamazepine 100 mg / 5 ml 100 ml bottle 115 carbamazepine(200 mg),tablet 116 carbamazepine tab. 400mg 117 carbimazole(10 mg),tablet 118 carbondioxide gas in medium size cylinder(b type),miscellaneous 119 carbondioxide gas in small size cylinder(a type),miscellaneous 120 carboplatin(150mg 15 ml vial),injection 121 carboplatin(450mg 45ml multidose vial),injection 122 carboprost promithamin 250mcg/ml inj (1ml amp) 123 carboprost trome thamine inj usp 0.25mg/ml vial( ),injection solution for 124 carboxymethylcellulose(5 ml),eye drop 125 carboxymethylcellulose eye drop ip 1% w/v 10ml vial 126 carvedilol(3.125 mg),tablet 127 carvedilol 6.25 mg tab 128 cefazolin(1gm),injection 129 cefazolin inj 500mg vial 130 cefepime 1gm and tazobactam 125 mg inj(vial),injection solution for 131 cefepime(250 mg/vial),injection 132 cefepime 500mg/vial inj(500mg/vial),injection solution for 133 cefixime 100 mg / 5 ml 10 ml bottle 134 cefixime 50 mg/5ml, 30 ml, drop(30 ml),drop 135 cefixime(50 mg dt),tablet 136 cefixime + azithromycin 200 mg + 250 mg 137 cefixime syrup 50mg/5ml(30 ml bottle),syrup 138 cefoperazone 1000mg + sulbactam 1000mg inj(vial),injection 139 cefoperazone 1gm /vial vial 140 ceftazidime(250mg/vial),injection 141 ceftazidime inj(500mg/ vial),injection 142 ceftriaxone tab(250 mg),tablet 143 ceftriaxone+tazobactum 250mg+31.25mg inj(vial),injection solution for 144 cefuroxime 750mg powder for solution for injection(750mg),injection powder for 145 centchroman ip (30 mg),tablet 146 cetirizine syrup(5mg/5ml 30 ml bottle),syrup 147 cetrimide 15% w/v + chlorhexidine 1.5% w/v (1 liter bottle)( ),bottle 148 cetrimide + chlorhexidine (conc.) (15%+7.5%) (1 liter bottle)(15%+7.5%),liquid 149 cetrimide + choline salicylate 0.01% + 8% all w/v 10 gm tube 150 cetrimide + choline salicylate gel for oral ulcer 15ml tube 151 cetrimide cream bp(0.1% w/w),tube 152 charcoal activated (powder) 100 gm box/pouch 153 chlorambucil(2 mg),tablet 154 chloramphenicol 0.5%(5ml),eye drop 155 chloramphenicol 1% w/w 50 /pack 156 chloramphenicol 500 mg capsule 157 chloramphenicol eye ointment 1% 4 gram( ),tube 158 chlordiazepoxide 10 mg 159 chlordiazepoxide 20 mg 160 chlorhexidine gluconate solution 161 chloroquine phosphate inj. 64.5mg/ml 30ml vial( ),injection solution for 162 chloroquine phosphate syrup. 163 chlorpromazine hydrochloride 50 mg tab 164 chlorpromazine tab 50 mg 165 chlorthalidone 50 mg 166 cholecalciferol 60000 iu 167 choline salicylate + benzalkonium chloride 9% + 0.02% 10 gm 168 chymotrypsin and trypsin 100000 iu tab 169 ciprofloxacin inj 100 mg/50ml (100ml ffs bfs bottle) 170 ciprofloxacin + tinidazole(250 mg + 300 mg),tablet 171 cisplatin( 10 mg vial),injection 172 cisplatin 50 mg inj (50 ml vial) 173 clindamycin(150mg/ml (2 ml vial/amp)),injection 174 clobetasol 0.05% + gentamicin 0.1% cream 10 gm(10 gm tube),cream 175 clofazimine cap 50 mg capsule 176 clomiphene citrate 25 mg tab 177 clonazepam 0.5mg tab 178 clonidine 100 mcg tab 179 clopidogrel 75mg + aspirin 75mg tab 180 clotrimazole 1% 100 gm 181 clotrimazole 1% w/v 15 ml 182 clotrimazole 1%w/v +lignocaine 2%w/v(10ml),eye drop 183 clotrimazole 1%w/v +lignocaine 2%w/v ear drop 10ml vial bfs/ffs squeeze (10ml vial) 184 clotrimazole 1% w/w 30 gm 185 clotrimazole cream 1%(15 gm tube ),cream 186 clotrimazole vaginal 500 mg tab tablet 187 clotrimazole vaginal tablet i.p. 100mg (without applicator) 188 cloxacillin(125 mg / 5 ml 40 ml bottle),syrup 189 cloxacillin 250 mg / vial vial 190 cloxacillin cap(250 mg),capsule 191 cloxacillin capsules 500mg 192 cloxacillin sodium inj. 500mg 193 clozapine 25 mg 194 cold cough drop , 15 ml(phenyl ephrine 5 mg, chlorphenaramine 0.5 mg, paracetamol 125 mg/ 5 ml),consumable 195 colistinethate sodium inj bp(1 moillion iu),injection 196 compound sodium lactate injection ip (ringers lactate) 0.24 % w/v of lactic acid ( eq. to 0.32% w/v of sodium lactate), 0.6 % w/v sodium chloride, 0.04 % w/v potassium chloride and 0.027 % w/v calcium chloride (500 ml bottle)( ),solution 197 cream sumag( ),cream 198 crystalline penicillin 5 lakh iu / vial vial 199 curved blade having telescoping shaft(10cm 14cm with integrated hand activation control buttons),consumable 200 cyclobenzaprine 5 mg 201 cyclopentolate 1% w/v(5 ml),eye drop 202 cyclophosphamide(1000mg (vial/amp)),injection 203 cyclophosphamide 50 mg tab 204 cyclophosphamide inj(200 mg/vial),injection 205 cyclophosphamide inj 500mg/vial(each),injection solution for 206 cycloserine 250 mg 10 capsules 207 cyclosporine 25 mg 208 cyclosporine 50 mg 209 cyproheptadine hcl + tricholine citrate(2mg + 275 mg / 5 ml (200ml bottle)),syrup 210 cytra.bine 100 mg vial 211 dacarbazine(200 mg per vial),injection 212 dacarbazine inj. (dtic)(500 mg vial),injection 213 daunorubicin( 20 mg / vial),injection 214 daunorubicin 50 mg / vial vial 215 deferasirox dispersible tab. 400mg 216 desferioxamine inj 0.5g/vial 217 desferioxamine injection 500mg 218 des venlafaxine 100 mg 219 des venlafaxine(50 mg),tablet 220 dexamethasone sodium inj 4mg/2ml(2ml vial),injection 221 dexmedetomidine hydrochloride injection(100mg),injection 222 dexmedetomidine hydrochloride injection 1ml amp(1 ml amp),ampoule 223 dextran iv 40%(500ml ),injection 224 dextromethorphan hydrobromide syrup 13.5 mg/ 5ml (30 ml bottle) 225 dextrose 10% 500ml bfs bottle( ),injection solution for 226 dextrose(10% inj 500 ml ffs btl),injection 227 dextrose(25% 100 ml ffs bottle),injection 228 dextrose 25%(500ml ffs bottle),injection 229 dextrose 25% inj 100ml ffs/bfs bottle 230 dextrose 25% inj 500ml ffs/bfs bottle( ),injection solution for 231 dextrose 50 %, (25 ml) inj(50 %),injection 232 dextrose 50% inj 100ml ffs/bfs bottle 233 dextrose 5%(500ml ffs bottle),injection 234 dextrose with saline(5% + 0.9% (500ml ffs bottle)),injection 235 diacerein + glucosamine 50 mg + 750 mg 236 diazepam 10 mg tab. 237 diclofenac gel 1% 10gm tube 238 diclofenac + menthol(30gm),tube 239 diclofenac+paracetamol+chlorzoxazoe(50 mg + 325 mg + 250 mg),tablet 240 dicyclomine 20mg+paracetamol 325mg tab 241 dicyclomine drops 242 dicyclomine hydrochloride 20 mg tab 243 dicyclomine syrup 244 didanosine 250 mg 245 didanosine 400 mg 246 diethylcarbamazine 50 mg 247 digestive drop ( digestive enzyme and multivitamin with l lysine )( 15 ml),drop 248 diltiazem 5mg/1ml 5 ml 249 diltiazem tablet(60 mg),tablet 250 dimercaprol 50 mg / ml 2 ml amp 251 dinoprostone gel(0.5%),gel 252 diphenhydramine syrup 12.5mg/ml 253 diphtheria antitoxin 10000 iu (10ml vial) 254 diproex er tablet 500mg(500mg),tablet 255 disodium acid phosphate + sodium phosphate 10 gm + 8 gm /100 ml 100 ml 256 disodium hydrogen citrate 1.25gm/5ml 100 ml(100 ml),syrup 257 dispersible zinc tab 10mg 258 disulfiram 250 mg 259 divalproex sodium 250 mg 260 dobutamine 12.5 mg / ml 20 ml vial 261 dobutamine inj 50 mg / 5 ml 262 docetaxel(120mg vial),injection 263 docetaxel 20mg inj 264 docetaxel 80mg inj 265 domperidone(1 mg/ ml 10 ml with dropper),drop 266 domperidone +ranitidine 150mg tab 267 domperidone suspension 5mg/5ml 268 donepezil 10 mg 269 donepezil 5 mg 270 doxophylline 400 mg 271 doxorubicin inj 10mg 272 doxorubicin(lypholozed) 10 mg / vial 273 doxorubicin(lypholozed) 50 mg / vial 274 doxorubicin (lypholozed)(50mg vial),injection 275 doxycycline tab. 100mg( ),tablet 276 doxylamine succinate 10 mg 277 doxylamine succinate + pyridoxine(10mg+10mg),tablet 278 dpt with vvm 10 doses 279 drop iron 15ml 280 drotaverine 80 mg(10x10),tablet 281 duloxetine(20 mg),tablet 282 duloxetine 30 mg 283 duloxetine(40 mg),tablet 284 dydrogesterone 10 mg 285 each combipack red colour blister pack contains 3tab of artesunate 150mg and 2 tab of sulphadoxine pyrimethamine (500mg + 25mg)( age group 9 to 14 years),tablet 286 electrolyte m inj 500ml ffs bottle 287 elemental iron 50 mg /5 ml 150 ml bottle 288 elemental iron 50 mg /ml 15 ml with dropper 289 eltrombopag 25 mg 290 enalapril maleate inj. 1.25 mg per ml( ),injection 291 enalapril maleate tab 2.5mg 292 ephedrine 30 mg / ml 1 ml amp 293 epinephrine hydrochloride inj. 1 mg/ml( ),injection solution for 294 epirubicin(10mg vial),injection 295 epirubicin(50mg vial),injection 296 epirubicin inj 100mg/vial vial(each),injection 297 eplerenone 25 mg 298 equine anti rabies immunoglobulin inj. 299 erythromycin (as estolate)(125mg/5ml, 60ml blttle),suspension 300 erythromycin (as estolate) powder for susp(125 mg/5ml 40ml bottle),consumable 301 erythropoietin 10000iu inj 302 erythropoietin(4000 iu inj vial),injection 303 escitalopram + clonazepam 10 mg + 0.5 mg 304 esmolol 100 mg /vial vial 305 estradiol 10 mg /vial vial 306 estradiol 1 mg /gm 15 gm tube 307 estradiol cypionate + medroxy progesterone acetate 5 mg + 25 mg /0.5 ml 0.5 ml 308 ethacridine lactate 1 mg / ml 50 ml 309 ethamsylate 250mg tablet 310 ethamsylate inj(250mg (2ml amp)),injection 311 ethamsylate tab 500mg 312 ethinyl estradiol 0.01 mg 10 tablets 313 ethinyl estradiol 0.05 mg 10 tablets 314 ethinyl estriadiol+norethisterone tab(35 mcg +1mg),tablet 315 etophylline + theophylline sr tablet 231mg + 69mg( ),tablet 316 etoposide(100mg vial),injection 317 etoposide 50 mg 8 capsule 318 everolimus tab 10mg(4x7),tablet 319 fentanyl citrate inj 50 mcg/ml(2ml ampoule),ampoule 320 filgrastim 300mcg inj 321 filgrastim 300 mcg(prefilled syrings),vial 322 fluconazole 100 mg 323 fluconazole 200 mg 324 fluconazole 50 mg 325 fluconazole eye drop 3 mg / ml (10 ml vial)(3 mg),eye drop 326 flumazenil 0.1 mg / ml 5 ml multiple dose vial 327 flunarizine 10 mg 328 fluoxamine(50 mg),tablet 329 fluoxetine 40 mg 330 flupenthixol 20 mg/ml 1 ml 331 fluphenazine 2.5 mg 332 fluphenazine 25 mg / ml 1 ml amp 333 flurbiprofen sodium 0.03% 5 ml 334 formoterol + budesonide(6 mcg + 100 mcg/puff (120 mdi)),inhaler 335 frusemide 20 mg, spironolactone 50 mg, tab tablet 336 fusidic acid cream/sodium fusidic ointment 2% 5gm tube(5 gm),tube 337 gabapentine 100 mg 338 gefitinib tab 250mg 339 gemcitabine(1000mg vial),injection 340 gemcitabine(1.4 gm vial),injection 341 gemcitabine(200mg/vial),injection 342 gentamicin inj(40 mg/ml 2 ml amp),injection 343 gentamycin 40 mg /ml 10 ml vial(10 ml vial),injection 344 gentamycin + hydrocortisone 0.3% + 1% 5 ml vial 345 glibenclamide tab 2.5 mg 346 glimepiride + metformin hydrocloride sr tab 1 mg + 500 mg 347 glycerine + mag sulphate crystal 250 ml jar 348 glycerine + sodium chloride enema 15% + 15% 20 30 ml /pack 349 glycerine suppository usp 3 gm bottle /10 350 glycopyrrolate inj. 0.2 mg/ml (1 ml amp)(1 ml amp),injection solution for 351 granisetron 1 mg /ml 1 ml amp 352 griseofulvin tab. ip 125 mg 353 haemoccel, 500 ml inj (electrolight na, k, ca, cl) 354 haemocoagulase 1 iu /ml 10 ml 355 haemoglobin tube(tube),consumable 356 haemoglobi pippate(pippate),consumable 357 haloperidol 1.5 mg 358 hcg (human chorionic gonadotropin) inj 5000 iu vial 359 hemotocyto meter(meter),consumable 360 heparin 25000 iu 5 ml 361 hepatitis b immunoglobulin 100 iu/vial 362 hepatitis b immunoglobulin im inj 200 iu/vial 363 hepatitis b vaccine ( hep b) 10 doses 364 human albumin 20% (50 ml vial) 365 human chorionic gonadotropin 2000 iu / ml 1 ml amp 366 human chorionic gonadotropin inj 5000 iu 1ml amp 367 human insulin regular/soluble(100iu/ml (10ml vial)),injection 368 human insulin regular/soluble(40iu/ml (10ml vial)),injection 369 human normal immunoglobin(5gm/100ml),injection 370 hydrocortisone sodium succinate inj. 200mg vial( ),injection 371 hydroethylstarch 6% solution with sodium chloride 0.9% iv infusion (hydroxy ethylstarch solution ffs/bfs)(0.9% iv),bottle 372 hydroxyethylstarch 3%(500 ml),injection 373 hydroxyethyl starch 6%(each),suspension 374 hydroxyprogesterone caproate inj i.p. 250mg/ml 375 hydroxypropyle methyle cellulose opthalmic solution 2% 2ml pfs 376 hydroxypropyl methylcellulose eye drops(2% 5 ml vial),eye drop 377 hydroxy urea(500mg),capsule 378 hyoscine butylbromide inj. 20mg/ml 379 ibandronic acid inj(6mg),injection 380 ibuprofen 100mg + paracetamol 125mg per 5 ml syrup(60 ml bottle),syrup 381 ibuprofen 10mg+paracetamol 125mg syrup 382 icthyol glycerine 1% 30 ml 383 id wrist band(identification for mother/child specific colour)(wrist band/no),consumable 384 ifosphamide 1gm lyophilised each vial + 3amp of mesna 100mg/2ml inj 385 ifosphamide + mesna(1gm),injection 386 imatinib 100 mg cap 387 imatinib cap/tab(100 mg),tablet 388 imatinib mesylate 400 mg 389 imipenem 250mg+cilastatin 250mg powder for solution(1 each),injection powder for 390 imipramine 25 mg 391 inj.iv dns( ),injection 392 insulin aspart in disposable pen 300iu with minimum 4 needles per pen 31g needle 393 insulin aspart penfill 300 iu with free permanent pen (one pen per five cartridges and ten needles per pen) 394 insulin biphasic lispro 25:75 100 iu/ml (3 ml cartridge)(firm has to supply compatible pen along with cartridges as and when required without any extra cost),cartridges 395 insulin biphasic/premix 50:50(100 iu/ml (10 ml vial)),injection 396 insulin biphasic/premix 50:50(40 iu/ml (10 ml vial)),injection 397 insulin human mixtard inj. 30:70( ),injection solution for 398 insulin intermediate inj 399 insulin lispro in disposable pen 300iu with minimum 4 needles per pen 31g needle 300iu(prefilled syringe),pens 400 insulin soluble inj. 40 iu/ml 401 insulin syringe(each),consumable 402 intraocular irrigating solution sodium chloride 0.49 % w/v, potassium chloride 0.075 % w/v, calcium chloride 0.048 %, magnesium chloride 0.03 % w/v, sodium acetate 0.39 % w/v, sodium citrate 0.17 % w/v. 500 ml ffs 403 intravenous fat emulsion 20% w/v(20% w/v),bottle 404 intravenous immuglobin (ivig)(each),injection 405 ipratropium bromide + levosalbutamol(20mcg+50mcg, 200 mdi),inhaler 406 ipratropium bromide powder for inhalation 250mcg/ml 407 irinotecan 100 mg inj (1 ml amp) 408 irinotecan(40mg/vial),injection 409 irinotecan hydrochloride(100 mg),injection 410 iron and folic acid entric coated tab dessicated ip 67mg equivalent to 20mg of elmental iron 411 iron and folic acid sugar coated tab dried ferrous sulphate ip eq. to 45 mg ferrous iron and 400 mcg folic acid ip (pink colored tab) wifs junior ifa tablets (detail specification as per tender)( ),tablet 412 iron dextran 50 mg / ml(2 ml amp),injection 413 iron ferrous sulphate folic acid 100ml(each 5ml contains ferrous sulphate i.p equivalent to elementary iron 100mg folic acid i.p 0.5mg),syrup 414 iron sucrose 20mg(20 mg),injection 415 iron syrup 200 ml (elemental iron 40 mg, ammonium citrate 200 mg, cyanocobalamin 7.5 mg, folic acid 0.5 mg, zinc sulphate 7 mg/ 5 ml) 416 isoflurane(250 ml amber color bottle),inhalation 417 isoflurane solution (liquid for inhalation) 100ml (amber color bottle) 418 isoprenaline 2 mg /ml 1 ml 419 isoxsuprine hydrochloride inj. 5mg/ml (2 ml amp)(2 ml),injection solution for 420 isoxsuprine tablets i.p. 20 mg tablet 421 itraconazole cap(100 mg),capsule 422 ketamine hydrochloride inj(50mg/ml (10 ml vial)),injection 423 ketamine hydrochloride inj. 50mg/ml (2 ml amp) 424 ketoconazole tab 200mg( ),tablet 425 labetalol 20 mg / 4 ml inj (4 ml) 426 lactobacillus 150 million spores 1 sachet 427 lactulose solution 3.35gm/5 ml 428 lactulose syrup(10gm/15ml),syrup 429 lamotrigine dt(50 mg),tablet 430 lamotrigine dt tab(100 mg),tablet 431 l asparaginase 5000 iu lyophilised(vial),injection 432 letrozole(2.5 mg),tablet 433 leuprolide depot inj(3.75mg),injection 434 levamisole 50 mg 435 levodopa + carbidopa 200 mg + 50 mg 436 levodopa +carbidopa tab 250mg + 25mg 437 levofloxacin 500 mg(100 ml ffs bottle),injection 438 levonorgestrel emergency contraceptive(0.75mg),tablet 439 lidocaine 2% inj. 30 ml vial( ),injection solution for 440 lignocaine hydrochloride topical solution usp 441 linazolid(300ml),injection 442 linezolid 200mg/100ml(100ml ffs bottle),injection 443 linezolid tab(600 mg),tablet 444 lithium carbonate 300 mg 445 lomustine 40mg cap 446 lorazepam 1 mg 447 l ornithine +l aspartate 5mg inj 448 losartan tab 25 mg(10x10),tablet 449 magnesium hdroxide+aluminium hydroxide (625mg+312mg/5ml) 450 magnesium suplhate inj 50 % w/v (2ml amp) 451 magnesium suplhate injection i.p.50 % w/v 10ml amp 452 mannitol(20% 100 ml ffs bottle),injection 453 mannitol inj,10% 100 ml bottle 454 mannitol inj. 20% 350ml ffs bottle 455 mebendazole 100 mg tab 456 medroxy progesterone acetate 10 mg 457 medroxy progesterone acetate(150mg/ml 1 ml amp),injection 458 mefenamic acid + dicyclomine tab(250 mg + 10 mg),tablet 459 mefenamic acid + drotaverine hcl 250 mg + 80 mg 460 mefloquine 250mg tab 461 mehylcobalamine 1500 mcg, alpha lipoic acid 100 mg, folic acid 1.5 mcg, thiamine mononitrate 10 mg, pyridoxine hcl 3 mg cap capsule 462 memantine(10 mg),tablet 463 menadione usp (vitamin k3)(10 mg/ml (1 ml amp)),injection 464 mephentermine inj 15mg/ml 10ml vial 465 mesalamine (5 aminosalicylic acid) usp 800 mg 466 metformin 500mg + gliclazide 80mg tablet(10x10),tablet 467 methocarbamol 100 mg /ml 10 ml 468 methotrexate(10 mg),tablet 469 methotrexate 2.5 mg tab 470 methotrexate 5 mg 471 methotrexate(7.5 mg),tablet 472 methotrexate inj 15mg/ml (vial) 473 methotrexate inj 500mg vial 474 methotrexate inj 50mg (2ml) 475 methylcobalamine (vitamin b12) 500 mcg /ml 3 ml 476 methyl prednisolone(500mg),injection 477 methyl prednisolone sodium succinate inj.1000mg vial 478 methyl prednisolone sodium succinate inj. usp 125mg(10ml),vial 479 metoprolol + amlodipin 25 mg + 2.5 mg 480 metoprolol + ramipril 25 mg + 2.5 mg 481 metronidazole 0.01 15 gm cream 482 micronised progesterone(100 mg),tablet 483 micronised progesterone 400 mg 484 micronised progestrone(200 mg),tablet 485 micronised progestrone 50 mg /ml 4 ml amp 486 micronised progestron inj. 200mg/ml 487 midazolam inj. 1mg/ml 5ml amp 488 misoprostol 100 mcg 4 tables / pack 489 misoprostol 400 mcg 4 tablets / strip 490 modafinil 100 mg 491 mometasone 0.10% 15gm 492 morphine sulphate inj. ip 10mg/ml(1ml ampoule),injection solution for 493 moxifloxacin(100ml),injection 494 moxifloxacine eye drop 0.5%w/v 495 multivitamin 10ml amp inj 496 multivitamine 200ml syrup 497 multivitamin syrup 60 ml (each 5ml contains vitamin a (palmitate) ip 1600 iu+vitamin d3 ip 200 iu(+vitamin b2 ip 1.00mg+vitamin b6 ip 0.50mg+niacinamide ip 15.00mg+d panthenol ip 1.00mg),syrup 498 multivitamin without iron syrup(100ml),syrup 499 multivitamin with protein 200 ml(200 ml),syrup 500 multivitamin with zinc drop 15ml(15 ml),drop 501 n acetyl cysteine inj 200mg/ml in 1ml amp 502 naltrexone(50 mg),tablet 503 neomycin+bacitricin ointment 5mg+500 iu/g 504 azothioprine 50 mg 505 azothioprine 75 mg 506 azothioprine 100 mg 507 neostigmine 30mg 508 neostigmine 60 mg 509 netilmycin 25 mg /ml 1 ml vial 510 nicorandil 5 mg 10 x 10 511 nilotinib 150mg tab 512 nilotinib 200mg tab 513 nimesulide 100 mg tab 514 nimesulide +paracetamol 100 + 325 mg,tablet 515 nimesulide +paracetamol+serratiopetidase 100 + 325 + 10 mg 516 nitrofruantoin tablet ip 100mg 517 noraderanaline inj. 2 mg base/2 ml amp 518 norethisterone enanthate 200 mg/ml 1 ml 519 norethisterone tablets 5mg 520 norfloxacin 200 mg 521 norfloxacin + metronidazole suspension 100mg+100mg/5ml(30 ml bottle),bottle 522 norfloxacin + tinidazole((100 mg + 100 mg) 30ml syrup),syrup 523 norfloxacin + tinidazole 400mg tab 524 norfloxacin +tinidazole 400mg tab 525 normal saline injection 0.9% (500ml ffs bottle) 526 nortriptyline 10 mg 527 n s 3% hypotonic(100ml),injection 528 octreotide lar 30mg injection 529 ofloxacin 200mg +tinidazole 600mg tab 530 ofloxacin + dexamethasone 10 ml eye drop(10 ml),drop 531 ofloxacin inj 2mg/1ml 100ml 532 ofloxacin+ metronidazole(30ml),syrup 533 ofloxacin + ornidazole (50 mg + 125 mg) / 5ml 30 ml bottle(30 ml),suspension 534 ofloxacin suspension 535 ofloxacin suspension 50mg/5 ml 30 ml bottle 536 olanzapine 10 mg/vial vial 537 olanzapine 20mg tab 538 olanzapine 2.5 mg 539 olanzapine 7.5 mg 540 olopatadine hydrochloride ophthalmic solution usp 01% w/v 5ml( ),eye drop 541 omeprazole 10 mg 542 omeprazole capsule(40 mg),capsule 543 omeprazole + domperidone 20 mg + 10 mg(capsule),capsule 544 ondansetron 2 mg 545 ondansetron 8mg inj 546 ondansetron(drops) syrup(2mg/5ml (10 ml bottle)),syrup 547 ondansetron syrup 2mg/ml 548 ornidazole tab(500 mg),tablet 549 oxaliplatin(100mg),injection 550 oxaliplatin(50mg inj 25 ml vial),injection 551 oxcarbazepine 150 mg 552 oxcarbazepine(300 mg),tablet 553 oxcarbazepine(600 mg),tablet 554 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures(size 4x 4approved by us fda),consumable 555 oxytocin(5 iu/ml (2ml amp)),injection 556 oxytocin inj. 10 iu/ml 557 paclitaxel 260mg inj 43.4ml vial 558 paclitaxel 260mg inj( ),injection 559 paclitaxel 300mg inj 560 paclitaxel 30mg inj 561 paclitaxel inj 100mg 16.7 ml vial 562 paclitaxel nanoparticle/protein bound particles inj.(100mg vial),vial 563 paliperidone 1.5 mg 564 paliperidone 3 mg 565 pancuronium 2 mg / ml 2 ml amp 566 paracetamol 100 mg/ml, 150 ml drop(150 ml),consumable 567 paracetamol 150 mg/ml(15 ml bottle with dropper),drop 568 paracetamol + chlorphenaramine+ phenylephrine 250 mg + 2.5 mg + 10 mg 569 paracetamol drop 100 mg/ml 570 paracetamol drop 10mg/ml 571 paracetamol + phenylephrine + chlorpheniramine maleate (125mg+2.5 mg+1mg) /ml(15 ml bottle with dropper),drop 572 paroxetine cr 12.5 mg 573 paroxetine cr 25 mg 574 pemetrexed(100 mg vial),injection 575 pemetrexed(500mg),injection 576 penicillin v 125 mg 577 penicillin v 250 mg 578 pentoprazole 40mg, domperidone 10mg tab tablet 579 pentoprozole 40mg +domperidone 10mg tab 580 permethrin cream 5%(30 mg),cream 581 petrollium jelly ip 500 gm 582 phenobarbitine 20 mg/ml, 60 ml, syp syrup 583 phenobarbitone(200 mg/ml),injection 584 phenobarbitone syp 200mg/5ml( ),syrup 585 phenylepherine hcl & tropicamide 5% + 1% 5 ml 586 phenytoin sodium 250 mg/ 5 ml inj (5ml vial) 587 phenytoin sodium inj. 100 mg( ),vial 588 pilocarpine hydrochloride eye drops bp 2% 589 pilocarpine nitrate inj. ip 0.5 % w/v(1 ml),injection 590 piogliatazone tab. 15mg 591 piogliatazone tab. 30 mg 592 piperacillin + tazobactam 2000 mg + 250 mg 20ml vial( ),injection 593 piracetam 200 mg /15 ml 15 ml 594 piroxicam capsules 20 mg 595 pistol grip curved coagulating shears with ergonomic handle in the following shaft lengths 23 cm. can seal blood vessels upto and including(5mm in diameter),consumable 596 pistol grip curved coagulating shears with ergonomic handle shaft lengths 45 cm. can seal blood vessels upto and including(5mm in diameter),consumable 597 pneumococcal (polysaccharide) vaccine 23 valent/0.5ml inj 598 potassium chloride inj. 150 mg/ 10ml 599 potassium chloride oral solution 100mg/ml 600 povidone iodine cream 250 gm 601 povidone iodine ointment 5% 250gm jar 602 povidone iodine vaginal pessary 200 mg 603 pralidoxime chloride injection i.p.(pam) 1gm(20 ml amp),injection 604 prazosin tab 5 mg 605 prednisolone 10 mg tab 606 prednisolone(5mg),tablet 607 prednisolone eye drops(10 mg/ml (5 ml)),eye drop 608 prednisolone tab 20 mg 609 pregabalin + methylcobalamin 75 mg + 750 mcg 610 premixed insulin biphasic analogue 25/75 in penfill 300iu permanent pen one pen per five cartidges and ten needles per pen 611 premixed insulin biphasic analogue 30/70 in penfill 300iu permanent pens one pen per five cartridges and ten needles per pen 612 procaine penicillin 4 lac iu / vial vial 613 procyclidine 5 mg 614 promethazine inj 25 mg/ml (10 ml vail) 615 promethazine syrup. 5 mg/5ml(60 ml),syrup 616 promethazine tab 25 mg 617 proparacaine 0.50% 5 ml /vial 618 propofol 1%(10ml/5ml 20ml),injection 619 propofol sodium(1% w/v 10mg/ml, 10ml vial),injection 620 propranolol tr 20 mg 621 prostaglandin e2 gel 0.5mg ( 3gm tube) 622 protamine sulphate inj 10mg/ml 623 providone iodine 1% 1% 5 ml 624 pyrazinamide 750mg tablet(10x10),tablet 625 pyridostigmine 60 mg 626 quetiapine 200 mg 627 quinine dihydrochloride 150 mg /ml 2 ml amp 628 quinine dihydrochloride(300mg/ml (2ml amp)),injection 629 quinine sulphate(ip 600mg),tablet 630 rabeprazole 10 mg 631 rabies vaccine ip human (purified chick embryo cell culture)( ),vaccine 632 rabies vaccine ip inj human (chick embryo/vero cell culture) intra muscular( ),injection solution for 633 ranibizumab inj (10ml/mg),injection 634 ranitidine 15 mg /ml 100 ml bottle 635 recombiant factor vii 1mg 636 recombiant factor vii 2mg 637 recombinant anti hemophilic factor viii(1000 iu inj / vial),injection 638 recombinant anti hemophilic factor viii(250 iu inj / vial),injection 639 rh erythropoetin 2000 i.u pfs 640 ribavirin 200 mg cap( ),capsule 641 rituximab 100mg inj 642 rituximab 500mg inj 643 rosuvastatin. 10 mg 644 roxithromycin 150mg tablet 645 roxithromycin 300 mg 646 roxithromycin 50 mg / 5 ml 30 ml bottle 647 s adenosyl l methionine 400 mg 648 salbutamol sulphate(2 mg),tablet 649 salicylic acid 0.02 30 gm 650 salicylic acid ointment 6% 651 salmeterol 25 mcg + fluticasone 125 mcg inhaler (120mdi) 652 salmeterol 25 mcg + fluticasone 250 mcg inhaler (120mdi)(250 mcg),inhaler 653 secnidazole(500 mg tab),tablet 654 sevoflurane usp inhalation anesthetic 250 ml(250 ml),bottle 655 sics blade sideport(sideport entry knife),consumable 656 sildenafil 50 mg tab 657 silver nitrate 500 ml each 658 silver sulphadiazine cream usp 1%(500 gm jar),cream 659 sitagliptin(100 mg),tablet 660 sitagliptin(50 mg),tablet 661 sodium chloride 0.3% iv 100ml(1 each),injection 662 sodium chloride 0.45% + dextrose 5%(500 ml ffs bottle),injection 663 sodium chloride 1/2 normal, hyper tonic and dextrose 5% inj 664 sodium chloride inj iv 0.9% 500ml (glass bottle)( ),injection solution for 665 sodium chloride (ophthalmic) 5% 10 ml 666 sodium citrate 3.8% 500 ml 667 sodium hypochlorite 0.03 5 ltr 668 sodium thiopentone(500mg),injection powder for 669 sodium thiopentone inj. 0.5 gm powder/vial (20ml vial) 670 sodium valproate(200mg),tablet 671 sodium valproate 500 mg 672 inj metheline blue 673 soluble insulin 30% isophane insulin 70% 100 iu inj 674 sorafenib(200mg),tablet 675 stainic rack(each),consumable 676 sulphadoxine 500mg and pyrimethamine 25mg tab. 677 surfactant bovine(135 mg phopholipid per 5 ml) 5ml vial( ),vial 678 surfactant suspension (for intratrcaheal) natural surfactant inj 25 mg/ml 679 surfactant suspension (intratrcaheal) bovine 4ml amp natural inj( ),ampoule 680 swine flu vaccine 681 syp. alkaline citrate with k oral solution 100ml syrup 682 syp. cetirizine 5mg/5ml 30ml syrup 683 syp. ferric ammonium citrate 200mg +folic acid 0.5mg+vitamin b 125mcg+zinc 5ml syrup 684 syphalis card igg+igm s/s above 99.5 % syrup 685 syrup 100ml bottle. (5ml 100mg elemental fe iron & folic acid syrup(as per the standards provided)( ),syrup 686 syrup 50ml bottle (each 1 ml contains 20 mg elemental iron and 100 mcg folic acid syrup ( as per the standards provided) with dropper)) 687 syrup cefpodoxime 50 mg 688 tadalafil 10 mg 689 tamoxifen(10 mg),tablet 690 tamoxifen(20mg),tablet 691 tamsulosin(0.4mg),tablet 692 tamsulosin 4mg tab 693 tamsulosin + dutasteride 0.4 mg + 0.5 mg 694 telmisatran 20 mg 695 temozolomide(100mg),capsule 696 temozolomide 250mg cap 697 terbutaline suplhate inj 698 terbutaline suplhate tab. 2.5mg 699 terlipressine inj. 1mg/10ml vial(1 each),injection 700 testcha(23),ampoule 701 tetracycline eye oint 1% 702 tetracycline eye ointment 1% 5 gm 703 thalidomide 100 mg 704 thiocholchecocide 4 mg 705 thiocholchecocide 8 mg 706 thiopentone injection 1gm 707 thyroxine sodium 25 mcg 100 per bottle 708 thyroxine sodium tab 50mcg(100 tab bottle) 709 tianeptin 12.5 mg 710 tinidazole tab 300 mg 711 topiramate 100 mg 712 topiramate 25 mg 713 topiramate 50 mg 714 torasemide(10mg),tablet 715 torasemide 20 mg / 2 ml vial 716 torasemide inj 100mg/2ml( ),injection 717 torasemide tab 20mg 718 total parenteral nutrition(including carbohydrate + proteins + fats solution 2000 ml),infusion 719 tpn(total parenteral nutrition) including carbohydrate + proteins + fats solution (brand: oliclinomel n7 2000 ml) 720 tranexamic acid injection bp/ip(100mg/ml (5ml amp)),injection 721 trastuzumab 440mg inj. 722 trastuzumav inj(440mg),injection 723 triamcinolone acetate 40mg/ml 724 tricholine citrate + sorbitol(550 mg + 7.15 g/10 ml (100 ml bottle) syrup),syrup 725 trifluoperazine 5 mg 726 trifluoperazine + trihexyphenidyle 5 mg + 2 mg 727 tri iodothyronine(t3),consumable 728 tropicamide eye drops 1% 5ml vial 729 trypan blue dye(1ml),consumable 730 tt with vvm 10 doses 731 tuberculin diluted ppd 5 tu/0.1 ml, 5 ml 732 ultravist 300mg(50 ml/vial),injection 733 urograffin 76% solution for injection 20ml vial 734 urograffin 76% solution for injection 50ml vial bottle 735 ursodeoxy cholic acid 150 mg tab 736 ursodeoxy cholic acid 300 mg tab 737 vancomycin hydrochloride(1000mg vial),injection 738 vancomycin hydrochloride(250mg vial),injection 739 vecuronium bromide inj 2mg/ml (2ml amp) 740 vecuronium bromide inj 4mg/ml amp 741 venlafaxine(150 mg),tablet capsule 742 venlafaxine 75 mg(cap),capsule 743 venlafaxine er/pr(37.5 mg),tablet capsule 744 ventilator adult model new port e 360 745 verapamil sugar coated tab ip 40mg 746 verapamil tab 80 mg 747 vildagliptin + metformin(50mg + 500mg),tablet 748 vinblastine 10mg inj. 749 vincristine sulphate(1mg/ml (cytocristin inj) 1 ml vial),injection 750 vitamin a (soft gelatin cap) 50000 i.u 751 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 100mg, calcium panthenol 50mg, folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more tab( ),tablet 752 vitamin b1 10mg, b2 10mg, b6 3mg, b12 15mcg, niacinamide 75mg, calcium panthenol 50mg(folic acid 1.5mg, vitamin c 150mg, biotin 100mcg or more),tablet 753 vitamin b12 500 mcg /ml 10 ml vial 754 vitamin b12 inj 500 mcg/ml (30 ml amp) 755 vitamin b1 (thiamine) 100 mg 756 vitamin b1 (thiamine) 75 mg 757 vitamin b complex nfi formula(100ml bottle),syrup 758 vitamin b complex nfi formula(200ml bottle),syrup 759 vitamin b complex syp 200 ml 760 vitamin c tab 500 mg tablet 761 vitamin d3 drop 10ml (cholecalciferol 400 iu)(10 ml),drop 762 vitamin d3 granules(60000 iu sachet),powder 763 vitamin e 200 mg 764 vitamin k inj. 10 mg/ml 765 vitamin k inj (phytonadione inj)1mg/0.5ml( ),injection solution for 766 voglibose(0.3mg tab),tablet 767 voglibose dispersible 0.3mg tab 768 warfarin sodium 5 mg(5 mg),tablet 769 zinc sulphate 10 mg elemental zinc / 5 ml 100 ml bottle 770 zinc sulphate 10 mg elemental zinc / 5 ml 200 ml bottle 771 zoledronic acid(4mg vial),injection 772 zolpidem 10 mg 773 zonisamide 100 mg 774 zonisamide 50 mg 775 prostaglandin e2(dinoprostone gel) 0.5 mg pfs 776 alkaline citrate with pottsium 777 amlodipine 5 mg 778 calcium citrate 1000mg (elemental ca equivalent to 250 mg and vitamin d3 400 iu) 779 calcium with vitamin d tablets calcium carbonate 650mg eq. to elemental calcium 250mg and cholecalciferol 125 iu 780 calcium with vitamin d tablets usp calcium carbonate 1.25g eq. to elemental calcium 500mg and cholecalciferol ip 250 iu 781 ceftazidime 1gm/vial inj(1 gm/vial),injection solution for 782 ceftriaxone inj 500mg vial 783 ceftriaxone+tazobactum(1gm+125mg,vial),injection 784 dextrose 5% inj 500ml ffs/bfs bottle( ),bottle 785 dextrose with saline 5% + 0.9% inj 500ml ffs/bfs bottle 786 diclofenac sodium + paracetamol +serratiopeptidase 50 mg +325 mg + 10 mg 787 dispersible zinc(20mg),tablet 788 enoxaparin (20mg/0.2ml)(0.2 ml prefilled syringe ),injection 789 enoxaparin sodium 40mg (20mg/0.2ml) prefilled syringe inj( ),syrings 790 meropenem(1000 mg (vial)),injection 791 nicotine 14 mg 792 nicotine 2 mg 793 nicotine 4 mg 794 nicotine transdermal patch 21 mg 795 nicotine transdermal patch 7 mg 796 norfloxacine 400mg and tinidazole 600mg tablet 797 ofloxacin tab 200mg 798 pantaprazole 40mg tab 799 paraffin liquid (liquid paraffin 1.25ml + milk of magnesia 3.75ml + sodium picosulphate 3.33ml) syrup 800 pentaprazole inj. 40mg 10ml vial( ),injection solution for 801 piperacillin + tezobactin(4.5 g),injection 802 povidone iodine solution 5%(500 ml),bottle 803 providone iodine + metronidazole 5 % + 1 % 15 gm tube 804 rabies vaccine ip human cell culture 2.5 iu/dose (intra muscular use) 805 snake venom anti serum ip liquid form( ),injection 806 sodium chloride 0.9% injection ip 100ml bottle( ),injection powder for 807 syp. antacid mint flavour 170ml syrup 808 inj .paracetamol amp. 809 inj. cefotaxime 1 gram 810 inj. cefotaxime 250 m,g 811 inj. ceftazidime 1 gram 812 inj. diltizam30 mg 813 inj. tetanus toxoid 5ml vial 814 tab misoprostrol 200 mcg 815 a v fistula sterilized twin needle(17 g (two needle pack)),consumable [700786] 816 a.v. blood line (post haemodialysis tubing) [700428] 817 adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm to 15cm (curved)),consumable [700824] 818 adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm to 15cm (straight)),consumable [700823] 819 a v blood lines with av pressure transducer(acceptable for fitting to all standard dialyzers ) with side tubing (for heparinization and av pressure monitoring) ce and iso certificate essential with protector for all machines types and dialysers(medical grade pvc like of fresenius bain (dora), dialife ,nipro, b raun browndone,biolight or equivalent post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality),consumable [700787] 820 dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)(d) cotton gauze pieces 1,e) artery forceps 1 no (disposable) (mfg by precious life care pvt ltd)),consumable [700770] 821 fistula sterilized twin needle(16 g (two needle pack)),consumable [700785] 822 hemodialysis fluid for bicarb made(part a 10 ltr +part b 500gm 2/pkt),consumable [700254] 823 hemodialysis fluid for bicarb made(part a powder to make 10 ltr + part b 500gm 2/pkt),consumable [700822] 824 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid(5 ltr can),consumable [700820] 825 sterilant hot disinfectant for dialysis containing 21% (approx) citric acid, malic acid, lactic acid(5 ltr can),consumable [700821] 826 1.3/1.4 dora dialiser fluid 827 almirrah godrej type 828 artery forceps 829 attendent bed 2*6 830 attendent stool 831 autoclave 16*24 electric (s.s.) 832 autoclove (large) 12*20 833 autoclove (medium) 12*15 834 autoclove gasket small 835 autoclove gasket larg 836 autoclove gasket medium 837 autoclove indicator roll 838 b.p.apparatus digital 839 b.p.apparatus stand model 840 b.p.cuff adult 841 b.p.cuff infant 842 b.p.cuff paediatric/child 843 baby weighing machine digital 3 digit 844 bacilocid 845 back out solution 5 lit. 846 balance with agitator 847 bed side locker deluxe (steel) top epoxy powder coated 848 bed side screen 4 panel 849 bed side screen 3 fold 850 bio waste bucket 10 lit. 851 bio waste bucket 25 lit. 852 bio waste bucket 50 lit. 853 benzoin powder (for lab use) 854 1/2 ccs cut needle 48 mm stainless steel length 45 cm size 4 855 1/2 ccs cut needle 48 mm stainless steel length 45 cm size 5 856 1/2 ccs cut needle 48 mm stainless steel length 45 cm size 6 857 1.3/1.4 adult dialyzer (dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone) 858 1.5/1.6 adult dialyzer (dialyzer multiple use hollow fiber size as given polysulphone or polyethersulfone) 859 1.5/1.6 dialyzers multiple use made of polysulphone or polyethersulfone low/middle flux, hi performance dialyser performance enhanced technology with hi biocompatibility housed in medical grade polycarbonate openable ends for easy cleaning caps(for dialysate inlet utlet for safer storage openable caps(red and blue)hi quality sterilisation procedure using gamma radiation and should meetings standards of european ce/iso13485:2003sterlised),consumable 860 1%w/v available iodine in a non oxynol with soluble iodine suractant base with sodium iodide(< 1% w/v and surfactant < 5% w/v 500 ml),consumable 861 5 0 da polyglactin 910 coated with polyglactin 910 and calcium state mono with 1/4 circle spatulated needle (12 foils/pkt) 862 5mm lap dissecting hook(32 cm long),consumable 863 abdominal belt(32 inch each),consumable 864 abdominal belt(34 inch each),consumable 865 abdominal belt(36 inch each),consumable 866 abdominal belt(38 inch each),consumable 867 abdominal drain set 28 no 868 abdominal drain set 32 no 869 absolute alcohol (ethanol)(1x500 ml = 500 ml),consumable 870 acd a solution 500ml, model : pb 1ac500j8b(packing size : 2 bags/foil or 12 foils/box),consumable 871 acetone solution(100 ml bottle),consumable 872 adult double lumen catheter set 11.5 f 12 fr, 13cm (curved), kit 873 adult double lumen catheter set 11.5 f 12 fr, 13cm (straight), set 874 adult double lumen catheter set(size: 11.5 fr 12 fr, 13cm (curved)),consumable 875 adult double lumen catheter set(size: 11.5 fr 12 fr,14cm (curved)),consumable 876 adult double lumen catheter set(size: 11.5 fr 12 fr, 15cm to (straight)),consumable 877 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand(foot activated),consumable 878 advanced rfenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree articulation and should be both hand(foot activated with curved tip),consumable 879 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 14cm and should be both hand and( foot activated),consumable 880 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 25cm and should be both hand and(foot activated),consumable 881 advanced rfenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 35cm and should be both hand and(foot activated),consumable 882 advanced rf energy hand instruments of 12mm shaft diameter for open procedures with shaft lengths(22cm and should be both hand & foot activated),consumable 883 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths (35cm and should be both hand & foot activated with curved tip),consumable 884 advanced rf energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths(45cm and should be both hand & foot activated),consumable 885 advanced rf energy hand instruments of 5mm shaft diameter for open procedures with shaft(lengths 14cm and should be both hand & foot activated with curved tip),consumable 886 advanced rf energy hand instruments of(5mm shaft diameter for open procedures with shaft lengths 25cm and should be both hand & foot activated with curved tip),consumable 887 alkaline phosphate kit (autospan) 888 alkaline phosphate kit (erba) 889 alphacypermetherin 5% wdp(as per attached specifications in rc (confirming to is 15603 standards to be supplied in in 25kg or 20kg pack . 1 metric ton)),consumable 890 alt/gpt 600 ml(model ba 400 system (mfg bybio system)),consumable 891 aluminium potassim sulphate (each),consumable 892 ambu bag / adult each 1700ml, with oxygen connecting tube ,should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories,(should have silicon rubber bellow to withstand autoclave at 134 deg.c),consumable 893 ambu bag / resuscitator silicon 200 250 ml infant size each, with oxygen connecting tube ,should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories,(should have silicon rubber bellow to withstand autoclave at 134 deg.c),consumable 894 ambu bag (silicon type) paediatrics each 1400 1700 ml with oxygen connecting tube ,should be supplied with a carry pouch , ambu bag should be complete with required autoclavable valves and other accessories,(should have silicon rubber bellow to withstand autoclave at 134 deg.c),consumable 895 ammonium sulphate (analar (gr/ar) (1x500 gm = 500gm),consumable 896 amunation boot, per pair as per measurment 897 ankle boot, per pair as per measurment 898 anti a1 lection sera5 ml vial(each),consumable 899 anti abd grouping serum 3x10ml consumable 900 anti ab sera igm 5 ml vial(each),consumable 901 anti a sera igm(10 vial),consumable 902 anti b sera igm(10 vial),consumable 903 anti d (polyvalent)(1x10 ml),consumable 904 anti d sera igg+igm 10ml vial(each),consumable 905 anti h sera 10 ml vial(each),consumable 906 apit(2x4 ml),consumable 907 apo a(100 tests),consumable 908 apo b(100 tests),consumable 909 aso kit(25 test/packet), (span) 910 ast/got 600 ml(model ba 400 system (mfg bybio system)),consumable 911 auto cleanser for cbc machine(4 liter),consumable 912 auto dill solution for cbc machine(20 liter),consumable 913 auto lyser solution for cbc machine(500ml),consumable 914 babcock laparoscopic 10mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip(36 cms length, independently moving jaws),consumable 915 babcock laparoscopic 5mm a traumatic babcock, straight 360 degree rotating with insulated shaft, a traumatic jaws with ratchet mechanism, plastic grip(36 cms length, independently moving jaws),consumable 916 barium chloride 10% (500 ml bottle) 917 barium chloride 10%(mfg precious life care pvt ltd)(500 ml bottle),consumable 918 basic carbol fuchsin for afb staining(mfg precious life care pvt ltd)(25 gram/packet),consumable 919 bcg(1 ml each),syrings 920 syrum bilirubin total/direct (autospan/erba) 921 blood culture media fungus bottles per year, fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.; fungus can be tested by all quoted bottles. in the same bottle bacteria and fungus can be tested.( ),consumable 922 blood grouping anti sera a monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with a positive cells 10 ml 923 blood grouping anti sera b monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c , it should give +++ agglutination at 1.256 dilution in 3 4 sec with b positive cells 10 ml 924 blood grouping anti sera d monoclonal : antisera should be transparent with more than one year shelf life at 2 6 c, it should give +++ agglutination at 1.256 dilution in 3 4 sec with d antigen positive cells. 10ml vail (eryclone anti d igm) 925 blood urea (autospan/erba) 926 blood vessel introducers needles 16g, sterilized, set 927 bone wax sterilised(2 gm/packet),consumable 928 bovine albumin (22% w/v)(1x5=5 ml),consumable 929 bovine albumin(each),consumable 930 brain thromboplastin(5ml bottle (mfg tulip diagnostics)),consumable 931 brain thromboplastin for prothrombin time (pt reagent) 5ml (liquiplastin) 932 calcium arsenazo 600 ml(model ba 400 system (mfg bybio system)),consumable 933 cannula fixer set consumable 934 carelyte 503(calibrator 1&2),consumable 935 carelyte 503(complete tubing set),consumable 936 carelyte 503(enzyme cleaning solution),consumable 937 carelyte 503(pottasium electrode),consumable 938 carelyte 503(pump tubing),consumable 939 carelyte 503(refernce electrode),consumable 940 carelyte 503(sodium electrode),consumable 941 carelyte 503(thermal printer roll),consumable 942 chromic catgut (12 foils/pkt)(size:1/0 length 150 cm),consumable 943 chromic catgut monofilament with 1/4 circle reverse cutting needle 6 0 ( 12 / pkt ) 944 chromic catgut no 1.0 round dody, 40 mm 12 foils/pkt 945 chromic catgut , round body needle no. 1.0 946 chromic catgut suture (12 foils/pkt)(3/8 cir r cutting needle 19 mm needle, suture length 76 cm size 4/0),needle 947 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm(5/0 12 foils/pkt)),sutures 948 chromic size 1, (12 foils/pkt)(1/2 cir rb needle 40 mm, length 76 cm),needle 949 chromic size 1, 12 foils/pkt(1/2 cir rb needle 45 mm, length 100 cm),needle 950 chromic with 1/2 cir rb needle 20 mm length 76 cm, 3 0 usp, absorbable surgical suture surgical material 12foils/box 951 chromic with 1/2 cir rb needle 30 mm length 76cm, 2 0 usp, absorbable surgical suture surgical material 12 foils/box 952 chromic with 1/2 cir rb needle 40 mm length 76 cm (with needle) ) absorbable surgical sutures usp,(size 1, 12 foils/pkt),surgical material 953 chromic with 1/2 cir rb needle size:1/0, 30 mm length 76cm absorbable surgical suture surgical material 954 chromic with cd cutting needle 12 mm length 70cm size:3/0 955 chromic with cd rb needle 30 mm length 76 cm size:2/0 absorbable surgical suture surgical usp, 12 foils/boxmaterial 956 chromic with cd.rb needle absorbable surgical suture (12 foils/pkt)(40 mm length 76 cm size:1/0),surgical material 957 chromic with st rb needle (12 foils/pkt)(60 mm length 76 cm size:2/0),consumable 958 citric acid analar/gr/ar (1x500 gm = 500gm),consumable 959 cleanac 3 4000 pack size 5l(cell counter (model no mek 6420p japan)),consumable 960 cleanac 3n 5litre solution(each),consumable 961 cleanac 4000 pack size 5l(cell counter (model no mek 6420p japan)),consumable 962 cleanac 5 litre solution(each),consumable 963 close wound drainage device under negative pressure(closed wound suction unit) size 200 ml(catheter size 16),consumable 964 close wound drainage device under negative pressure(closed wound suction unit) size 200 ml(catheter size 18),consumable 965 cloth based surgical adhesive tape roll(1 inch x 5 mtr / roll),consumable 966 coated polyster braided with cd white d needle 25 mm (curved reverse cutting or curved round body or taper cut) size:2/0 967 coated polyster with cd green needle 17 mm (curved reverse cutting or curved round body or taper cut) size:2/0 length 90cm 968 collagen sheets 10 x 10 cm sheet 969 complete absorbable mesh fixation device with minimum strap length 7mm2point fixation to hold the mesh and device should be of (25 absorbable straps),consumable 970 conc hcl (1x500 ml = 500 ml),consumable 971 conc washing solution 500 ml(model ba 400 system (mfg bybio system)),consumable 972 coombs ahg sera 5ml(each),consumable 973 coombs reagent 5 ml bottle(each),consumable 974 coombs serum (anti human globulin) (polyvalent)(1x5=5 ml),consumable 975 corrugated drainage sheet, sterile, multichannel, single use(2 inch x 6 inch (pvc) piece),consumable 976 cotton delivery belt 977 cover slip 18 x 18 mm 10gm 978 cpk mb kit (kinetic) 25 test/kit 979 creatinine mfg by ba 400 biosystems diagnostics pvt ltd(600 ml),consumable 980 crp (hs)(100 tests),consumable 981 crp test kit(latex/card),kit of 25 tests(mfg pathogyme diagnostics)(25 test / kit),consumable 982 crp test kit (autospan) 983 curved scissors laparoscopic 5mm size, 360 degree rotating with insulated shaft, non ratchet , plastic grip(36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving jaws),consumable 984 cvp line complete set 985 cyanemeth solution for hb(mfg by beacon diagnostic)(5 lit can),consumable 986 cytochrome stain with buffer (500 ml),consumable 987 d dimer(10x3 ml),consumable 988 dengue card test 100 test kit 989 developer powder (22.5 ltr) 990 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast/fog ratio and good shelf life 2 lit can( to make 9 liters working solution) (bromodex mp developer concentrate) 9ltr packing 991 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast/fog ratio and good shelf life 3 lit can( to make 13.5 liters working solution) (bromodex mp developer concentrate) 13.5 ltr packing 992 dexamethasone + gentamycin eye drop 0.1%+0.3% 993 dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)cotton gauze pieces 1 994 dialysis starting kit disposable:a)sterile tray with top(disposable),size not less than 30x30cm b) sterile drape size not less than 45x45 cm 1no c) cotton ball 6 no d)(d) cotton gauze pieces 1,e) artery forceps 1 no (disposable) (mfg by precious life care pvt ltd)),consumable 995 dionised water 5 ltr cane(each),consumable 996 diphenhydramine inj 50mg/ml 997 disinfectant renaclean cold sterilant (5 ltr can) 998 disinfectant renasteril hot disinfectant (5 ltr can) 999 disinfectant with stabilizer by 0.01%w/v agn03 and h2p04(each),consumable 1000 disposable(24 g each),needle 1001 disposable appron consumable 1002 disposable cap 1003 disposable cup for urine sputum 30ml 80 to 90 mm diameter 100/pkt 1004 disposable dust mask jl246c equivalent to n 95 mask 1005 disposable examination gloves made of natural rubber latex, pre powdered, non streile, conforming to is 15354:2003 and amendment thereof. size: large 1006 disposable examination gloves made of natural rubber latex, pre powdered, non streile medium 1007 disposable examination gloves made of natural rubber latex, pre powdered, non streile small 1008 disposable needle 20 g no isi marked 1009 disposable needles 22g consumable 1010 disposable needles 23g 1011 disposable needles 26g x 1/2 consumable 1012 disposable needles is 10654:2002 22g 1013 disposable needles is 10654:2002(23g),needle 1014 disposable needles is 10654:2002 24g 1015 disposable needles is 10654:2002 26 g 1016 disposable needles is 10654:2002 26g x 1/2 1017 disposable pricking lancet (pkt of 200 units) 1018 disposable sharp collection containers(1.5 l mfg by precious life care),each 1019 disposable sharp collection containers(5 l (mfg by precious life care)),each 1020 disposable spinal needle 18 no 1021 disposable spinal needle 22 no 1022 disposable spinal needle 23 no 1023 disposable spinal needle, mfg by alpha medicare and devices pvt. ltd.(23 no),needle 1024 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422, 6.5 inch / pair 1025 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422, 7.5 inch / pair 1026 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422, 7 inch / pair 1027 disposable sterile gloves b.i.s specification gloves, surgical rubber, made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, 6 inch / pair 1028 disposable sterile gloves isi marked surgical rubber hypoallergenic latex 100% powder free 7 1/2 inc 1029 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 6 1/2 inches 1030 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 6 inches 1031 disposable sterile gloves isi marked surgical rubber made of hypoallergenic latex 100% powder free 7 inches 1032 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6.5 inch / pair 1033 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 6 inch / pair 1034 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free(7.5 inch / pair),consumable 1035 disposable sterile gloves isi marked surgical rubber made of hypoallergic latex 100%, electronically tested sterilized by gamma irradiation / eto is no : 13422 92, powder free 7 inch / pair 1036 disposable syringe (for vitamin k inj)(1ml with needle 26g),consumable 1037 disposable syringes is 10258:2002 with needle is 10654:2002 10ml 1038 disposable syringes is 10258:2002 with needle is 10654:2002 cgs 10cc (in ribbon pack) 1039 disposable syringes is 10258:2002 with needle is 10654:2002 cgs 2cc (in ribbon pack) 1040 disposable syringes is 10258 2002 with needle is 10654 2002 cgs 5cc in ribbon pack 1041 disposable syringes is 10258:2002 with needle is 10654:2002, mfg by ph health care pvt ltd(10ml),consumable 1042 disposable syringes with needle cgs 10cc consumable 1043 disposable syringes with needle cgs 2cc consumable 1044 disposable syringes with needle cgs 5cc consumable 1045 dissecting hook having telescoping shaft(10cm 14cm with integrated hand activation control buttons),consumable 1046 distilled water 5 litre(each),consumable 1047 dj stent for ureter 6 fr 1048 dj stent for ureter 8 fr 1049 double blood bag 450 ml cpda(each),consumable 1050 double lumen hoemodialysis catheter with pur ext tube 1051 double lumen polyurethane cvp catheter 4 to 5 fr(length 8 to 13 cm),consumable 1052 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, length 15cm 1053 double lumen polyurethane cvp catheter, 5 fr, g 17 x 20, length 8cm 1054 double lumen polyurethane cvp catheter 5 fr(length 13 to 15 cm),consumable 1055 dpx(1 x 250 lit),consumable 1056 drabkin solution for hb (1x5 lit),consumable 1057 drop paracetamol 100mg/15ml 1058 dusting powder, 10 gm ( neomycin sulphate 5 mg, baccitracin 250 unit, sulphacetamide sodium 60 mg) 1059 ea 50 (modified) (for cytology)(1x125 ml),consumable 1060 ecg paper(chemical coated) 50mm x 20mm roll 1061 ecg paper(chemical coated) 50mm x 30 mtr. roll 1062 ecg paper (chemical coated)(80mmx 20 mtr each),consumable 1063 ecg paper computerizesd triple channel 20m 1064 ecg paper computerizesd 6 channel 20m 1065 ecg paper computerizesd 12 channel 20m 1066 ecg roll three channel 20m 1067 edta solutions k3(mfg by himedia)(500 ml bottle),consumable 1068 edta vaccutainer 3 ml + needle(each),consumable 1069 edta vial 1070 egc roll 66 mm x 15 mm 1071 egc roll, mfg by life o line technologist(66 mm x 15 mm roll),consumable 1072 ehrilichs aidehyde reagen (2x250 ml),consumable 1073 electrolyte solution a 250ml(250ml),consumable 1074 electrolyte solution b 250ml(250ml),consumable 1075 endotracheal tube internal dia 2.5 mm to 5 mm 1076 endotracheal tube internal dia 5.5mm to 9.5mm 1077 endotracheal tube internal with radioopaque line(dia 2.5 mm to 5 mm),consumable 1078 endotracheal tube,soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product(size 3),tube 1079 endotracheal tube, soft cuff towards the distal end kink resistant inflation tube murphy eye at distal end with polished smoothness standard 15 mm connector sterile, single use curved shaped blister pack suiting the shape of product(size 4),tube 1080 endotracheal tubes size 5.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),combi blister pack 1081 endotracheal tubes size 5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1082 endotracheal tubes size 6.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1083 endotracheal tubes size 6 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1084 endotracheal tubes size 7.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1085 endotracheal tubes size 7 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1086 endotracheal tubes size 8.5 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1087 endotracheal tubes size 8 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1088 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque blue line 1089 endotracheal tubes size 9.5 cuffed should have low pressure high volume cuff and radio opaque line(size 9.5),consumable 1090 endotracheal tubes size 9 cuffed should have low pressure high volume cuff and radio opaque blue(25 each),consumable 1091 endotreheal tube size 3 cuffed piece, should have silicon tube with radio opaque blue line 1092 endotreheal tube size 4 cuffed piece, should have silicon tube with radio opaque blue line 1093 enema 100 ml (sodium acid phosphate 10 gm, sodium phosphate 8 gm / 100 ml) 1094 eosin 2% solution (1x250 ml),consumable 1095 esbachs reagent (125 ml),consumable 1096 exchange transfusion catheter with four way adaptor size 4 cm, l 40 cm 1097 e z cleaner 100ml(each),solution 1098 factor ix deficient plasma (<1%)(10x1 ml),consumable 1099 factor vii deficient plasma (<1%)(10x30 ml),consumable 1100 fdp kit(4 ml),consumable 1101 femoral catheters double lumen kit curved double lumen catheter set 12 f (curved) adult, set 1102 femoral catheters single lumen set adult(size 6f to 8f, length 13 cm to 15 cm),consumable 1103 femoral catheters single lumen set pediatric(size 3f to 4f, length 13 cm to 15 cm or less),consumable 1104 femoral catheters single lumen size adult (set of 12 different sizes), set 1105 femoral catheters single lumen size size pediatrics (set of 12 different sizes), set 1106 femoral guide wires : straight (0.325 mm size) should meet the following standards : european ce, iso13485, sterile, fda, set 1107 femoral guide wires : straight/j tip((0.325 mm size) sterile: ce/iso13485 marked),consumable 1108 ferric ammonium citrate 200mg, folic acid 0.5mg 1109 fistula 16g, single sterilized eto single needle packing 1110 fistula 17g, single sterilized eto single needle packing 1111 fistula and wound management system(size 104 159 mm),consumable 1112 fistula and wound management system(size 156 228 mm),consumable 1113 fistula and wound management system(size 208 297 mm),consumable 1114 fistula sterilized twin needle(16 g (two needle pack)),consumable 1115 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 13.5 ltr 1116 fixer: it shall be powder fixer to produce clean radiographs available in pack size size: 9 ltr 1117 fixer powder (bromex acid fixer with hardner) ( 22.5 ltr/pkt) 1118 flow regulator (dial flow)(each),consumable 1119 foldable iol sterile lens +18d(each),lens 1120 foldable iol sterile lens + 18d (usfda approved, as per specification)(each),consumable 1121 foldable iol sterile lens + 19.5d (usfda approved, as per specification)(each),consumable 1122 foldable iol sterile lens +19d(each),lens 1123 foldable iol sterile lens + 19d (usfda approved, as per specification)(each),consumable 1124 foldable iol sterile lens + 20.5d (usfda approved, as per specification)(each),consumable 1125 foldable iol sterile lens +20d(each),lens 1126 foldable iol sterile lens + 20d (usfda approved, as per specification)(each),consumable 1127 foldable iol sterile lens + 21.5d (usfda approved, as per specification)(each),consumable 1128 foldable iol sterile lens +21d(each),lens 1129 foldable iol sterile lens + 21d (usfda approved, as per specification)(each),consumable 1130 foldable iol sterile lens + 22.5d (usfda approved, as per specification)(each),consumable 1131 foldable iol sterile lens +22d(each),lens 1132 foldable iol sterile lens + 22d (usfda approved, as per specification)(each),consumable 1133 foleys catheter size 14 2 way 1134 foleys catheter size 14 3 way 1135 foleys catheter size 18 2 way 1136 foleys catheter size 20 2 way(12 each),consumable 1137 foleys catheter size 22 2 way(13 each),consumable 1138 foleys catheter size 24 2 way(14 each),consumable 1139 foleys urinary catheter 2 way(size 22 each),consumable 1140 foleys urinary catheter 2 way size 8 1141 foleys urinary catheter 3 way size 12 1142 foleys urinary catheter 3 way size 16 1143 foleys urinary catheter 3 way size 18 1144 foleys urinary catheter 3 way size 20 1145 foleys urinary catheter 3 way size 22 1146 foleys urinary catheter pediatrics size 10 1147 foleys urinary catheter size 16 2 way 1148 formaldehyde 40% (conc. formaline)(1 x 30 lit),consumable 1149 formaldehyde (formolene liquid 450 ml 1150 formaldehyde (formolene ) tab pack 1151 fouchets reagent(mfg precious life care pvt ltd)(100 ml bottle),consumable 1152 g 6pd kinetic per ml 1153 g6pd (span) 1154 gauze swab/pad 4 layer 20x40 1155 gauze swab/pad 6 layer 10 ã— 10 1156 gauze swab/pad 6 layer 20 ã— 20 1157 giemsa stain (merck / span) (125 ml),consumable 1158 glacial acetic acid (2.5 liter),consumable 1159 glass slide 75mm x 25mm 1.1 mm 1160 glass slide 75mm x 25mm 1.35 mm 1161 glass test tube 5 without edge 1162 glucometer strip (1x100) 1163 gold chloride (1x1 gm),consumable 1164 gram iodine (gram stain) 125 ml 1165 grasper laparoscopic 5mm straight 360 degree rotating with insulated shaft, toothed a traumatic grasper with ratchet mechanism, plastic grip(36 cms length, independently moving jaws),consumable 1166 guide wire 3mm 1167 h2so4 (sulphuric acid)(25% 500 ml bottle),consumable 1168 h2so4 (sulphuric acid)(5% 500 ml bottle),consumable 1169 haematoxyline solution (harris)(1x125 ml),consumable 1170 haemocoagulase 1 nih unit/ml, 1 ml inj 1171 haemoglobin colour scale with paper 1172 haemoglobinometer (square tube pattern) 1173 capillary tube 1174 stop watch 1175 handpiece(blue),consumable 1176 handpiece(transducer),each 1177 hba 1 c (glycosylated hb)(100 tests),consumable 1178 hba ag elisa 96 kit 1x96(each),consumable 1179 hba ag rapid card test(each),consumable 1180 hbsag test kit (sd biolab) 1181 hcv elisa(96 test kit),consumable (sd biolab) 1182 hdl kit 50 test 1183 hematology cell counter reagents rinse solution (20 ltr) 1184 hemodialysis fluid for bicarb made(part a 10 ltr +part b 500gm 2/pkt),consumable 1185 hemolynac 3n 2340 500ml(each),consumable 1186 hemolynac 3n 2340 pack size 500 ml(cell counter (model no mek 6420p japan)),consumable 1187 heparin and benzyl nicotinate 20mg oint. 1188 heparin sodium benzyl nicotinate oint 1189 hiv 1+2 (rapid) per card j mitra 1190 hiv 1&2 test cards 1191 hiv kit (sd biolab) 1192 hpmed solution consumable (pack size: 16 bottles of 50 ml) , make polti s.p.a. ; model sani system(country of origin italy;),consumable 1193 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine 1194 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. cuts the needle from the hub of machine(mfg by precious life care),each 1195 hydroethyl starch 6% solution with sodium chloride 0.9% 500 ml bottle(each),consumable 1196 hydrogen peroxide (conc.) h2o2 (500 ml),consumable 1197 hypodermic needles for single use bis gauze(23 length, 25 mm + 1),needle 1198 hypodermic needles for single use gauze 22 bis length, 25 +1/ 2 1199 hypodermic needles for single use gauze 23 bis length, 25 +1/ 2 1200 hypodermic syringe for single use 10ml bp/bis (without needle) 1201 hypodermic syringe for single use 1ml, is : 10258 (10 ml vial) 1202 hypodermic syringe for single use 2ml bp/bis (without needle) 1203 hypodermic syringe for single use 5ml bp/bis (without needle) 1204 individual identification panel for aerobic gram positive organism(gpid),each 1205 individual identification panel for anaerobic gram negative organism(anc),each 1206 individual identification panel for anaerobic gram positive organism(anc),each 1207 individual identification panel for fungus(yst),each 1208 infant feeding tube size: 5g 1209 inj. b complex 30ml 1210 inj. diclofenac 30ml 1211 inj. heamocoagulase 1cu 1ml 1212 inj. l ornithine l aspartate 10ml 1213 inj. meropenam 125mg 1214 inj. primacort hydrocotisone 200 mg 1215 inj. sigmacrome (obrochrome) 10ml 1216 instrument sterilant 10 minute sporicidal sterilant aldehyde free containing sodium perborate((810 grm packet)),powder 1217 instrument wash 500ml with spray pump 1218 insulin syringe/ each (graduation upto 100 units) 30 g needle, 40 units/ml(30 g needle, 40 units/ml),syrings 1219 intra camral saline (r.l) sep (eto sterelied, specialy(manufactured for intra camral),consumable 1220 iron alum a) ferric amino sulphate (1x500 ml = 500 ml),consumable 1221 iron & folic acid entric coated 100mg,of elemental iron (adult)+fa 1.5mg tab. 1222 iv cannula size with inj.valve (port)(18g ),consumable 1223 iv dextrose 40% 1224 jugular catheters : double lumen kit (curved), set 1225 k3 blood vaccutainer edta 100 tubes/pkt 1226 keratome 3.2 keratome –round stock 3.2mm full handle knives e.t.o. sterile angled bevel up 45 deg 1227 kores indelible ink marker pen 1228 k wire length 375mm size:1.6mm roll 1229 k wire length 375mm size:1.8mm roll 1230 k wire size:1mm 1231 labetalol 5 mg/ ml, 2 ml inj 1232 ladies sleeper, per pair as per measurment 1233 l alanyl l glutamine solution for infusion (20%w/v)(each),consumable 1234 laser fiber for dental laser , make faith inovation ; model fd10b ;(country of origin india),consumable 1235 ldh kit pack (50 ml bottle),consumable 1236 leishmann stain sol with buffer tablet ph (1x5 lit),consumable 1237 leishman stain(mfg precious life care pvt ltd)(500 ml bottle),consumable 1238 light weight composite mesh : polypropylene and polyglycolic acid partially absorbable composite mesh with large pore size 6 x 11 cm 1239 liquid paraffin 50ml(bottle ),consumable 1240 liquor ammonia (500 ml),consumable 1241 long line silicon catheter, g 24, fr 2, l 30cm 1242 low profile titenium chemo port with cilicon catheter (9.6 fr, 6.6fr, 3.9fr,) length 60cm,guide wire, peel away desilet,hubsite needle(22g*20mm) 1243 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card (as per gio nvbdcp specification) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab 1244 malaria antigen, p vivax, p falciparum rapid diagnostics bivalentt test card (as per gio nvbdcp specification) pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet, and 10 alcohol swab (sd biolab) 1245 malaria card (antigen) atleast 100 microbes/desi ltr. for both species 1246 malaria pf/pv antigen card 1247 malaria pf/pv rapid test 1248 maryland dissector laparoscopic 5mm curved maryland dissector with tapering end, 360 degree rotating with insulated shaft, non ratchet , plastic grip(36 cms length, monopolar pin provision for usage with electro surgical unit, independently moving),consumable 1249 masson trichrome staining kits(100 test),consumable 1250 medical x ray film polyester based imaging film 35.6cm x 35.6cm (14x14) size: 50 sheets in one packet 1251 medical x ray film polyester based imaging film 35.6 cm x 43.2cm (14x17) size: 50 sheets in one packet 1252 medigard hand scrub 1253 meropenem inj 1mg 1254 methyl blue for (z n)(mfg precious life care pvt ltd)(125 ml bottle),consumable 1255 methyline blue(100 ml),solution 1256 methyline blue 0.1% solu. 1257 miconazole nitrate 2 % w/w 15 gm, oint 1258 microalbumin urine(100 tests),consumable 1259 micro pipet 1000 fix and variable each 1260 micropiptte 100 1000 1261 microtips (2 200 ul) 1x1000(each),consumable pkt 1262 microtips yellow (10 200ul)1x1000(each),consumable 1263 micro and macro tips stand 1264 milkiwhite gel based sanitizer 1.ethinol (cas 64 17 5) 58 62% 2. benzoil coline chloride 0.52% 1 % 3.(ph neutral contact time 15 se 4. pack size 100 ml & 100 ml with dispensor),consumable 1265 milkiwhite gel based sanitizer 1.ethinol (cas 64 17 5) 58 62% 2. benzoil coline chloride 0.52% 1 % 3. ph neutral contact time 15 sec 4.(pack size l& 500 ml with dispensor),consumable 1266 mindray bc 2800, auto hematology analyzer(m 18 cfl lyes),consumable 1267 mindray bc 2800, auto hematology analyzer (m 18 cleanzer),consumable 1268 mindray bc 2800, auto hematology analyzer (m 18 diluent),consumable 1269 mindray bc 2800, auto hematology analyzer(m 18 probe cleanzer),consumable 1270 mindray bc 2800, auto hematology analyzer(m 18 rinse),consumable 1271 mindray bc 2800, auto hematology analyzer(paper roll),consumable 1272 mindray bc 2800, auto hematology analyzer(quality control),consumable 1273 mindray bc 5300, auto hematology analyzer part 5(m 53 cleaner),consumable 1274 mindray bc 5300, auto hematology analyzer part 5(m 53 diluent),consumable 1275 mindray bc 5300, auto hematology analyzer part 5(m 53 leo (ii) lyes),consumable 1276 mindray bc 5300, auto hematology analyzer part 5(m 53 leo (i) lyes),consumable 1277 mindray bc 5300, auto hematology analyzer part 5(m 53 lh lyes),consumable 1278 mindray bc 5300, auto hematology analyzer part 5(m 53 probe cleaner),consumable 1279 mindray bc 5300, auto hematology analyzer part 5(quality control),consumable 1280 montex test 2tu(1 vial),consumable 1281 mva kit (mannual vaccum aspiration kit) (as per attached specification)(mfg by women care global),consumable 1282 n/10 hcl 500ml 1283 nah2 po4 (anhydrous) analar / gr/ar (1x500 gm = 500gm),consumable 1284 needle hypodermic0insulin (metallic non0sterile) needle 1285 needle hypodermic size is 10654:2002 23g 1286 needle hypodermic size is 10654:2002 24g 1287 neomycin and sulfacetamide sprinkling powder 5 gm(each),consumable 1288 neubauers chamber(each),consumable 1289 nimesulide oint gel 20gm 1290 non foldable iol sterile lens ac + 18 1291 non foldable iol sterile lens ac + 20 1292 non foldable iol sterile lens pc+14d ,lens 1293 non foldable iol sterile lens pc+16d ,lens 1294 non foldable iol sterile lens pc+18d ,lens 1295 non foldable iol sterile lens pc+19d ,lens 1296 non foldable iol sterile lens pc+19.5d ,lens 1297 non foldable iol sterile lens pc+20 d ,lens 1298 non foldable iol sterile lens pc+20.5 d ,lens 1299 non foldable iol sterile lens pc+21 d ,lens 1300 non foldable iol sterile lens pc+21.5 d ,lens 1301 non foldable iol sterile lens pc+22 d ,lens 1302 non foldable iol sterile lens pc+22.5 d ,lens 1303 non foldable iol sterile lens pc+23 d ,lens 1304 non foldable iol sterile lens pc+24 d ,lens 1305 non foldable iol sterile lens pc+26 d ,lens 1306 non foldable iol sterile lens ac+19d ,lens 1307 non foldable iol sterile lens pc + 18.5(each),lens 1308 occult blood test kit (haem test kit) (1 x 100 strips),consumable 1309 og6 (for cytology)(1x125 ml),consumable 1310 oint. gentamycin sulphate 15gm 1311 optia granulocyte depletion set, model : 10300(packing size : 6 kits),consumable 1312 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures(size 1x 2approved by us fda),consumable 1313 oxidized regenerated cellulose based topical absorbable hemostat, structured non woven material, with bactericidal property. ease of use in both open and minimally invasive procedures(size 2x 4approved by us fda),consumable 1314 oxygen mask adult (standard size) 1315 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm (curved), kit 1316 paediatric double lumen catheter set 6.5 f 8.5 fr, 13cm (straight), set 1317 paediatric drip set(set),digonstic 1318 paediatric epidural set(19g needle, metal stylet,22g catheter,0.22micron epidural catheter lor syringe) 1319 adult epidural set with catheter 1320 pandys reagent csf (125 ml),consumable 1321 papaniculau stain kit (125ml bottle) 1322 paper adhesive microporous surgical tape 3 inch x 5 m / roll (10 roll/pkt)(3 inch x 5 m / roll (10 roll/pkt)),consumable 1323 paper adhesive plaster 1/2 x 9.0mts 1324 paper adhesive plaster 1 x 9.0mts 1325 paper adhesive plaster microporous surgical tape 1 inch x 9 m / roll 1326 paper adhesive plaster microporous surgical tape 6 inch x 10 m / roll 1327 paracetamol 75 mg/ml, 10 ml inj 1328 paracetamol + chlorpheniramine(100 ml syrup),syrup 1329 paraffin wax histology (58 60)(1x1 kg = 1 kg),consumable 1330 patch buprenorphine(10mcg),consumable 1331 patch buprenorphine(20mcg),consumable 1332 personal protection kit(kit),consumable 1333 phenobarbitone inj. 100 mg/ml 1334 pistol grip curvedcoagulating shears ergonomic handle with att shaft lenght 36cm can seal blood vessel upto and inclding (5mm in diameter),consumable 1335 pistol grip curved coagulating shears with ergonomic handle in the(folloeing shaft lengths 36 cm can seal blood vessels upto and including 5 mm in diameter),consumable 1336 pistol grip curved coagulating shears with ergonomic handle shaft(langths 36 cm can seal blood vessels upto and including 5 mm in diameter att),each 1337 plain disposable vial 3ml(each),consumable 1338 plain vial(12 x 75 with screw cap each),consumable 1339 plain vial with screw cap(12 x 75),consumable 1340 p o p 1 kg pkt 1341 plastic bottle(300ml),consumable 1342 plastic bottle(500 ml),consumable 1343 platelet dilution fluid(mfg precious life care pvt ltd)(100 ml),consumable 1344 polybutylate coated with polyester braided(green) with 1/2 cir tap cut v 5 da needle 17mm, non abs surg suture usp 2 0 length 90cm (12 foils/pkt) 1345 polyester braided coated with cd white dn 17 mm curved rb 90cm 2/0 (12 foils/pkt) 1346 polyester braided coated with cd white dn 17 mm(curved rev cut) cut 90 cm 2/0 (12 foils/pkt) 1347 polyester braided coated with cd white dn 17 mm taped cut 90 cm 2/0 (12 foils/pkt) 1348 polyester braided coated with cd white dn 25mm(curved rb) 2 0 length 90cm (12 foils/pkt) 1349 polyethylene high pressure extension tube, length 100cm 1350 polyethylene high pressure extension tube, length 150cm 1351 polyglecaprone with 1/2 cir oval rb needle 26 mm length 70 cm (12 foils/pkt) 1352 poly l lysine coated slides (50 lidess x 1),consumable 1353 poly l lysine sol (for immunochisto chemistry) (1x100 ml),consumable 1354 polymaide mono filament (nylon) with cd cut needle 20 mm length 70 cm size 2/0 (12 foils/pkt) 1355 poly propylene mesh 15 x 15 cm 1356 poly propylene mesh 7.5cmx15cm 1357 poly propylene mono filament sterile precut with 1/2 cir rb d needle 16mm length 70 cm non absorbable surgical sutures usp size 5/0(12foils/pkt),consumable 1358 poly propylene mono filament sterile precut with 1/2 cir rb heavy needle 16 mm length 70 cm non absorbable surgical sutures usp 5/0 (12 foils/pkt) 1359 poly propylene mono filament sterile precut with 1/2 cir rb heavy needle 30mm length 70 cm non absorbable surgical sutures usp size 1 1360 poly propylene mono filament sterile precut with 1/2 cir rb needle 25 mm length 70 cm non absorbable surgical sutures usp size 3/0 1361 poly propylene mono filament sterile precut with 1/2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 1/0 1362 poly propylene mono filament sterile precut with 1/2 cir rb needle 30 mm length 70 cm non absorbable surgical sutures usp size 2/0(12 foils/pkt),surgical material 1363 poly propylene monofilament sterile precut with 1/2 cir rb needle 30mm length 70cm size : 1/0(12 foils/pkt),consumable 1364 poly propylene monofilament sterile precut with 1/2 cir rb needle 30mm length 70cm size:2/0 (12 foils/pkt) 1365 poly propylene mono filament sterile precut with 1/2 cir rb needle 40 mm length 70 cm non absorbable surgical sutures usp size 1/0 1366 poly propylene monofilament sterile precut with 1/2 cir rb needle 40 mm length 70 cm size 1(12 foils/pkt),needle 1367 polytaxine powder(1x5 gm),consumable 1368 post operative bag with window size 100 mm(1 each),consumable 1369 post operative bag with window size 70 mm(1 each),consumable 1370 potassium chloride oral solution 500mg/10ml 1371 povidone iodine cream 250gm 1372 powder protien +vitamins +corbohydrates & minerals 200gm 1373 pregnancy detection kit ce marked/isi marked 30 test/ kit 1374 prolene 1 0 rb 1/2 circle 30 mm, l 70 cm (12 foils /pkt) 1375 prolene mesh 7.5 x 15 cm(12 foils /pkt) 1376 protein (total)(600 ml),consumable 1377 protein (total) (autospan) 1378 protein (total) (erba) 1379 protein (total) 600 ml(model ba 400 system (mfg bybio system)),consumable 1380 protien (total) mfg by ba 400 biosystems diagnostics pvt ltd(600 ml),consumable 1381 protien (urine) ba 400 biosystems diagnostics pvt ltd(240 ml),consumable 1382 ptah staining kits(100 test),consumable 1383 ptfe material, iv cannula, with luer lock, g 18 1384 ptfe material, i.v. safety cannula, with luer lock, g 16 1385 pt kit (time) (ist 1.00 1.20)(2x4 ml),consumable 1386 ptk (nishchay kit) 1387 quick diff staining kits for pap smear(100 test),consumable 1388 quincke bevel pediatric spinal needle, g 25, length 1.2 inch 1389 quincke pediatric spinal needles g 25, length 2.0 inch 1390 ra factor 50 test kit qualicative 1391 r a factor test kit (span) 1392 r a factor test kit (erba) 1393 reaction rotor 10 pc(model ba 400 system (mfg bybio system)),consumable 1394 hdl cholesterol(autospan/erba) 1395 reticulocyte kit (100 tests),consumable 1396 reuse prevention syringe 10 ml 1397 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles complaint to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized,non latex stopper 3ml 1398 reuse prevention syringe sterile single use reuse prevention syringewith detachable needles complaint to iso 7886:4 type i and type b, flow wrap/ blister package using medical grade breathable paper, eto sterilized, non latex stopper 2ml 1399 reuse prevention syringe sterile single use reuse prevention syringe with detachable needles complaint to iso 7886:4 type i,b, flow rap/blister pack using medical grade breathable paper, eto sterilized, nonlatex stopper (prefd matr thmoplast ela)5ml 1400 reuse prevention syringe sterile single use reuse prevention syringe with fixed/ detachable needles complaint to iso 7886:4 type i and b,flow wrap/ blister pkg using medical grade breathable paper, eto sterilized.(10 ml),syrings 1401 reuse prevention syringe sterile single use reuse prevention syringe with fixed/detachable needles complaint to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(2ml),syrings 1402 reuse prevention syringe sterile single use reuse prevention syringe with fixed/detachable needles complaint to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(3ml),syrings 1403 reuse prevention syringe sterile single use reuse prevention syringe with fixed/detachable needles complaint to iso 7886:4 type i,b,flow wrap/ blister pack using medical grade breathable paper, eto sterilized(5ml),syrings 1404 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 typei and typeb 3ml 1405 reuse prevention syringe sterile with detachable needles complaint to iso 7886:4 type i and type b, flow wrap/ blister package using medical grade breathable paper, eto sterilized, non latex stopper (preferred material thermoplastic elastomer) 5ml 1406 rhyroid stimulating hormone(tsh),consumable 1407 rib belt large(mfg by precious life care),each 1408 rib belt medium(mfg by precious life care),each 1409 roll bandage 05 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1410 roll bandage 10 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1411 roll bandage 15 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1412 roll bandage 7.5 cm x 05 m tana x bana (26s x 26s) reed x pik (34x 24) 1413 rolled bandage 10cm ã— 5m 1414 rolled bandage 15cm ã— 5 m 1415 rolled bandage 5cm ã— 5m 1416 rolled bandage 7.5cm ã— 5m 1417 safranine (gram stain) 500 ml bottle 1418 safranine (gram stain) (500 ml bottle (mfg sunlabs)),consumable 1419 s.albumin(each),consumable 1420 sargramostim (recombinant human granulocyte macrophage colony stimulating factor)(500 mcg/ml),injection 1421 s. b12(100 tests),consumable 1422 s.calcium(each),consumable 1423 scalp vein set(size 24g, disposable),consumable 1424 schirmer strip for ophthalmic use 1425 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft(lengths 17 cm can seal blood vessels upto and including 5 mm in diameter),each 1426 scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft(lengths 9cm can seal blood vessels upto and including 5 mm in diameter),each 1427 s direct billirubin(1000 ml),consumable 1428 semen dilution fluid(100 ml bottle),consumable 1429 serum amylase (mfg by beacon diagnostic)(100 ml),consumable 1430 serum electrolite na+ k+ kit analizer(50 test per kit),consumable 1431 serum t4 kit, elisa(96 test kit each),consumable 1432 serum tsh kit, elisa(96 / pkt),consumable 1433 sevoflurane 20cc(each),consumable 1434 s. ferritin(each),consumable 1435 s. folate(100 tests),consumable 1436 sgot(mfg pathogyme diagnostics)(25 ml),consumable 1437 sgot(mfg autospan/erba 1438 sgpt kit lyphozyme 5x20 ml 1439 sgpt test kit reagent 1440 sgpt test kit reagent (autospan/erba) 1441 shoes uniform ,per pair as per measurment 1442 short iv catheter with straight guidewire. l 20, fr 2, g 22 1443 short iv catheter with straight guidewire. l 4, fr 2, g 22 1444 short iv catheter with straight/j tip guidewire(l 4, fr 2, g 22),consumable 1445 sics blade cresent(15 degree),consumable 1446 sics blade (disposable) cresent nife 2.8 (specialy long matel handle, micro sharp edge, isi/iso(manufaturer, eto stereliged),consumable 1447 silk no 1 cutting needle 1x12(1x12),consumable 1448 sulpher powder pkt 1449 s. iron (ferrozine)(100 tests),consumable 1450 s.lipase(each),consumable 1451 sliver nitrate (1x25 gm = 25 gm),consumable 1452 sodium chloride nacl analar / gr / ar (1x500 gm = 500gm),consumable 1453 sodium citrate 3.8%(mfg precious life care pvt ltd)(500 ml bottle),consumable 1454 sodium hydroxide (naoh) (analar / gr/ar) (1x500 gm = 500gm),consumable 1455 sodium hypo chloride 5 lit jar 1456 sodium metabisuiphite (na2s2o3) (analar (gr/ar) (1x500 gm = 500gm),consumable 1457 sodium nitroprusside (100 gm),consumable 1458 spectra optia collection set, model : 10110 / 10120(packing size : 6 kits),consumable 1459 spectra optia exchange set, model : 10220(packing size : 6 kits),consumable 1460 spectra optia platelet kit, model : 10400(packing size : 6 kits),consumable 1461 s. phosphorus (each),consumable 1462 spinal needle with metal stylet, mfg by nipro medical india pvt. ltd.(g 23),needle 1463 (ss) powder (1x25 gm = 25 gm),consumable 1464 sstromatolyser 4ds for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 126 ml),consumable 1465 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(pt ã¢â€â“sta neoplastin cl + 5),consumable 1466 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta cacl2 ),consumable 1467 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta cleaner solution),consumable 1468 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta coagcontrol n+p),consumable 1469 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta desorb u),consumable 1470 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(sta satellite cuvette),consumable 1471 stago diagnostica stago s.g.s, model sta satellite fully automated coagulation machine(white stirrer for pt test),consumable 1472 stain (1x25 gm = 25 gm),consumable 1473 staining kit reticulin(100 test),consumable 1474 staining kits (100 test),consumable 1475 stainless steel wire 28g 1476 stainless steel wire 30g 1477 sterigen c electrolyte solution one pack of 10 ltr. for sterigen 400 daf , make faith inovation; model sterigen sg 400 daf ;(country of origin india),consumable 1478 sterilant cold disinfectant for dialysis containing peracetic acid hydrogen peroxide acetic acid(5 ltr can),consumable 1479 sterilant hot disinfectant for dialysis containing 21% (approx) citric acid, malic acid, lactic acid(5 ltr can),consumable 1480 sterile hypodermic syringe with needle, mfg by ph health care pvt ltd(20 ml),consumable 1481 sterile hypodermic syring with needle 10 ml 1482 sterile hypodermic syring with needle 20 ml 1483 sterile hypodermic syring with needle(5 ml),syrings 1484 sterile hypodermic syring with needle, mfg by ph health care pvt ltd(10ml),consumable 1485 sterlium 500 ml 1486 s. tibc kit(100 tests),consumable 1487 s. total protein(each),consumable 1488 s. transferin(100 tests),consumable 1489 strip for albumin urine and suger 1490 strip for malaria antigen, p vivex, p falciparum (50 tests) 1491 stromatolyser 4dl for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 5000 ml),consumable 1492 sulfolyser for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 5000 ml),consumable 1493 sulfur powder 1494 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder(5 kg packet (mfg by zenith chemicals allied industries)),consumable 1495 surface disinfectant 10 minute aldehyde free disinfectant containing potassium mono per sulphate powder((5kg packet)),powder 1496 surgical blade, size 15 (100/pkt) 1497 surgical blade, size 24 (50/pkt) 1498 suter(8/0 (01 box)),consumable 1499 sutureless dural graft substitute(1x3),consumable 1500 sutureless dural graft substitute(2x2),consumable 1501 sutureless dural graft substitute(3x3),consumable 1502 sutureless dural graft substitute(4x5),consumable 1503 suture mersilk 8 0 (12 foil) 1504 s.vitamin d3(100 tests),consumable 1505 tannic acid with glycerine (gum paint) 80% + 20% 10 ml vial(10 ml),lotion 1506 macroporus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber (6 0) and poliglecaprone 25 monofilament fiber (5 0) with pore size 2.7 mm having a weight of 39 g/m2 and containing blue orientation stripes of polypropylene. 15cmx15cm 1507 thrombin time kit(10x3 ml),consumable 1508 thyroxine(t4),consumable 1509 tmt graph paper a4 size, 100 piece/pkt 1510 tracheostomy tube (pvc) sterile single use (adult)(size 4 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1511 tracheostomy tube (pvc) sterile single use (adult)(size 5 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1512 tracheostomy tube (pvc) sterile single use (adult)(size 7 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1513 tracheostomy tube (pvc) sterile single use (adult)(size 8 each piece soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction non irritant),tube 1514 triple lumen jugular catheter 12 x 16 1515 triple lumen jugular catheter kit(size 12f, 16+/ 1cm),consumable 1516 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 15cm 1517 triple lumen polyurethane cvp catheter, 7.5 fr, g 14x18x18, length 20cm 1518 triple lumen polyurethane cvp catheter 7 to 7.5fr(g 14 16x18x18, length 16 20 cm),consumable 1519 triple lumen polyurethane cvp catheter 7 to 7.5 fr(g 14 16x18x18x18, length 15 16cm),consumable 1520 trisodium citrate 3.8%(mfg precious life care pvt ltd)(500 ml bottle),consumable 1521 trisodium citrate analar/gr/ar (1x500 gm = 500gm),consumable 1522 troponin 1 kit(10 test per pack),consumable 1523 troponin t (ctn t) card test(50 test),consumable 1524 trucut biopsy needle 18 g length 15 cm 1525 typhoid test card. 1526 umblical cotton tape length 75cm. 1527 urea/bun ã¢â€â“ uv 600 ml(model ba 400 system (mfg bybio system)),consumable 1528 urea uv gloh 5x20ml 1529 uric acid 600 ml(model ba 400 system (mfg bybio system)),consumable 1530 uric acid biosystem 1531 uric acid(mfg pathogyme diagnostics)(50 ml (2 x 25 ml)),consumable 1532 uric acid(autospan)(50 ml (2 x 25 ml)),consumable 1533 uric acid(erba)(50 ml (2 x 25 ml)),consumable 1534 urine albumin & suger test kit 1*100 pkt 1535 urine culture pot 30 ml. 1536 urine (multi stripe),consumable 1537 urine strip 2 parameter (sd biolab) 1538 urine strip 2 parameter (tulip) 1539 urine strip 10 parameter (sd biolab) 1540 urine strip 10 parameter (tulip) 1541 uri stix 100 test 1542 urosticks(50/pkt),consumable 1543 usg gel(250 ml bottle),consumable 1544 vaseline white/yellow 1/2kg 1545 vdrl kit (strip) (mfg by alere)(50 test/kit),consumable 1546 vdrl (rpr) 1x100 sd strip (sd biolab) 1547 vdrl tedt kit (liquid) span 1548 v.p shunt high pressure (venticular peritonial shunt, (venticular catheter 15cm length, 1 distilled catheter 75 l, struit stylet)(each),consumable 1549 v.p.shunt(low pressur),consumable 1550 v.p.shunt(medium pressur),consumable 1551 whitacre pencil point spinal needle 25 g with introducer 1552 white petrollium jelly 500 gm 1553 widal 2x2 sera slide kit 1554 widal 2x2 tube test kit 1555 widal 4x5 ml 1556 wound suction no 18 1557 xro catheter with ptfe material, i.v. safety cannula, with luer lock(g 18),consumable 1558 xro catheter with ptfe material, i.v. safety cannula, with luer lock(g 20),consumable 1559 xro catheter with ptfe material, i.v. safety cannula, with luer lock(g 22),consumable 1560 adhesive tape 7.5cm x10 mtr/roll 1561 alcohol dispensor 1562 all out 1563 blood bag with acd/cpd solution (disposable sterilised) with needle(100 ml),bag hll 1564 blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag (hll) triple 1565 cleanser m52 1 lit 1566 coagulater 1567 diff lyse m52 500 ml 1568 disposable sterile gloves size 6 inches consumable 1569 disposable sterile gloves size 61/2 inches consumable 1570 disposable sterile gloves size 7,1/2 inches consumable 1571 disposable sterile gloves size 7inches consumable 1572 glucometer with strip 1573 i.v. cannula with injection valve(size 24 g),consumable 1574 iv cannula size 24g with inj.valve (port) 1575 iv cannula size with inj.valve (port)(22g ),consumable 1576 latex based baloon capacity (30 50ml) foleys catheter(size 16 2 way),consumable 1577 bleaching power gr ii (25kg) bags consumable 1578 a.v fistula needle 17 g 1579 a.v. blood line (post haemodialysis tubing) high quality 1580 a v blood lines with av pressure transducer(acceptable for fitting to all standard dialyzers ) with side tubing (for heparinization and av pressure monitoring) ce and iso certificate essential with protector for all machines types and dialysers(medical grade pvc like of fresenius bain (dora), dialife ,nipro, b raun browndone,biolight or equivalent post pump tubing sets options medical grade clear tubing guarded access ports for reduced infection risks parts of superior quality),consumable 1581 a v blood lines with av pressure transducer protector for all machines types and dialysers (acceptable for fitting to all standard dialysers), set 1582 giemsa stain 1583 glass beaker 200 ml 1584 glass conical flask 100 ml 1585 glass conical flask 200 ml 1586 glass tube plain 4” 1587 glass tube plain 6” 1588 group confermation card+ solution matrix gel system 1589 prolin no 1 1590 prolin no 2 0 1591 rub in hand solution 100ml/500ml 1592 surgical scalpel blade with handle 1593 t3, reagent (mini vidas)/biomerieux 1594 t4 reagent (mini vidas)biomerieux 1595 test tube glass 10 ml 1596 tsh reagent (mini vidas)biomerieux 1597 wiper big 1598 wiper medium 1599 wiper small 1600 utility gloves for large latex 1601 utility gloves for medium of latex 1602 baby vest the baby vest should be a double breasted upper garment & single jersey knit (100% cotton) 150 160 gsm. size should be: length 9”, chest size should be 9”, sleeve length should be 1¾” & width 6”. piping is must & the piping made of cotton cambric. it should have side wise stretching. (specs attached seperately) {for all new born} 1603 b. b. silk size 2/0 , 110 cm with 1/2 cr cutting needle 1604 mackintosh sheet rubber makintosh double colour rubber sheeting, high polymer (55% grade a) water proof colour (green, blue, red), thickness 0.4mm, width 90cm roll of 30 mtr compliant to is 4135 (1974) {for labour table ot & maternity beds} 1605 synthetic absorbable suture with 1/2 circle round body needle 40 mm length 90 cm polyglycolic acid 1606 nylon no .1, 1/2 circle needle 40 mm, 110 cm, nonabsorblr suture 1607 vicryl no.1 2347 d ,40mm 1/2 circle cut,tapper, heavy,double needle, 180 cm, pga absorble,suture 1608 inj. myopyrolate 5ml ampule 1609 inj. pheneramine malate 1610 paracetamol suppository 400 mg 1611 inj. voluven 1612 endotrachial tube 3.5; ( uncuffed) 1613 endotrachial tube 4; ( uncuffed) 1614 endotrachial tube 4.5; ( uncuffed) 1615 endotrachial tube 5; ( uncuffed) 1616 endotrachial tube 5.5; ( uncuffed) 1617 endotrachial tube 5.5; 1618 endotrachial tube 6.5; 1619 endotrachial tube 7; 1620 endotrachial tube 7.5; 1621 endotrachial tube 8; 1622 endotrachial tube 8.5; 1623 glycine 1.5% 3 litre bottle 1624 normal saline 0.45% 3 litre bottle 1625 inj. carboprost / prostodin 1626 inj. methergin 0.24 1627 inj. pitocin 1628 inj.human chorionic ganadotraphin 5000u, 2000u 1629 tab. cabergoline 1630 tab. bromocriptine 50 mg, 25 mg 1631 tab. letrozole 2.5 mg 1632 tab. pyridoxine 25 mg 1633 tab. perinorm 1634 inj . methotrexate 1635 tab. methotrexate 1636 acetic acid 1 % 1637 lugol’s lodine 1638 tolmdine blue 1639 formalin solution 5 lit. 1640 sodium hypochlorite solution or bleaching power 1641 inj. vitamin k 1642 xylocaine 2 % multidose vial for labour room 1643 inj. tranexa 1644 inj. buscopan 1645 inj. drotaverine 1646 inj. mgso4 1647 inj. largactil 1648 inj. phenargan 1649 inj. duvadilon ( lsoxsuprine) 1650 inj. labetolol 1651 tab. labetolol 1652 inj. hydrallazine 1653 inj. phenytoin sodium 1654 tab. medroxy progesteione acetrate 10 mg 1655 ear buds 1656 ear speculum (set) 1657 flying cacher 1658 foreign body spud ear 1659 foreign body spud nasal/ 1660 franulum retractor 1661 fumigator 1662 liquid soap 500ml 1663 oxyagen flow meter (rotometer) 1664 oxygen cylender key 1665 thermometer 40 digree 1666 scissor encleation (medium) 1667 scissors big (tailor type) 1668 shoe rack affordable, stackable 6 tier storage shoe rack holds up to 24 shoes, made from metal and plastic 34w x 11d x 41h 1669 sonography jelly 500 ml 1670 sonography jelly 5 lit. 1671 steel bowel 10 1672 steel bowel 4 1673 steel bowel 8 1674 steel container for general use 2 lit with led 1675 steel container for general use 5 lit with led 1676 steel container for general use 10 lit with led 1677 steel container for general use 20e lit with led 1678 steel/iron rack four selves 1679 strecher trolley deluxe 1680 three bucket trolly for cleaning/moping 1681 vein spy equipment 1682 walker non folding 1683 walker folding 1684 walking stick 3/4 base 1685 walking stick double grig 1686 walking stick single base 1687 walking stick single grip 1688 ward linen trolly 1689 new born sheet 1690 alcoho; based hand rub 70% 1691 sensorcaine vial 1692 vintolin injection 500 mcg 1693 low molecular weight heparin 40 mg 1694 low molecular weight heparin 60 mg 1695 p.t.inr test kit (beccon) 1696 pap smear kit 1697 stethoscope 1698 formalin solution per litres 1699 glycerine per litre 1700 distilled water per litre 1701 phenol per litre 1702 histology slides for histology lab set of 60 slide 1703 benedict’s reagent per litres 1704 acetic acid 10% per litres 1705 litmus paper 1706 ammonium sulphate 1707 sodium nitroprusside 1708 liquor ammonia per litres 1709 sulphur powder (fine) 1710 wbc diluting fluid per litres 1711 rbc diluting fluid per litres 1712 leishmann stain per litres 1713 dextrose powder per pack 1714 xylene per litres 1715 paraffin wax per kg 1716 nitric acid per litres 1717 haematoxylin& eosin stain per litres 1718 dpx mount pre bottle 1719 egg albumin pre bottle 1720 ethanol (absolute) per litres 1721 rapid pap stain pre bottle 1722 may grunwald giemsa stain (mgg)per litres 1723 ziehl neelsen stain( zn stain) pre bottle 1724 glass slides (sunbeam–frosted) 1725 cover slip (glass) 22 x 40 1726 cover slip (glass) 22 x 60 1727 field stain pre bottle 1728 filter paper per pack 1729 bloating paper per pack 1730 distilled water per litres 1731 reticulocyte solution (new methylene blue) pre bottle 1732 fitefaraco stain per litres 1733 grocott’smethamine silver (gms) stain pre bottle 1734 india ink per litres 1735 sodium metabisulphite pre bottle 1736 liquid paraffin pre bottle 1737 pas (periodic acid schiff) stain pre bottle 1738 edta vacutainer (purple top) per piece 1739 sodium citrate vacutainer (light blue top) 1740 multistix 10 sg (10 parameter urine analysis strip) 1741 glucose per pack of 100 test god pod 1742 urea per pack of 100 test gldh 1743 creatinine per pack of 100 test modified jaffe’s 1744 billirubin (total and direct) per pack of 100 test diazo 1745 sgpt per pack of 100 test nadh oxidation 1746 sgot per pack of 100 testnadh oxidation 1747 alp per pack of 100 test nitrophenyl phosphate 1748 total protein per pack of 100 test biuret 1749 albumin per pack of 100 test bcg 1750 total cholesterol per pack of 100 test chod pod 1751 triglyceride per pack of 100 test trinder 1752 hdl per pack of 100 test direct 1753 ldl per pack of 100 test direct 1754 uric acid per pack of 100 test uricase pod 1755 uristix ( strips for qualitative urine ketone bodies and protein detection)1/100 1756 troponin i qualitative kit 1/100 1757 troponin t qualitative kit 1/100 1758 ck mb per pack of 100 testnadp reduction 1759 t3 per pack of 100 testimmunoturbidimetry (biomerieux) 1760 t4 per pack of 100 testimmunoturbidimetry (biomerieux) 1761 tshimmunoturbidimetry (biomerieux) 1762 amylase per pack of 100 test for semiautomated biochemistry analyser 1763 lipase per pack of 100 test for semiautomated biochemistry analyser 1764 ldh per pack of 100 test for semiautomated biochemistry analyser 1765 sodium per pack of 100 test for semiautomated biochemistry analyser 1766 potassium per pack of 100 test for semiautomated biochemistry analyser 1767 distilled water per litres 1768 vacutainer (plain) red coloured cap 1/100 1769 vacutainer (fluoride) grey coloured cap 1/100 1770 sterilium per litres 1771 microtips (10 200 µl)1/100 1772 microtips (100 1000 µl)1/100 1773 micro and macro tips stand1/100 1774 micro pipettes (10 100 µl) per piece 1775 micro pipettes (20 200 µl) per piece 1776 micro pipettes (100 1000 µl)per piece 1777 micro pipettes (0.5 50 µl)per piece 1778 micro pipettes standper piece 1779 glass tubes small 5ml 1780 rubber pipette bulb (25 ml)per piece 1781 rubber pipette bulb (60 ml size)per piece 1782 pipette fillersper piece 1783 bottle top dispenserper piece 1784 acetone2.5 litre x 1 1785 acetic acid 2.5 litre x 1 1786 liquid ammonia500 ml x 1 1787 ammonium chloride 500 gm x1 1788 100 gm x 1 1789 alpha naphthol 100 gm x 1 1790 ammonium molybdate 500 gm x1 100 gm x 1 1791 ammonium oxalate 500 gm x1 1792 agar powder 500 gm x1 1793 barium chloride 500 gm x1 1794 benzoic acid 500 gm x1 1795 benzidine powder 100 gm x 1 1796 bovine albumin 5 gm x1 1797 benedicts reagent 5 litre x 1 1798 barfoeds reagent 125 ml x 1;500 ml x 1 1799 bromine water 500 ml x 1 1800 bile salt 500 gm x1 1801 boric acid 500 gm x1 1802 butanol 500 ml x 1 1803 copper sulphate 500 gm x1 1804 calcium carbonate 500 gm x1 1805 calcium chloride 500 gm x1 1806 citric acid500 gm x1 1807 chloroform 500 gm x1 1808 carbolic acid/ phenol 500 gm x1 1809 cupric acetate 500 gm x1 1810 disodium hydrogen phosphate 500 gm x1 1811 dipotassium hydrogen phosohate 500 gm x1 1812 dextrose 500 gm x1 1813 dextrin 500 gm x1 1814 ethanol 500 ml x 1 1815 esbachs reagent 125 ml x 1 1816 egg albumin powder 1817 d fructose250 gm x 1 1818 formaldehyde solution 500 ml x 1 1819 formic acid 500 ml x 1 1820 fehlings solution a 500 ml x 1 1821 fehlings solution b 500 ml x 1 1822 ferric chloride 500 gm x1 1823 ferric ammonium sulphate 500 gm x1 1824 fouchets reagent 125 ml x 1 1825 gelatin 500 gm x 1 1826 hydrochloric acid(hcl) 2.5 litre x 1 1827 hydrogen peroxide 500 ml x 1 1828 iodine crystals 100 gm x 1 1829 lead acetate trihydrate 500 gm x1 1830 lactose 500 gm x1 1831 mercuric chloride 100 gm x 1 1832 mercuric nitrate 100 gm x 1 1833 methyl red 25 gm x 1 1834 methylene blue 125 ml x 1; 100 ml x 1 1835 magnesium sulphate 500 gm x1 1836 methanol 500 ml x 1 1837 mercuric sulphate100 gm x 1 1838 molischs reagent500 ml x 1 1839 maltose 250 gm x 1 1840 millons reagent500 ml x 1 100 ml x 1 1841 ninhydrin 10 gm x 1 1842 ninhydrin reagent 500 ml x 1 1843 ortho toludine 100 gm x 1 1844 potassium hydroxide 500 gm x1 1845 potassium dichromate 500 gm x1 1846 potassium chromate 500 gm x1 1847 potassium iodide500 gm x1 250 gm x 1 1848 phenopthaleine indicator 100 ml x 1 1849 phenol red 100 ml x1 1850 potassium chloride 500 gm x1 1851 potassium dihdrogen phosphate 500 gm x1 1852 potassium ferricyanite 500 gm x1 1853 phenylhydrazine 250 gm x 1 1854 peptone 500 gm x1 1855 picric acid 500 gm x1 1856 resorcinol 500 gm x1 1857 sodium hydroxide 500 gm x1 1858 sucrose 500 gm x1 1859 sulphosalicylic acid 500 gm x1 1860 sodium dithionite 500 gm x1 1861 sodium nitrite 500 gm x1 1862 sodium nitrate 500 gm x1 1863 sodium acetate 500 gm x1 1864 sodium carbonate 500 gm x1 1865 sodium bicarbonate 500 gm x1 1866 starch 500 gm x1 1867 sodium chloride 500 gm x1 1868 sodium sulphate 500 gm x1 1869 silver nitrate100 gm x 1 1870 sodium hydrogen carbonate 500 gm x1 1871 sulphuric acid 2.5 litre x 1 1872 seliwanoffs reagent 125 ml x 1 1873 sodium citrate 500 gm x1 1874 sodium potassium tartarate 500 gm x1 1875 sodium nitroprusside 100 gm x 1 1876 trichloro acetic acid 500 gm x1 1877 zinc oxide 500 gm x1 1878 nitric acid 500 ml x 1 1879 phenylhydrazine hydrochloride 250 gm x 1 1880 bromophenol blue 125 ml x 1 1881 1 amino 2 naphthol 4 sulphonic acid 25 gm x 1 1882 2,4 dinitrophenyl hydrazine 100 gm x 1 1883 2 amino 2 methyl 1 propanol 500 ml x 1 1884 4 amino antipyrine 100 gm x 1 1885 8 hydroxyquinoline 100 gm x 1 1886 alpha ketoglutaric acid 25 gm x 1 1887 bromocresol green 5 gm x 1 1888 cholesterol 25 gm x 1 1889 creatinine 5 gm x 1 1890 diacetylmonoxime 25 gm x 1 1891 disodium phenyl phosphate 25 gm x 1 1892 ehrlich’s aldehyde reagent 100 ml x 1 1893 glycine 5 gm x 1 1894 l alanine 5 gm x 1 1895 l aspartic acid 5 gm x 1 1896 l leucine 10 gm x 1 1897 l proline 5 gm x 1 1898 nessler’s reagent 100ml x 1 1899 o cresolphthalein 25 gm x 1 1900 oxaloacetate 5 gm x 1 1901 ph indicator papers ph range 1 14 1 pack 1902 ph indicator papers ph range 3.5 6.0 1 pack 1903 ph indicator papers ph range 6.5 9.0 1 pack 1904 phosphotungstic acid 100 gm x 1 1905 potassium thiocyanate 500 gm x1 1906 sodium hypobromite solution 100 ml x 1 1907 sodium pyruvate 25 gm x 1 1908 sodium tungstate 100 gm x 1 1909 sulphanilic acid 100 gm x 1 1910 tartaric acid 100 gm x 1 1911 thiosemicarbazide 25 gm x 1 1912 unconjugated bilirubin 1 gm x 1 1913 urea 500 gm x1 1914 uric acid 25 gm x 1 1915 whatman paper no. 1 100 nos. x 1 1916 test tubes 12 × 100 mm (borosil) 1917 test tubes12 × 75 mm(borosil) 1918 test tubes18 × 150 mm(borosil) 1919 sterile, autoclavablepetriplates,optical clear) (gamma irradiated)100 mm × 15 mm pack of 20 plates(borosil) 1920 glass slide 75×25×1 mm(borosil) 1921 cover slip (microscope cover glass)22x22 mm(borosil) 1922 conical flask (flat bottam)2000 cc(borosil) 1923 conical flask (flat bottam)1000 cc(borosil) 1924 conical flask (flat bottam)500 cc(borosil) 1925 conical flask (flat bottam)250 cc(borosil) 1926 conical flask (flat bottam)100 cc(borosil) 1927 conical flask (flat bottam)50 cc(borosil) 1928 glass rod 1929 measuring jar500 ml(borosil) 1930 measuring jar100 ml(borosil) 1931 glass volumetric pipette1 ml(borosil) 1932 glass volumetric pipette5 ml(borosil) 1933 petri plates (glass) (pack of 10 plates)100 x 15 mm(borosil) 1934 tuberculin syringe 1/100 pack 1935 sterile cotton swab in screw capped plastic tubes himedia75mm packed in 12 mm tube per piece 1936 sterile cotton swab sticks himedia pack 1937 urine container 1/100(30 ml) 1938 stool container 1/100(50 ml) 1939 micropipette tips (nucleases autoclavable polystyrene free (500 µl 1000 µl) 1 / 1000 tips 1940 micropipette tips (nucleases autoclavable polystyrene free) (1µl 500 µl)1/1000 1941 dropping bottle (plastic) per p 1942 filter paper (46×57 cm) 1/50big sheet 1943 forcep (pointed) 1944 teasing needle 1945 metal loop holder (w/o loop) any size of nichrome wire can be inserted 1×24pack 1946 antibiotic zonescale per psize 370 mm×65 mm 1947 cleaning brush for test tubes nylon material 1948 spatula128 1949 concavity slide (1 cavity) 1950 spirit lamp 1951 filter paper (watsmen no 6) pack 1952 cotton bundle roll 1953 plastic tray 24x18x6 1954 test tube racks for 12 × 100 mm tubes 1955 test tube racks for 12 × 75 mm tubes 1956 test tube racks for 18 × 150 mm tubes 1957 steam indicatortape 1 no 1958 serum vials 1 pack of 500 vials 2ml 1959 screw capped plastic tubes 1 pack of 500 vials 1960 serum vial stand (for 2 ml vials) 1961 durham’s tube 1 pack of 500 1962 multichannel pipette (50 ul 300 ul) 1963 micropipette tip stand(1µl 500 µl 1964 micropipette tips stand (500 µl 1000 µl) 1965 acetone 500 ml 1966 alberts metachromatic stain kit (stain a &b) 500 ml 1967 barium chloride 500 gm 1968 carbol fuchsin 25gm 1969 phenol (crystal) 500 gm 1970 cedar wood oil 30ml. 30ml 1971 distilled water 5 ltr 1972 ethanol absolute , 500 ml 5lit 1973 crystal violet 125 ml 1974 methylene blue solution 25 gm 1975 ph paper range 2 10.5 1976 saffranin 125 ml 1977 spirit 500 ml 1978 sulphuric acid conc. 5 ltr 1979 gram stain kit 1980 liquid paraffin 500ml 1981 tissue paper / laboratory paper 50 role 1982 xylene 500 ml 1983 hydrogen peroxide 3% 1 lit 1984 lactophenol cotton blue stain 100 ml 1985 hydrochloric acid conc. 500 ml 1986 india ink stain 100 ml 1987 potassium hydroxide pellets 500 gm 1988 sodium hydroxide 500 gm 1989 nichrome wire loop 2mm 1990 nichrome wire loop 4mm 1991 aluminium foil roll 500 gm 1992 kovacs reagent (for indole test) 100 ml 1993 grams iodine 125 ml 1994 blood culture bottle (adult) (hi media) 70 ml 1995 blood culture bottle (pediatric) (himedia) 20 ml 1996 sodium hypochlorite solution 5 lit 1997 haem test kit ( stool for occult blood test) 1 pack of 200 test 1998 rapid afb stain kit (ba1523, 2x100ml (biolab) 100 ml 1999 lugol’s iodine 125 ml/ bottle 2000 golves (7.5 no) 50 pairs/ pack 2001 liquid soap 500 ml 2002 hand sanitizer 2003 vaccutainers (plain) red coloured cap 100 /pack 2004 triple sugar iron agar 500 gm mo21 500g, hi media 2005 peptone 500 gm rm667 500g, hi media 2006 agar agar powder 500 gm rm026 500 g, hi media 2007 bile esculin agar (mv972) 100 gm m340 100 g, hi media 2008 cooked meat medium 500 gm m149 500g, hi media 2009 fluid thioglycolate medium 500 gm mm009 500g, hi media 2010 deoxycholate citrate agar 500 gm m065 500 g,hi media 2011 mac conkey agar 500 gm m081 500g, hi media 2012 mannitol salt agar base 100gm m118 100 g,hi media 2013 sabouroudcyclohexamide agar 500 gm m063 500 g, hi media 2014 simmons citrate agar 500 gm m0009 500 g, hi media 2015 tcbs agar 500 gm m189 500 g, hi media 2016 urea 40% fd048 10 ml hi media 2017 urea agar base 500 gm m112 500g, hi media 2018 ready water testing kit k015 hi media 2019 tuberculin p.p.d 1 tu hi media 2020 nutrient agar 500 gm m877 500g, hi media 2021 meuller hinton agar 500 gm m1084 500 gm 2022 brain heart infusion broth 500gm 10210 500g 2023 spore strips 25 strips/pack dd032 1pk 2024 glucose broth 500 gm pack himedia m 860 2025 l j media 10 bottles/ box himedia sl 001 10sl 2026 field stain kit 1 himediak 011l 2027 ferric chloride 500 gm himedia rm1379 2028 mr vp broth 100 gm himedia m070 2029 methyl red indcator 125 ml bottle himedia 1007 2030 glucose 500 gm himedia 2031 lactose 500 gm 2032 sucrose 500 gm himedia 2033 mannitol disk 1 vial dd006 1vl 2034 corn meal agar 100 gm himedia m146 100g 2035 moeller decarboxylase broth lysine 100 gm m687 100g 2036 moeller decarboxylase broth ornithine 100 gm m688 100g 2037 moeller decarboxylase broth arginine 100 gm m689 100g 2038 phenol red broth base 500 gm m054 500g 2039 sodium chloride 500 gm rm853 500g 2040 beef extract powder 500 gm rm669 500g 2041 glucose phosphate broth 100 gm m070 100g 2042 barritt reagent a 100 ml r029 100 ml 2043 barritt reagent a 100 ml r030 100 ml 2044 macconkey double strength broth 500 gm hi media 2045 amikacin antibiotic disc 30mcg sd035 5vl himedia 2046 amoxyclav antibiotic 20+10mcg sd063 5vl himedia 2047 ampicillin antibiotic 10mcg sd002 5ct himedia 2048 aztreonam antibiotic disc 30mcg sd212 5ct himedia 2049 ampicillin + sulbactum antibiotic disc (10+10)mcg sd112 5ct himedia 2050 bacitracin 0.04 unit dd015 1vl himedia 2051 cefotaxime antibiotic disc 30mcg sd040 himedia 2052 cefoxitin antibiotic disc 30mcg sd041 himedia 2053 clindamicin antibiotic disc 2mcg sd051 5ct himedia 2054 cefotaxime + clavulanic acid antibiotic disc (30+10)mcg sd724 5ct himedia 2055 ceftazidime + clavulanic acid antibiotic disc (30+10)mcg sd207 5ct himedia 2056 cefalexin 30 mcg sd048–5ct himedia 2057 ceftriaxone antibiotic disc 30mcg sd065 – 5ct himedia 2058 cefazoline antibiotic disc 30mcg sd047 5ct himedia 2059 cefepime antibiotic disc 30mcg sd219 5vl himedia 2060 cefuroxime antibiotic disc 30mcg sd061 5ct himedia 2061 chloromphenicol antibiotic disc 30mcg sd006 5vl himedia 2062 ciprofloxacin antibiotic disc 5mcg sd060 5vl himedia 2063 cefixime 30mcg sd211 5ct himedia 2064 colistin e strip (0.5) 10mcg em020 30st himedia 2065 ceftazidime 30mcg sd062 5vl himedia 2066 co trimaxazole (1.25+23.75)mcg sd010 5vl himedia 2067 cefoperazone sulbactum 75/10mcg sd254 5ct hi media 2068 doxycycline 30mcg sd012 5vl himedia 2069 imipenam antibiotic disc 10mcg sd073 5vl himedia 2070 imipenam + edta antibiotic disc (10+750)mcg himedia 2071 ertapenem antibiotic disc 10mcg sd280 5vl himedia 2072 levofloxacin antibiotic disc 5mcg sd216 – 5vl himedia 2073 linezolid antibiotic disc 30mcg sd215 5ct himedia 2074 meropenam antibiotic disc 10mcg sd727 5vl himedia 2075 moxifloxacin 5mcg sd217 5ct himedia 2076 h.s gentamicin 120mcg sd195 1vl himedia 2077 netilmicin antibiotic disc30mcg sd085 5ct himedia 2078 nitrofurantoin antibiotic disc 300mcg sd023 5vl himedia 2079 norfloxacin antibiotic disc 10mcg sd057 5vl himedia 2080 nalidixic acid antibiotic disc 30mcg sd021 1vl himedia 2081 ofloxacin antibiotic disc 5mcg sd087 5ct himedia 2082 optochin antibiotic disc 5mcg dd009 1vl himedia 2083 oxidase disc antibiotic disc dd018 1vl himedia 2084 penicillin g antibiotic disc 10 units sd028 5ct himedia 2085 piperacillin antibiotic disc 100mcg sd066 5ct himedia 2086 piperacillin/tazobactum antibiotic disc (100+10)mcg sd210 5vl himedia 2087 polymyxin b e strip part a 240 .01mcg part b32 .001mcg/ml em043 30sthimedia 2088 polymyxin b 50mcg himedia 2089 tigecycline antibiotic disc 15mcg sd278 5ct himedia 2090 novobiocin 5mcg himedia 2091 gentamicin 10mcg sd016 5vl himedia 2092 teicoplanin antibiotic disc 30mcg sd213 5ct himedia 2093 tetracycline antibiotic disc 30mcg sd037 5vl himedia 2094 tobramycin antibiotic disc 10mcg sd044 5vl himedia 2095 vancomycin antibiotic disc 30mcg sd045 5ct himedia 2096 vancomycin e strip 256 .015mcg/ml em060 30st himedia 2097 fosfomycin 200mcg sd179 5vl himedia 2098 azithromycin 15mcg sd204 himedia 2099 erythromycin 15mcg sd013 5ct himedia 2100 hbsag test kit 10 tests/ kit 2101 hcv test kit 10 tests/ kit 2102 rpr test kit 25 tests (5 ml reagent)/ kit 2103 malaria ag (pv/pf) test kit 10 tests/ kit 2104 widal slide agglutination test kit 25 tests (5 ml reagent)/ kit 2105 dengue ns1 antigen elisa 96 tests/ kits 2106 ra factor test kit 25 tests (5 ml reagent)/ kit 2107 aso titre test 25 tests (5 ml reagent)/ kit 2108 crp test 25 tests (5 ml reagent)/ kit 2109 widal tube agglutination test 25 tests (5 ml reagent)/ kit 2110 torch elisa 1/96 test 2111 hbeag strip rapid card test 10 tests/ kit 2112 hepatitis a rapid card test 10 tests/ kit 2113 weil felix tube agglutionation test 25 tests (5 ml reagent)/ kit 2114 atcc strain enterococcus fecalis 29212 pack of 2 swabs himedia – 0366 p 2115 atcc strain e.coli 25922 pack of 2 swabs himedia 0335 p 2116 atcc strain e.coli 35218 pack of 2 swabs himedia – 0495 p 2117 atcc strain pseudomonas aeruginosa 27853 pack of 2 swabs himedia 0353 p 2118 atcc strain staphylococcus aureus 25923 pack of 2 swabs himedia 0360 p 2119 atcc strain staphylococcus aureus 29213 pack of 2 swabs himedia – 0365 p 2120 atcc klebsiella pack of 2 swabs himedia – 01005 p 2121 pneumoniae baa 1705 2122 atcc klebsiella pack of 2 swabs himedia 0784 p 2123 pneumoniae 700603 2124 atcc candida albicans 10231pack of 2 swabs himedia 0443 p 2125 atcc candida tropicalis 750 pack of 2 swabs himedia 0767 p 2126 antisera salmonella 1 set 2127 antisera – shigella dysenteriae 2128 antisera – shigella flexnari 2129 antisera – shigella sonnie 2130 antisera vibrio cholerae 1 set 2131 methylene blue stain 100ml 2132 carbol fuschin(strong) 100ml 2133 sulfuric acid(conc.) per liter 2134 ecg electrode (disposal) other 2135 electric setlizier 10*5 other 2136 electric setlizier 14*5 other 2137 electric setlizier 16*5 other 2138 electric setlizier 18*5 other 2139 electric setlizier 20*5 other 2140 reusable preformed supraglotic airway device with sizes 1, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2141 reusable preformed supraglotic airway device with sizes 1.5, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2142 reusable preformed supraglotic airway device with sizes 2, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2143 reusable preformed supraglotic airway device with sizes 2.5, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2144 reusable preformed supraglotic airway device with sizes 3, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2145 reusable preformed supraglotic airway device with sizes 4, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2146 reusable preformed supraglotic airway device with sizes 5, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2147 reusable preformed supraglotic airway device with sizes 6, should have silicon cuff , reinforced tip, pilot balloon withtactile indication, autoclavable ,us fda ,ce & iso certified. 2148 supraglotic airway device with integrated gastric access and intubation : 2149 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 1 usfda ce & iso certified 2150 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 1.5 usfda ce & iso certified 2151 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 2 usfda ce & iso certified 2152 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 2.5 usfda ce & iso certified 2153 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 3 usfda ce & iso certified 2154 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 4 usfda ce & iso certified 2155 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 5 usfda ce & iso certified 2156 reinforced tip with gastric drainage port and intubating laryngeal. pilot balloon withtactile indication, mri safe and phthalate free material. integrated bite absorption area. soft & thin cuff & available with sizes 6 usfda ce & iso certified 2157 manual resuscitators with built in pressure limitation – adult withface mask of size 3/4 & 5,o2 tidal volume 1300 ml, reservoir volume 1500 ml; 100% latex free & double layered. built in pressure limitation, single shutter valve, integrated hand strap, autoclavable, provision to attach peep valve. usfda ,ce & iso certified 2158 manual resuscitators with built in pressure limitation – paediatric/neonatewith face mask of size 0 & 2 max. tidal volume 300 ml; volume of o2 reservoir 1500 ml/volume 100% latex free outer cover & double layered. single shutter valve, integrated hand strap, autoclavable ,pressure limiting valve ,provision to attach pressure manometer, usfda ,ce & iso certified 2159 ecg electrodes with offset connector. highly conductive wet gel , combination of instant and long term adhesives ,breathable micro porous material ,special soft spongeoffset connector concept, high quality ag/ agcl sensor 2160 fibreless video scope, available with three optional sizes of inner diameter 1.2mm, 2.2mm & 2.8 mm, should have suction port & oxygen delivery port, should be usfdashould be compatible with a view monitor of size 8.5 inches with 8 gb memory. 2161 airway visualization system (adult): display monitor with video output capability. work on aaa consumable batteries & runs continuously upto 90 mints. can work on reusable batteries too if required, anti fog lens with white led light source, supplied with 3pcs of size 3 channelled and 1 pc of size 3 non channelled blades, 510 k , iso & ce certified 2162 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 18, 2163 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 20, 2164 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 22, 2165 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 24, 2166 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 26, 2167 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 28, 2168 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 30, 2169 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 32, 2170 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 34, 2171 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 36, 2172 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 38, 2173 reusable armored tube made of 100% siliconized, radio opaque, mounted connector, pilot balloon with universal port. size 40, 2174 broad spectrum antimicrobial/ antibacterial/ double lumen polyurethane cvc catheter kit, catheter and extension line along with hub should be impregnated. kit should contain fr 7, g 14x18, l 16cm.with j guide wire, rollerson, syringe, dilator, scalpel. needle free cannula transduction probe, catheter stabilization device. 2175 broad spectrum antimicrobial/antibacterial triple lumen polyurethane cvc catheter, catheter and extension line along with hub should be impregnated. kit should contain fr 7, g 16x18x18, l 16cm. with j guide wire, rollerson, syringe, hub stopper impregnated with 70% isopropyl alcohol swab dilator, scalpel. needle free cannula, transduction probe, catheter stabilization device 2176 broad spectrum antimicrobial/antibacterial double lumen polyurethane hd catheter, catheter lumen and extension line along with hub should be impregnated. kit should contain fr 12, l 13cm. with j guide wire, rollerson syringe with dilator, scalpel. needle free cannula, transduction probe, catheter stabilization device. 2177 broad spectrum antibacterial /antifungal triple lumen polyurethane hd catheter, catheter and extension line along with hub should be impregnated. kit should contain fr 12, l 16cm. with j guide wire, rollerson syringe, dilator, scalpel. needle free cannula, transduction probe,catheter stabilization device. 2178 hydrocolloid scar free nasal pads to prevent cpcp, bipap, and oxy mask, to avoid pressure ulcers or bruises on the nose. sizes s/l. ce certified. 2179 hemostatic dressing in sponge/ pad from made of 100% natural biopolymer with a net positive charge, gama sterilized and moisture proof. usfda approved. sizes 5*5, 2180 hemostatic dressing in sponge/ pad from made of 100% natural biopolymer with a net positive charge, gama sterilized and moisture proof. usfda approved. sizes 8*8 2181 urethral catheter made up of soft color less,clear, breathable, odorless, 2182 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 8, should be us fda approved. 2183 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 12, should be us fda approved. 2184 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 14, should be us fda approved. 2185 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 16, should be us fda approved. 2186 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. sizes 18, should be us fda approved. 2187 non absorbable polymer locking clips provide cool secure ligation; clip locks onto the vessel. clip sizes medium, medium large, large and extra large. the non absorbable polymer clip is inert, nonconductive, radiolucent, and does not interfere with ct or x ray diagnostics. fda approved 2188 multifunctional mask with the multiple integrated attachment of nebulizer mask, venture mask, oxygen mask, with 7” double oxygen tube. should have oxygen outlet diverter and fenestration opening slits on both sides. fda approved 2189 polymer ligation device with locking mechanism, sterile, radiolucent property, usfda approved. cartridges should have self adhesive backing.sizes a medium large polymer ligation device. 2190 polymer ligation device with locking mechanism, sterile, radiolucent property, usfda approved. cartridges should have self adhesive backing. sizes b medium large polymer ligation device. 2191 polymer ligation device with locking mechanism, sterile, radiolucent property, usfda approved. cartridges should have self adhesive backing.sizes c medium large polymer ligation device. 2192 sizes a 8 inch in size with curved for ml/ l/ xl. 2193 b 11 inch in size with right angle 70° 2194 endo applicator matt finishing stainless steel applier, with us fda approvedsizes a 32.5cm for ml/ l/ xl 2195 endo applicator matt finishing stainless steel applier, with us fda approvedsizes b 45cm for ml/ l/ xl 2196 micro titanium ligation device with locking mechanism, sterile, usfda approved. cartridges should have self adhesive backing. 2197 sizes 6” and 8” 2198 postpartum hemorrhage balloon silicon catheter for control of obstetrical bleeding or management of pph. size 24fr, length 54cm,balloon capacity 500ml, fda approved 2199 cervical ripering balloon for mechanical dilation l 40cm. fr. 18, balloon capacity 80ml. 2200 pur catheter non shrinkable iv line with prefilled 70% isopropyl alcohol cap for peripheral veins. xro, and with non return valve 2201 short iv catheter for neonates with straight guide wire. g 22, l 10, 12cm 2202 arterial catheter with floswitch and straight guide wire, g 18, l 6/13cm 2203 short ptfe material emergency catheter with floswitch and stabilising device. g 14, l 13 16mm. 2204 reinforced epidural wired polyurethane catheter kit with stainless steel needle. size catheter 19g, needle 17g. 2205 suture free securement hydrocolloid device s 2206 suture free securement hydrocolloid device m 2207 suture free securement hydrocolloid device l 2208 medicated catheter stabilization device with medical grade pvc clamp should have id tag s 2209 medicated catheter stabilization device with medical grade pvc clamp should have id tag m 2210 medicated catheter stabilization device with medical grade pvc clamp should have id tag l 2211 vascular haemostatic pad to stop external bleeding and catheterization site bleeding , should be 100% chitosin material, size 2”x2” single pack. sterilized. 2212 paracain eye drop 0.5% 2213 trypan blue dye 0.4% 2214 plastering in c.m 1:5 12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete 2215 spectacles fornschool childremna. frame material ployflex unbreakable frame with all different sizes suitable for children(from 8 20 yrs).nb. lenses cr hardcoated lenses (fiber) of prescribed numbers.nc. case plastic case printed as followos nname of the district.......nnpcb & vi, nmadhya pradeshnnot for salend. accessiores ni. dori, nii. cleaning cloth(slevet),niii. prescription card,n 2216 screening and free spectacles for near work to old personna. frame material ployflex unbreakable frame with all different sizes suitable for old personnb. lenses cr hardcoated lenses (fiber) of prescribed numbers.nc. case plastic case printed as followos nname of the district.......nnpcb & vi, nmadhya pradeshnnot for salend. accessiores ni. dori, nii. cleaning cloth(slevet),niii. prescription card,n 2217 spectacles after cataract surgery (where bifocal lens will be needed) na. frame material ployflex unbreakable frame with all different sizes suitable for cataract patient.nb.lenses cr hardcoated lenses (fiber) of prescribed numbers.nc. case plastic case printed as followos nname of the district.......nnpcb & vi, nmadhya pradeshnnot for salend.accessiores ni. dori, nii. cleaning cloth(slevet),niii. prescription card,n 2218 gastro intestinal anastomotic stapler 60 mm with dual firing knob and inbuilt knife in every cartridge,gia6038s,gia6048s,gia6025s 2219 gastro intestinal anastomotic stapler 80 mm with dual firing knob and inbuilt knife in every cartridge,gia8038s,gia8048s 2220 gastro intestinal anastomotic stapler 100 mm with dual firing knob and inbuilt knife in every cartridge,gia10038s,gia10048s 2221 gastro intestinal anastomotic 60 mm cartridge with fresh knife white/blue/green,gia6025l,gia6038l,gia6048l 2222 gastro intestinal anastomotic 80 mm cartridge with fresh knife white/blue/green,gia8038l,gia8048l 2223 gastro intestinal anastomotic 100 mm cartridge with fresh knife white/blue/green,gia10038l,gia10048l 2224 reusable gastro intestinal anastomotic stapler 60 mm with dual firing knob and inbuilt knife in every cartridge,gia60rs 2225 reusable gastro intestinal anastomotic stapler 80 mm with dual firing knob and inbuilt knife in every cartridge,gia80rs 2226 gastro intestinal anastomotic 60 mm cartridge with fresh knife white/blue/green for reusable stapler,gia6025rl,gia38rl,gia6048rl 2227 gastro intestinal anastomotic 80 mm cartridge with fresh knife white/blue/green for reusable stapler,gia8038rl,gia8048rl 2228 curved end to end anastomotic stapler 25 mm with tilt top anvil 2229 curved end to end anastomotic stapler 28 mm with tilt top anvil 2230 curved end to end anastomotic stapler 31 mm with tilt top anvil,eea31 circular stapler 2231 curved end to end anastomotic stapler 33 mm with tilt top anvil,eea33 circular stapler 2232 endo gastro intestinal anastomotic universal stapler can accommodate all sizes of cartridges also both straight and roticulator cartridges 2233 bladeless trocar 5mm/11mm/ 12mm,nonb12sts,nonb5stf 2234 optical bladeless trocars 5 mm / 11mm/12mm/15mm,onb12sts,onb5stf 2235 hemorrhoid stapler 33 mm diametre with detachable anvil and staple height 3.5 mm,hem3335 2236 hemorrhoid stapler 33 mm diametre with detachable anvil and staple height 4.8 mm,hem3348 2237 appose ulc skin stapler with 35 wide staples 2238 premium single use skin stapler remover 2239 med wound protector 5 9cm,wpsmd509 2240 sml wound protector 2.5 6cm,wpsm256 2241 premium surgiclip iii 9.0 2242 3x6 endobag specimen retrieval 2243 5 x 8 endobag specimen retriev 2244 endo clip* ii med/lrg applier 2245 premium surgiclip* ii m 9.75 2246 premium surgiclip* ii m 11.5 2247 fred anti fog kit 2248 monofilament glycomer 631* 3 0 75cm , undyed 24mm 3/8 circle reverse cutting 2249 monofilament glycomer 631* 0 75cm , undyed 37mm 1/2 circle reverse cutting 2250 monofilament glycomer 631* 2 0 75cm , undyed 37mm 1/2 circle reverse cutting 2251 monofilament glycomer 631* 0 ,150cm loop , violet 40mm 1/2 circle taper point 2252 monofilament glycomer 631* 1 ,90cm , violet 40mm 1/2 circle taper point 2253 monofilament glycomer 631* 2 0 75cm , violet 26mm 1/2 circle taper point 2254 monofilament polyglyconate* 3 0 75cm , green 20mm 1/2 circle taper point 2255 monofilament polyglyconate* 1, 150cm loop, green 40mm 1/2 circle taper point 2256 monofilament polyglyconate* 1 90cm , green 48mm 1/2 circle taper point 2257 monofilament polyamide * 1 150cm , loop , black 48mm 1/2 circle taper point 2258 coated,braided lactomer 91* 3 0 75cm , undyed 24mm 3/8 circle reverse cutting 2259 coated,braided lactomer 91* 3 0 75cm , violet 22mm 1/2 circle taper point 2260 coated,braided lactomer 91* 0 90cm , violet 37mm 1/2 circle reverse cutting 2261 coated,braided lactomer 91* 2 0 90cm , violet 37mm 1/2 circle reverse cutting 2262 coated,braided lactomer 91* 0 90cm , violet 40mm 1/2 circle reverse cutting 2263 coated,braided lactomer 91* 1 90cm , violet 40mm 1/2 circle reverse cutting 2264 180 absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry * 0 45cm , green 37mm 1/2 circle taper point 2265 180 absorbable polyglyconate knotless wound closure device with unidirectional & dual angled cut barbs geometry * 2 0 30cm , green 37mm 1/2 circle taper point 2266 90 glycomer 631 knotless wound closure device with unidirectional & dual angled cut barbs geometry 3 0 58cm , undyed 24mm 3/8 circle reverse cutting 2267 90 glycomer 631 knotless wound closure device with unidirectional & dual angled cut barbs geometry 3 0 45cm , undyed 24mm 3/8 circle reverse cutting 2268 polybutester with polytribolate coating knotless wound closure device with unidirectional & dual angled cut barbs geometry 1 45cm , blue 37mm 1/2 circle taper point 2269 polyester self gripping mesh for open inguinal hernia repair, size 14x9cm l&r 2270 polyester self gripping mesh for open incisional hernia repair, size 20x15cm 2271 polyester self gripping mesh for open incisional hernia repair, size 15x15cm 2272 macroporus partially absorbable mesh made up of approximately equal parts of polypropylene monofilament fiber (6 0) and poliglecaprone 25 monofilament fiber (5 0) with pore size 2.7 mm having a weight of 39 g/m2 and containing blue orientation stripes of polypropylene. 15cmx15cm 2273 purified lyophilized rabies antigen derived from rabies virus ( l.pasteur 2061/vero strain propagated in vero cells ) inactivated.2.5 i.u 2274 aceclofenac 100mg+paracetamol 325mg+chlorzoxazone 250mg tab(250mg),tablet 2275 aceclofenac 10 x 10 mg tab(10 x 10 ),tablet 2276 aceclofenac 100mg+paracetamol 500mg tab 2277 aceclofenac(100mg),tablet 2278 aceclofenac + paracetamol + chlorzoxazone 100 mg + 500 mg + 500 mg tab 2279 acetazolamide tab(250mg),tablet 2280 aciclovir cream 5% (5g tube) 2281 acyclovir(800mg),tablet 2282 acyclovir inj 250 mg/vial 2283 acyclovir inj 500mg/vial 2284 acyclovir intervenous infusion i.p 500mg/vial 2285 acyclovir suspension 400mg/5ml(100 ml bottle),suspension 2286 acyclovir tab 400 mg(400 mg),tablet 2287 acyclovir tab. ip 200mg 2288 adrenaline(1 mg / ml (1 ml amp)),injection 2289 aggs(anti gas gangrene serum)l/30000 ou/ml inj. 2290 albendazole suspension 200mg/5ml(10 ml bottle),syrup 2291 albendazole tab(200 mg),tablet 2292 albendazole tablets ip 400mg 2293 alpha beta arteether(150mg/2ml),injection 2294 alpha beta arteether inj 75 mg / 2 ml 2295 alpha beta arteether inj 75 mg /ml 1ml 1ml amp( ),injection 2296 alprazolam(0.5mg),tablet 2297 alprazolam tab. 0.25mg tab 2298 altracurium (10mg/ml,2.5ml vial),injection 2299 inj amphotericin b 500mg for injection 2300 cap amphotericin b 10mg 2301 amikacin(100mg / 2ml vial),injection 2302 amikacin(250mg/2ml),injection 2303 amikacin(500mg/2ml (2ml vial)),injection 2304 amiodarone inj. 50mg/ml (3ml vial) 2305 amiodarone tab 100mg 2306 amitriptyline(10 mg),tablet 2307 amitriptyline sugar coated tab. ip 25 mg 2308 amitryptiline 75 mg tab 2309 amitryptiline tab(50 mg),tablet 2310 amlodipine(10mg),tablet 2311 amlodipine(2.5mg),tablet 2312 amlodipin tab(5mg),tablet 2313 amoxicillin(125 ml/5ml (30 ml bottle)),suspension 2314 amoxicillin 250mg + clavulanic acid 50mg inj vial 2315 amoxicillin 250 mg / vial vial 2316 amoxicillin cap. 250 mg. 2317 amoxicillin + clavulanic acid (125 mg + 25 mg) / vial vial 2318 amoxicillin + clavulanic acid(200 mg + 28.5 mg),tablet 2319 amoxicillin trihydrate dispersible 125 mg tab(125 mg),tablet 2320 amoxycillin and clavulanic acid i.p.(200+28.5mg (30 ml bottle)),suspension 2321 amoxycillin and clavulanic acid i.p.(500mg + 125mg),tablet 2322 amoxycillin and potassium clavulanate i.p.(1 gm + 0.2 gm /10 ml vial),injection 2323 amoxycillin +clavulanic acid inj (amoxycillin 500 + clavulanic acid 100 mg)/vial 2324 amoxycillin dispersible tablets ip amoxicillin trihydrate ip equivalent to amoxicillin(250mg),tablet 2325 amoxycilline(500mg),capsule 2326 ampicillin(1 gm vial),injection 2327 ampicillin 250 mg cap 2328 ampicilline 125mg/30ml syrup 2329 ampicillin inj. 250 mg/vial 2330 ampicillin syrup (125 mg / 5 ml 30 ml bottle),syrup 2331 antacid chewable tablet containing aluminum hydroxide equivalent to dried gel 250mg+ magnesium hydroxide 250mg+ simethicone 50mg usp 2332 anticold (paracetamol 300mg+cetirizine hcl 5mg tablet 2333 anti d immunoglobulin for iv/im use (monoclonal) inj. 150mcg (1ml vial) 2334 anti hemophilic factor viii(250iu vial),injection 2335 anti rabies immunoglobulin inj 300 iu per 2ml (2ml vial)(300 iu per 2ml),injection solution for 2336 anti snake venom polyvalent inj 10ml (lyophilized)(10 ml vial),injection 2337 aripiprazole 5 mg tab 2338 artemether inj 80mg/ml (1 ml amp) 2339 artemether+lumefantrine 20mg+120mg tab 2340 artesunate inj 60 mg /vial 2341 artesunate + sulphadoxine + pyrimethamine (age group between 1 4 year)(50 mg (3 tab) + 500 mg (1 tab) + 25 mg (1 tab)),combi blister pack 2342 artesunate + sulphadoxine + pyrimethamine ip (age group 15 or above)(200 mg (3tab) + 750 mg (2tab) + 37.5 mg (1tab)),combi blister pack 2343 artesunate + sulphadoxine + pyrimethamine ip age group between 5 to 8 years(100 mg(3tab) + 750mg + 37.5mg (1tab)),combi blister pack 2344 artesunate tablets 150mg(3tab) + sulphadoxine (500mg+500mg) pyrimethamine 25mg +25mg tab ip (2tab) (age group 9 to 14 years) 2345 artesunate tablets 25mg(3tab) + sulphadoxine 125mg pyrimethamine 6.25mg tablets ip(1tab) (age group of less than 1year) 2346 ascorbic acid (vitamin c) tab. 500 mg. 2347 aspirin low dose 75mg tab 2348 aspirin low dose tab 150mg 2349 atenolol(25 mg),tablet 2350 atenolol tab. 100mg 10 x 14 tab 2351 atenolol tab 50mg. 2352 atorvastatin(10 mg),tablet 2353 atorvastatin(20mg),tablet 2354 atracurium besylate(10mg/ml inj amp),injection 2355 atropine sulphate 0.6 mg/ml sc/im/iv(2ml amp),injection 2356 atropine sulphate eye drops 1% (5 ml vial)(5 ml vial),eye drops/ ointment 2357 atropine sulphate eye ointment 1% (3 gm tube) 2358 azithromycin(100mg/5ml (15 ml bottle)),suspension 2359 azithromycin 1gm tab + cefixime 400mg tab 2360 azithromycin(200mg/5ml (15 ml bottle)),suspension 2361 azithromycin(250mg),tablet 2362 azithromycin(500 mg/5ml inj ),vial 2363 azithromycin 500mg tab 2364 balance salt solution for irrigation 500 ml ffs bottle(500ml bottle),eye applicap 2365 beclomethasone dipropionate, clotrimazole, neomycine sulphate, chlorocresol(0.025% + 1% + 0.5% + 0.1% w/w (5gm tube)),ointment or cream 2366 beclomethasone inhalation i.p 200 mcg per dose(200 metered dose container),inhaler 2367 benzathine penicilline 12 lac iu / vial vial 2368 benzathine penicillin powder for inj ip 6 lakh iu/vial 2369 benzyl benzoate lotion(25%),bottle 2370 benzyl penicillin 10lac/vial(penicillin g),injection 2371 betahistine(16 mg),tablet 2372 betahistine 8 mg tab 2373 betamethasone dipropionate ointment 0.05% (15gm) tube 2374 betamethasone tab 0.5 mg 2375 biphasic isophane insulin(30/70 40iu/ml (10 ml vial)),injection( mixtured ) 2376 insuline regular/ soulable (40iu/ml10mlvail) 2377 bisacodyl(5 mg),suppository 2378 bisacodyl tab 5mg 2379 botropase injection (haemocoagulase 1cu) 1ml 2380 bromhexine hydrochloride 4mg/5ml syrup (50ml bottle) 2381 budesonide nebulising suspension containing budesonide 0.25mg/ml 2ml amp 2382 budesonide respules 0.25mg/2ml inhalation(2ml amp/respule),inhaler 2383 bupivacaine hcl for spinal anaesthesia 0.5%(heavy)amp 4 ml amp 2384 bupivacaine hydrochloride inj. 0.5% (20 ml vial) 2385 bupivacaine hydrochloride inj. 0.5% 20ml vial (not for spinal use) 2386 bupivacaine hydrochloride inj. 4ml amp (not for spinal use)(0.5%),vial 2387 buppivacaine 5 mg, dextrose80 mg / ml, 4 ml inj injection 2388 caffeine citrate inj. 20mg/ml (3 ml vial)(20mg/ml 3 ml vial),injection 2389 calamine lotion ip (contains per 1000 ml: calamine 150 gm,zinc oxide 50 gm, bentonite 30 gm, sodium citrate 5gm, liquified phenol 5ml, glycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml) 50 ml bottle 2390 calcium carbonate 500 mg tab 2391 calcium carbonate derived from oyester shell equivalent to elemental calcium 500mg and vitamin d3 250 iu( ),tablet 2392 calcium gluconate injection i.p. 10%w/v (10ml amp) 2393 carbamazepine (sr) 100 mg tab 2394 carboprost tromethamine injection i.p.(15 methyl pgf2a)inj 250mcg/1ml 2395 carboxymethylcellulose sodium eye drop 0.5%(10ml),eye drop 2396 cefadroxil 250 mg tab 2397 cefadroxil 500 mg tab 2398 cefadroxil syrup(125 mg / 5 ml 30 ml bottle),syrup 2399 cefixime 200 mg tab 2400 cefixime 50 mg dt tab( ),tablet 2401 cefixime oral suspension(100 mg / 5 ml (30 ml bottle)),suspension 2402 cefixime tab ip 100mg tab 2403 cefoperazone 500mg + sulbactam 500mg(vial),injection 2404 cefotaxime + sulbactam 1000 mg + 500 mg vial 2405 cefpodoxime 100 mg( ),tablet 2406 cefpodoxime 200 mg tab 2407 cefpodoxime(50 mg),tablet 2408 ceftriaxone 1000mg + sulbactam 500mg(vial),injection 2409 ceftriaxone inj 250mg vial 2410 ceftriaxone+tazobactum(500mg+62.5mg vial),injection 2411 cefuroxime 250 mg,tablet 2412 cefuroxime 500 mg,tablet 2413 cephalexin 100 mg/ml 10 ml with dropper 2414 cephalexin dispersible tablet 125 mg 2415 cephalexine cap. 250mg capsule 2416 cephalexine cap. 500mg 2417 cephalexine(each 5ml contains 125mg (30ml bottle)),syrup 2418 cerumenolytic(for ear wax)each 10 ml contains paradichlorobenzene 2%benzocaine 2.7%chlorbutol 5%turpentine oil 15% 10 ml vial [110341] 2419 cetirizine syp 5mg/5ml 60 ml bottle syrup 2420 cetirizine tab. 10 mg 2421 chloramphenicol(1% (5 ml vial)),eye drop 2422 chloramphenicol ear drop 5% (5 ml vial) 2423 chloramphenicol eye applicaps 1% 100 applicaps per bottle 2424 chloraxozone + paracetamol 250 mg + 500 mg tab 2425 chlordiazepoxide 10 mg tab 2426 chlordiazepoxide 20 mg tab 2427 chlordiazepoxide(25 mg),tablet 2428 chlorhexidine 0.2% mouth gargle 100 ml 2429 chlorhexidine gluconate mouthwash 0.2% w/v solution(50ml bottle ),solution 2430 chlorhexidine gluconate solution 4% i.p. (antiseptic) 500 ml bottle 2431 chlorine based compound (sodium dicholoroiso cyanurate)nadcc tablets 75 mg with available chloroine 45 mg bis(45 mg),tablet 2432 chloroquine phosphate inj 40mg/ml (5 ml amp) 2433 chloroquine phosphate suspension equivalent to chloroquine(50mg/5ml (60 ml bottle)),suspension 2434 chloroquine phosphate tab. 250mg 2435 chlorpheniramine maleate 10mg/ml inj 10 ml vial 2436 chlorpheniramine maleate tab. 4mg 2437 chlorpromazine hydrochloride 100 mg sugar coated tab 2438 chlorpromazine hydrochloride(25 mg),tablet 2439 chlorpromazine inj ip 25mg/ml (2ml amp) 2440 chlorpromazine tab 100 mg 2441 cholecalciferol concentrate (powder form) ph.eur. 60000iu/gm 2442 cinnarizine(25 mg),tablet 2443 ciprofloxacin 0.3% + dexamethosone eye drop 0.1% 2444 ciprofloxacin 125 mg / 5 ml 60 ml bottle 2445 ciprofloxacin eye ointment 0.3% ( 3gm tube) 2446 ciprofloxacin inj 2 mg/ml inj 100ml glass bottle( ),injection solution for 2447 ciprofloxacin tab 250mg 2448 ciprofloxacin tab 500mg 2449 clindamycin(1% w/w 10 gm),gel 2450 clindamycin 300 mg/ml inj(1 each),injection 2451 clobazam(10 mg),tablet 2452 clobazam 5 mg tab 2453 clobetasol propionate 0.05% 15 gm tube 2454 clomiphene citrate 100 mg tab 2455 clomiphene citrate 50 mg tab 2456 clomipramine 25 mg tab 2457 clomipramine 50 mg tab 2458 clomipramine 75 mg tab 2459 clonazepam 0.25 mg tab 2460 clonazepam(1 mg),tablet 2461 clonazepam 2mg tab 2462 clonidine 100 mcg tab tablet 2463 clonidine injection, 10ml vial (1mg) 2464 clopidogrel + aspirin 150mg cap 2465 clopidogrel + aspirin(75 mg + 150 mg),capsule 2466 clopidogrel tab. 75 mg 2467 clotrimazole i.p. 2%w/w(15gm tube),cream 2468 clotrimazole + lignocaine ear drop 1%(5ml vial),drop 2469 clotrimazole suspension i.p 50mg/5ml 2470 clotrimazole vaginal pessary tab 100mg 14 x 10 tab 2471 tab clotrimazole 100mg 2472 clozapine 100 mg tab 2473 clozapine(50 mg),tablet 2474 colistin sulphate(12.5 mg / 5 ml 30 ml bottle),suspension 2475 compound benzoic acid ointment 2476 compound tincture benzoin ip 2477 co trimoxazole oral suspension ip(5 ml each trimethoprim 40 mg sulphamethoxazole 200 mg),bottle 2478 deferasirox dispersible(250mg),tablet 2479 deferasirox dispersible(500mg),tablet 2480 deferasirox dispersible tab. 100mg 2481 dexamethasone(4 mg),tablet 2482 dexamethasone sodium 0.5 mg, tab tablet 2483 dexamethasone sodium phosphate inj 8mg/2ml (2ml vial) 2484 dexamethasone tab(0.5mg),tablet 2485 dextran 70 injectable sol inj 500ml (solution) 2486 dextromethorphan 10mg/5ml syrup(60ml bottle) 2487 dextrose 10% inj 500ml ffs/bfs bottle( ),injection solution for 2488 dextrose 25% inj 500ml bfs bottle( ),injection solution for 2489 dextrose 5% 500ml bfs bottle( ),injection 2490 dextrose, d 25 0.25 25 ml(25 ml),injection 2491 dextrose, d 50 0.5 25 ml(25 ml),injection 2492 dextrose with saline 5% + 0.9% inj 500ml bfs bottle 2493 diazepam inj. 5 mg/ml (2 ml amp) 2494 diazepam tab 5 mg 2495 diclofenac 50mg +paracetamol 325mg+chlorzoxazone 500mg tab 2496 diclofenac 50mg +seratopeptidase 10mg tab(10mg),tablet 2497 diclofenac gel 1% 30gm tube 2498 dicyclomine(10mg/ml (2 ml amp)),injection 2499 dicyclomine 20mg tab 2500 dicyclomine hydrochloride oral solution 10 mg / ml 30 ml bottle(10 mg),solution 2501 dicyclomine + paracetamol tab 20 mg + 500 mg 2502 dicyclomine tab. 10mg 2503 diethylcarbamazine tab(100mg),tablet 2504 digoxin inj. 250mcg/ml 2505 digoxin tab 0.25mg(25x10),tablet 2506 dilitiazem tab 60mg 2507 dilitiazem tablets i.p. 30 mg 2508 diphenhydramine sg cap 25mg capsule 2509 diphenhydramine syrup(12.5mg/5ml (100 ml bottle)),syrup 2510 divalproex sodium 500 mg tab 2511 divalproex sodium 750 mg tab 2512 dobutamine hcl 50 mg / ml inj (5ml amp) 2513 domperidone(10mg),tablet 2514 domperidone suspension 1mg/ml (30ml bottle) 2515 dopamine hcl 40 mg/ml inj (5 ml amp) 2516 doxycycline cap 100 mg 2517 drotaverine(40 mg),tablet 2518 drotaverine inj. 40ml/2ml (2ml amp)(40ml/2ml 2ml amp),injection solution for 2519 electrolyte e(multiple electrolytes and dextrose inj type v ip)i/v fluid[each 100ml contains inj dextrose 5g, sod.acetate 0.64g, sod.chloride 0.50g,sodium citrate 0.075g,kcl 0.075g,ccl 0.035g,magnesium chloride 0.031g](500ml ffs bottle) 2520 electrolyte g(multi electrolyte with 5% dextrose iv injection type iv ip)intravenous fluid[each 100ml contains: anhydrous dextrose 5 gm,sod.chloride 0.37g,potassium chloride 0.13g,ammonium chloride 0.37g](500ml ffs bottle)(500 ml),bottle 2521 electrolyte m inj 500ml bfs bottle( ),injection solution for 2522 electrolyte p inj 500ml ffs/bfs bottle( ),injection solution for 2523 tab econazole 150 mg 2524 econazole nitrate 1% crem 15 gm 2525 enalapril maleate tab 5mg 2526 erythomycin stearate(250mg),tablet 2527 erythromycin stearate(500 mg),tablet 2528 escitalopram 10 mg tab 2529 escitalopram(20 mg),tablet 2530 escitalopram(5 mg),tablet 2531 etiophylline (77 mg) + theophylline (23 mg) tab 2532 etiophylline and theophylline(220 mg/2ml),injection 2533 etiophylline and theophylline paediatric syrup. 2534 etiophylline theophylline sr tab. 300mg( ),tablet 2535 etiophylline +theophylline syrup (46.5+14)mg / 5ml (100 ml bottle)( ),bottle 2536 favipiravir tab 200mg 2537 favipiravir tab 400 mg 2538 favipiravir tab 800mg 2539 ferrous ascorbate 100mg (elemental iron)+folic acid 1.5mg tablet 2540 fluconazole 0.3%(5 ml),eye drop 2541 fluconazole(150 mg),tablet 2542 fluconazole gel usp 0.5% 15 grm tube 2543 fluconazole iv(2mg/ml (100ml bottle)),injection 2544 flunarizine 5 mg tab 2545 fluoxamine(100 mg),tablet 2546 fluoxetine cap 10 mg 2547 fluoxetine cap. bp 20 mg 2548 folic acid tab(400 mcg),tablet 2549 folic acid tab ip 5 mg 2550 framycetin sulphate 1% cream(30 gm tube),cream 2551 frusemide inj. 10 mg/ml (2 ml amp) 2552 frusemide tab. 40mg 2553 furazolidone(25mg/5ml (60 ml bottle)),suspension 2554 furazolidone tab 100mg. 2555 fusidic acid 0.02 15 gm cream 2556 gamma benzene hexachloride solution 1% (100 ml bottle)(100 ml bottle),fluid 2557 gatifloxacin eye drop 0.3% 5ml 2558 gentamicin + betamethasone 0.3% w/v + 0.1% w/v 5 ml inj 2559 gentamicin inj. 40 mg/ml, 2ml amp 2560 gentamicin inj(80 mg/ml (2 ml amp)),injection 2561 gentamycin 0.3% eye/ear drops(5ml ffs squeeze vial),eye drop 2562 glibenclamide tab 5 mg 2563 gliclazide tab. 80 mg 2564 glimepiride 1 mg tab 2565 glimepiride 2 mg tab 2566 gluteraldehyde solution 2%(5 litre can),solution 2567 glycerine ip solution (100ml bottle) 2568 glyceryl trinitrate 0.5mg (sublingual) tab 2569 glyceryl trinitrate 5mg/ml inj 10ml vial (nitroglycerine)(5mg/ml),injection solution 2570 glycopyrolate 0.5% 5ml and neostigmin 2.5 mg/5 ml injection(each),injection 2571 haloperidol(5mg),tablet 2572 haloperidol inj 5mg/ml (1 ml amp) 2573 haloperidol tab 10mg 2574 halothane bp 250ml solution 2575 heparin(1000iu/ml 5ml vial),injection 2576 heparin inj(5000iu/ml 5ml vial),injection 2577 homatropine 2% 1 ml vial inj 2578 human albumin solution i.p. 20%w/v (100 ml vial),injection 2579 hyaluronidase 1500 iu/ 2 ml(2 ml amp/vial),injection 2580 hydralazine hydrochloride 20mg/ml injection (1 ml amp/vial) 2581 hydrochlorothiazide tab 25 mg 2582 hydrochlorthiazide(12.5 mg),tablet 2583 hydrocortisone sodium succinate(100 mg/vial),injection 2584 hydrogen peroxide sol 6%v 400 ml bottle 2585 hyoscine butylbromide tab 10mg. 2586 hyoscine butyl bromind 1 ml mg(amp),injection 2587 ibuprofen 200 mg,tablet 2588 ibuprofen 400mg+ paracetamol 325mg tablet( ),tablet 2589 ibuprofen(400mg),tablet 2590 ibuprofen syrup 100mg/5ml (60 ml bottle)(60 ml bottle),syrup 2591 imipramine 75 mg tab 2592 inj. pantaprazole (40mg) 2593 ipratropium bromide inhaler 20mcg per puff 200dose 2594 iron and folic acid enteric coated tab dried ferrous sulphate equ. to ferrous iron 100 mg and folic acid 0.5 mg (blue tablet) 2595 iron and folic acid enteric coated tab dried ferrous sulphate ip eq. to 45 mg elemental iron and 400 mcg folic acid ip (pink color) wifs junior 2596 iron and folic acid enteric coated tab. dried ferrous sulphate ip equ. to ferrous iron 100 mg and folic acid ip 0.5 mg granules (red tablet)( ),tablet 2597 iron folic acid syrup, each ml containing 20mg elemental iron&100mcgfolic acid with suitable anti oxidant, antimicrobial agent and food grade flavouring agent.the bottle should have 6 fragmented markings at equal intervals(if an artificial sweetening is used it should be highlighted on the label. warning should be put on label medication should be kept out of reach of children. (as per attached specification) (50ml bottle with auto dispenser)),syrup 2598 iron sucrose inj usp 100 mg/5 ml (5 ml amp) 2599 isosorbide 5 mononitrate(tab.20 mg),tablet 2600 isosorbide dinitrate tab ip 5 mg 2601 isosorbide mononitrate tab. 20mg 2602 isoxsuprine(10mg),tablet 2603 isoxsuprine hydrochloride inj. 5mg/ml (2 ml amp)(2 ml),injection 2604 ivermectin tab usp 6mg 2605 ivermectin tab usp 12mg 2606 isavuconazonium sulphate injection 372mg 2607 isavuconazole100 cap 2608 iv human immunoglobin 5mg/100ml(1 each),injection 2609 ketamine hydrochloride inj. 10mg/ml (10ml vial) 2610 ketoconazole ointment 2% 15gm tube(15 gm),ointment 2611 labetalol 100 mg tab 2612 lactobacillus tab (lactobacillus 60 million spores) . 2613 levetiracetam 250 mg tab 2614 levetiracetam 500 mg tab 2615 levocetirizine + monteleukast((2.5 mg + 4 mg) / 5 ml, 30 ml bottle),suspension 2616 levocetirizine + monteleukast 5 mg + 10 mg tab 2617 levocetirizine tab 5mg 2618 levofloxacin(250mg),tablet 2619 levofloxacin 500mg inj 100ml ffs/bfs bottle( ),injection solution 2620 levofloxacin 500mg tablet 2621 lignocaine 2 %(21.3 mg / ml (30 ml vial)),injection 2622 lignocaine 2% + adrenaline 5 mcg/ml(30 ml ),vial inj 2623 lignocaine hydrochloride eye drops 4% (5 ml vial) 2624 lignocaine hydrochloride for spinal anaesthesia(heavy) 0.05 2 ml amp 2625 lignocaine hydrochloride gel 2% w/v (30 gm tube) 2626 liquid paraffin ip 500 ml solution 2627 lithium carbonate 400 mg tab 2628 lmwh low molecular weight heparin inj 4000iu/ml.( ),injection solution 2629 lmwh low molecular weight heparin inj. 6000niu/ml( ),injectn solution 2630 lorazepam 1 mg tab 2631 lorazepam 2 mg / ml 2 ml vial 2632 lorazepam 2 mg tab 2633 losartan potassium, hydrochlorthiazide(50 mg + 12.5 mg),tablet 2634 losartan tab 50 mg 2635 lysol ip (cresol with soap solution) ( 5ltr jar) 2636 magnesium hydroxide + aluminium hydroxide simethecon 250 mg + 250 mg + 50 mg/ 5 ml 170 ml bottle(syrup),syrup 2637 magnesium suplhate injection i.p.50 % w/v (1 ml amp)(1 ml amp),ampoule 2638 mannitol inj. 10% 350ml bottle( ),injection solution for 2639 mannitol injection i.p. 20% 100ml bottle( ),injection solution for 2640 mephentermine inj 30mg/ml(10 ml vial),injection 2641 meropenem inj 125mg/vial(each),injection 2642 mesalamine (5 aminosalicylic acid 400 mg) tab 2643 metformine 500mg + glibenclamide 5mg(tab),tablet 2644 metformin + glimepiride 500 mg + 2 mg tab 2645 methylcobalamin + alpha lipoic acid(1500 mcg + 100 mg ),capsule 2646 methylcobalamin inj(500 mcg/ml (10 ml vial)),injection 2647 methylcobalamin/mecobalamin(500 mcg),tablet 2648 methyldopa tab. 250mg 2649 methyl ergometrine inj meleate 0.2 mg /ml (1ml amp) 2650 methyl ergometrine maleate tab. 0.125mg 2651 methyl phenidate 10 mg tab 2652 methyl phenidate 20 mg tab 2653 methyl prednisolone sodium succinate inj. usp 40mg vial 2654 methyl prednisolone sodium succinate inj. usp 500mg 2655 methyl prednisolone sodium succinate tablet 8 mg 2656 methyl prednisolone tab 16 mg 2657 methyl prednisolone tab 4mg 2658 metoclopramide inj. 5mg/ml (2 ml amp) 2659 metoclopramide syrup(5mg/5ml (30 ml bottle)),syrup 2660 metoclopramide tab. 10mg 2661 metoprolol(50mg),tablet 2662 metoprolol inj 1 mg/ml(5ml vial),injection solution 2663 metronidazole 100mg/5ml syrup (30ml) 2664 metronidazole benzoate oral suspension(100mg of base/5 ml (60ml bottle)),suspension 2665 metronidazole inj. 500mg/100ml (100 ml ffs bfs bottle) 2666 metronidazole tab 200 mg 2667 metronidazole tab(400mg),tablet 2668 miconazole cream i.p. 2% w/w(15 gm tube),consumable 2669 midazolam inj. 1mg/ml 10ml vial 2670 mifepristone 200mg tab 2671 milk of magnesia 11.25 ml, liquid paraffin 3.75ml phenolphthalein 50mg/15ml (cremaffin pink formula) 170ml syrup 2672 mirtazapine 15 mg tab 2673 mirtazapine 30 mg tab 2674 mirtazapine 7.5 mg tab 2675 misoprostol(200mcg),tablet 2676 morphine sulphate inj. ip 15mg/ml 2677 moxifloxacin 0.5% w/v(5 ml),eye drop 2678 moxifloxacine + dexamethasone 0.5% + 0.1% w/v drop 2679 moxifloxacin + prednisolone 5 mg + 3 mg /5 ml drop 2680 multivitamin drops (approx 22 drops)( ),drop 2681 multivitamine 100ml syrup(100 ml),syrup 2682 multivitamin sugar coated tablet 2683 mupirocin(2% w/w (5 gm tube)),ointment 2684 n acetyl cysteine inj 200mg/ml in 10ml amp 2685 naloxone inj. 0.4 mg/ml(1ml ampoule),injection solution 2686 neostigmine(0.5mg/ml (1ml amp)),injection 2687 nifedipine capsule 5mg cap 2688 nifedipine (sublingual) 10 mg tab 2689 nifedipine tablets 10mg tab 2690 nitrazepam 5 mg tab 2691 nitrofruantoin(100mg),tablet capsule 2692 nitroglycerine inj. usp 25 mg/5ml (5ml amp) 2693 non ionic contrast media(350 mg , 100ml),consumable 2694 noraderanaline bitartrate inj 2 mg base/2ml (2ml amp)(2 mg base/2ml),injection 2695 norfloxacine 400mg and tinidazole 600mg tab 2696 norfloxacin +metronidazole 30ml syrup 2697 norfloxacin tab. 400mg 2698 ofloxacin 0.3% w/v of ofloxacin ph.eur.(5 ml vial),eye drop 2699 ofloxacin + dexamethosone(0.3%+ 0.1% (10 ml)),eye drop 2700 ofloxacin infusion (2mg/1ml (100ml ffs bottle)),bottle 2701 ofloxacin tab 400 mg 2702 olanzapine 10mg tab 2703 olanzapine( 5 mg),tablet 2704 olopotadine antiallergic(0.1% w/v (5 ml vial)),eye drop 2705 omeprazole 40mg(vial),injection 2706 omeprazole cap. 20mg( ),capsule 2707 ondansetron(2mg/5ml 30ml bottle),syrup 2708 ondansetron 8mg tab 2709 ondansetron inj. 2 mg/ ml (2 ml amp) 2710 ondansetron inj 2 mg/ ml (4 ml amp)(4 ml amp),injection solution for 2711 ondansetron tab 4 mg 2712 ors packet who formula sodium chloride 2.5g, potessium chloride 1.5g, sodium citrete 2.09g dextrose 13.6g, 20.5gm pouch( ),powder 2713 ors who powder glucose anhydrous 13.5g/l, sodium chloride 2.6g/l, potassium chloride 1.5g/l, trisodium citrate 2.9g/l 2714 oseltamivir 12 mg/ml syrup 75ml bottle 2715 oseltamivir cap 30 mg 2716 oseltamivir cap 45 mg 2717 oseltamivir cap 75 mg 2718 oxytocin inj(5 iu/ml (1ml amp)),injection 2719 pantoprazole 40 mg, domperidone 10 mg(tab),tablet 2720 pantoprazole tab 40 mg 2721 paracetamol 1000mg i v infusion 100 ml ffs bottle 2722 paracetamol inj 150mg/ml 2ml amp(2ml amp),injection 2723 paracetamol oral drops(100 mg/ml (15 ml bottle with dropper)),drop 2724 paracetamol syrup/suspension 125 mg/5ml (60ml bottle) 2725 paracetamol tab. 500mg 2726 paracetamol tab 650 mg(650 mg),tablet 2727 pentazocin lactate inj. 30mg/ml (1 ml amp) 2728 permethrin lotion 5% w/v 60 ml bottle 2729 pheniramine maleate(22.75 mg/ml (2 ml amp)),injection 2730 phenobarbitone tab. 30 mg 2731 phenobarbitone tab. 60 mg( ),tablet 2732 phenytoin sodium(50 mg/ml (2ml amp)),injection 2733 phenytoin sodium oral suspension 25 mg/ml(100 ml bottle),suspension 2734 phenytoin sodium tab 100mg 2735 pilocarpine eye drops 4% 2736 piperacillin + tazobactam 1000 mg + 125 mg vial 10 ml vial( ),injection 2737 posaconazole oral suspension 200mg/5ml 105 ml 2738 posaconazole 300mg/16.7 ml injection 2739 tab posaconazole delayed releasetab 100mg 2740 potassium chloride inj. 150mg/ml 2741 potassium chloride syrup 200ml(each),syrup 2742 povidone iodine ointment 5% 15gm tube 2743 povidone iodine solution 5%(100 ml bottle),solution 2744 povidone iodine surgical scrub solution. 7.5%(500 ml bottle),solution 2745 pralidoxime (pam) inj. 25 mg/ml(20 ml amp/vial),injection 2746 primaquin 15mg tab 2747 primaquin(2.5mg),tablet 2748 primaquin(7.5mg),tablet 2749 promethazine(50 mg),tablet 2750 promethazine inj 25 mg/ml (2 ml amp)(2 ml amp),injection 2751 propofol sodium inj 1%w/v 10mg/ml 20ml vial(10mg/ml),vial 2752 propranolol 40 mg tab 2753 propranolol tab(10 mg),tablet 2754 pyridoxine tab 10mg 2755 quetiapine(100 mg),tablet 2756 quetiapine(50 mg),tablet 2757 quinine sulphate 150mg/5ml syrup 60 ml 2758 quinine sulphate(300mg),tablet 2759 quinine sulphate inj. 300mg/ml . 2760 rabeprazole(20 mg),tablet 2761 rabies immunoglobulin inj 300 iu (2ml vial pfs)( ),vial 2762 rabies vaccine inj (vero cell culture) inj. intra dermal( ),vial 2763 ramipril tab 2.5 mg 2764 ramipril tab 5 mg 2765 ranitidine(150mg),tablet 2766 ranitidine(50mg/2ml , 2ml amp),injection 2767 recombinant anti hemophilic factor viii(500 iu inj / vial),injection 2768 rectified spirit (90%) solution 2769 rifampicin cap(300 mg),capsule 2770 rifampicin cap(450 mg),capsule 2771 rifampicin cap(600 mg),capsule 2772 ringer lactate ip i/v 0.24 % w/v of lactic acid ( eq. to 0.32% w/v of sodium lactate), 0.6 % w/v sodium chloride, 0.04 % w/v potassium chloride and 0.027 % w/v calcium chloride(500ml ffs bottle),injection solution 2773 risperidone 1mg tab 2774 risperidone 2 mg tab 2775 risperidone 4 mg tab 2776 risperidone + trihexiphenidyle(2 mg + 2 mg),tablet 2777 risperidone + trihexiphenidyle(3 mg + 2 mg),tablet 2778 risperidone + trihexiphenidyle 4 mg + 2 mg tab 2779 salbutamol 2.5 mg /3 ml 3 ml inj 2780 salbutamol(2mg / 5ml (100ml bottle)),syrup 2781 salbutamol inhalation ip 100mcg/dose(200 metered dose container),inhaler 2782 salbutamol nebuliser solution bp sabutamol sulphate eq. to salbutamol 1mg per ml 2.5 ml amp 2783 salbutamol sulphate syrup 2mg/5ml 60ml( ),bottle 2784 salbutamol sulphate tab ip 4mg(4mg),tablet 2785 serratiopeptidase 10 mg tab 2786 sertraline(100 mg),tablet 2787 sertraline 50 mg tab 2788 silver sulphadiazine cream usp 1% w/w 25gm 2789 sodium bicarbonate inj. 7.5% w/v(10ml),ampoule 2790 sodium chloride inj iv 500ml bfs bottle( ),injection solution 2791 sodium chloride n/2 injection ip (0.45%)(500ml ffs bottle),injection 2792 sodium chloride n/2 injection ip 500ml bfs bottle( ),bottle 2793 sodium chloride normal saline(100ml ffs bottle),solution 2794 sodium hyaluronate (intraocular) 10 mg /ml 2ml inj 2795 sodium hypochlorite 5% solution 5ltr 2796 sodium hypochlorite solution 100 ml bottle 2797 sodium valporate 300 mg tab 2798 sodium valproate 100 mg/ml 5 ml inj 2799 sodium valproate 200 mg / 5 ml 100 ml bottle 2800 spironolactone tab 100mg(10x10),tablet 2801 streptomycin inj 0.75g 2802 succinyl choline inj. 50mg/ml (10 ml vial)(10 ml vial),injection solution 2803 sulfacetamide eye drops 20% 2804 sulfamethoxazole 200mg and trimethoprim 40mg per 5ml suspension 50ml bottle 2805 sulfamethoxazole and trimethoprim(100 mg and 20mg),tablet 2806 sulfamethoxazole and trimethoprim(400mg + 80mg),tablet 2807 sulfamethoxazole and trimethoprim(800mg + 160mg),tablet 2808 sulfamethoxazole +trimethoprim tab(200 mg + 40 mg),tablet 2809 surgical spirit bp 500 ml( ),bottle 2810 syp. cefodroxil 125mg/30ml syrup 2811 tab amitryptyline(25 mg),tablet 2812 tab citalopram(20 mg),tablet 2813 tablet domeperidone (10mg),tablet 2814 terbinafine hydrochloride 250mg 2815 terbinafine hydrochloride1%cream 10grm 2816 teicoplanin 200 mg /vial vial 2817 telmisartan, hydrochlorthiazide(40 mg + 12.5 mg),tablet 2818 telmisatran 40 mg tab 2819 temozolomide 20mg cap 2820 tetanus immunoglobulin(usp/ip 250 iu/vial),injection 2821 tetanus immunoglobulin usp/ip(500 iu/vial),vial 2822 tetanus toxide inj 5ml( ),injection solution 2823 thyroxine sodium 75 mcg 100 per bottle 2824 thyroxine sodium tab 100 mcg (100 tab bottle)(100 tab),tablet 2825 tianeptin 12.5 mg tab 2826 timolol maleate eye drop i.p. 0.5 %w/v (5 ml vial)(5 ml),solution 2827 tinidazole 150 mg / 5 ml 60 ml bottle 2828 tinidazole tab 500mg 2829 tobramycin(0.3% 5ml),eye drop 2830 tobramycin + dexamethasone(0.3%w/v + 0.1%w/v (5ml vial)),eye drop 2831 tramadol(100mg/ml (2 ml amp)),injection 2832 tramadol cap 50mg 2833 tramadol inj. 50mg/ml. (2ml amp) 2834 tramadol tab. 100mg 2835 tranexamic acid 500 mg tab tablet 2836 tranexamic acid inj. 125mg/ml amp 2837 trifluoperazine + trihexyphenidyle 5 mg + 2 mg tab 2838 trihexyphenidyl 2mg tab 2839 urokinase 5 lac iu/vial inj 2840 valethamate bromide inj. 8mg/ml 2841 vancomycin hydrochloride(500mg),injection 2842 verapamil tab 40 mg ip( ),tablet 2843 vildagliptin tab(50 mg),tablet 2844 vitamin a cap usp soft gelatin capsule(1 lakh iu),capsule 2845 vitamin a cap usp soft gelatin capsule( 2 lakh iu),capsule 2846 vitamin a syrup(100000 iu/ml with market spoon for 1ml and 2 ml (100 ml bottle)),syrup 2847 vitamin b complex injection nfi formula 30ml/vial(30ml/vial),injection 2848 vitamin. b complex tab. nfi (prophylactic) 2849 vitamin d3 (cholecalciferol)(400 iu /ml (100 ml bottle)),syrup 2850 vitamin e 50 iu /ml 10 ml bottle with dropper 2851 vitamin e capsule usp (400 mg) 2852 vitamin k1 inj 1mg/0.5ml (0.5 ml amp) 2853 water for injection 5 ml amp 2854 water for injection inj 10 ml amp 2855 water for injection ip(2 ml amp) 2856 xylometazoline nasal(0.1%w/v (10 ml vial)),drop 2857 zinc tab 20mg dispersible 2858 zinc tab 10mg dispersible 2859 zinc sulphate syrup 20mg/5ml(50 ml bottle),syrup 2860 anti d immunoglobin 300 mcg inj 2861 cefotaxime sodium inj 250 mg vial 2862 cefotaxime sodium inj(500 mg/vial),injection 2863 cefotaxime sodium inj. 1 gm vial 2864 ciprofloxacin 0.3%(5ml vial),eye drop 2865 ciprofloxacin 500mg + tinidazole 600mg tab 2866 cough syrup (each 5ml contains ammonium chloride 138mg, diphenhydramine hcl 14.08mg, sodium citrate 57.03mg, menthol 2.5mg) 2867 dextromethorphan 10mg/5ml syrup(100 ml bottle),syrup 2868 diclofenac sodium 25 mg/ml(3ml amp),injection 2869 diclofenac sodium 50mg + paracetamol 325mg tab 2870 diclofenac sodium tab 50 mg 2871 enoxaparin(40mg equivalent to 4000 iu vial/pfs),injection 2872 enoxaparin(60mg equivalant to 6000 iu vial/pfs),injection 2873 formaldehyde (formalin) 37% acq dilute 34 ml formaledehyde solution with water to produce 100ml (450 ml bottle) 2874 human anti d. immunoglobulin (monoclonal)(300mcg/vial),injection 2875 inj. ceftriaxone (1g) 2876 meropenam 500mg inj 2877 meropenem 250 mg / vial(250mg/vial),injection 2878 metformin(500 mg),tablet 2879 streptokinase inj 15 lac iu 2880 ampicillin(500 mg/vial),injection 2881 ampicillin trihydrate(500mg),capsule 2882 human anti d. immunoglobulin(polyclonal) bp/ ep/ usp/ ip(300mcg/vial (vial/pfs)),injection 2883 ceftrixone 250 gram inj 2884 albumin 100 ml bottle(each) 2885 albumin 600 ml(model ba 400 system (mfg bybio system)) 2886 albumin(mfg pathogyme diagnostics)(200 ml (4 x 50 ml)) 2887 chlorquine phosphate 64.5 mg/ ml, 5 ml inj 2888 dextrose 25 %, 25 ml inj 2889 diclofenac sodium injection,3ml 2890 halothane 200ml 2891 hydrocortisone sodium succinate inj. 200 mg/vial 2892 ad syringe 0.1 ml 2893 ad syringe 0.5 ml 2894 barium chloride powder(powder),consumable 200gm 2895 benedicts solution (qualitative) 100ml 2896 black disinfectant fluid (phenyl)strength : specification as per schedule o grade i per lit 2897 blood culture media aerobic for adult(bact/alert fa plus),each 2898 bloting paper(paper),consumable 100 per pack 2899 edta powder(250 gm),consumable 2900 edta vial with safty cap (2ml.) capsule 2901 gentian violet crys sol 1% 2902 x ray developer powder (13.5 liter),consumable 2903 absorbable gelatine sponge ip 80mm x 50mm x 10mm 2904 absorbent cotton roll 100 gm each consumable 2905 absorbent cotton wool ip 500 grms(each),consumable 2906 acetic acid solution(3% 100 ml bottle),consumable 2907 acetone detection kit(100 gm),powder 2908 adhesive plasters usp 7.5 cm x 5 mts/roll 2909 adhesive roll 1 inch x 5 m / roll 2910 alkaline phosphatase (alp) dea 300 ml(model ba 400 system (mfg bybio system)),consumable 2911 alkaline phosphatase kit (kinetic) 10x2.2ml 44 test/kit consumable 2912 alkaline phosphate(100 ml (5 x 20)),consumable 2913 ambu bag adult (silicon)(each),consumable 2914 ambu bag child (silicon)(each),consumable 2915 auto pippets fixed volume 1000 micro liters each 2916 auto pippets fixed volume 10 micro liters each 2917 auto pippets fixed volume 20 micro liters each 2918 baby diapers small (10 diaper per pkt) 2919 baby oxygen mask set of all sizes 2920 balanced salt solution 500 ml bottle(each),consumable 2921 basic carbol fuchsin for afb staining 25 gm/pkt 2922 b.b. silk 6 reels x 25 mts length 25 mts.black braided silk without needle in reels non absorbable surgical sutures usp , 2 0(6 reels is per box rate should be quoted for 6 reels ),surgical material 2923 b.b. silk 6 reels x 25 mts length 25 mts. black braided silk without needle in reels non absorbable surgical sutures usp 3 0(6 reels is per box rate should be quoted for 6 reels),consumable 2924 b.b. silk 6 reels x 25 mts size:1/0(6 reels is per box rate should be quoted for 6 reels),surgical material 2925 b.b. silk 6 reels x 25 mts size:3/0 length 25 mts 2926 b.b silk size 3/0 (12 foils/pkt)(3/8cir rcut needle 26mm length 76 cm),needle 2927 b.b silk with 1/2 cir rb needle 20 mm length 75 cm non absorbable surgical suture usp size 3 0,(12foils/pkt),needle 2928 b.b silk with 1/2 cir rb needle size:2/0 30 mm length 75 cm surgical material 2929 b.b silk with 1/2 cir rb needle size:3/0 20 mm length 75 cm 2930 b.b silk with 1/2 cir rb needle size:4/0 20 mm length 75 cm, 12 foils per packet 2931 benedicts qualitative reagent(1x5 lit),consumable 2932 serum bilirubin total/direct (autospan/erba) kit each 2933 bilirubin (direct) as 300 ml(model ba 400 system (mfg bybio system)),consumable 2934 bilirubin kit (colorimeter semi auto) 4x60 ml 480 test/kit consumable 2935 bilirubin standard 1x5 ml(model ba 400 system (mfg bybio system)),consumable 2936 bilirubin (total) 600 ml(model ba 400 system (mfg bybio system)),consumable 2937 biochemistry calibrator 5x5 ml(model ba 400 system (mfg bybio system)),consumable 2938 biochemistry control serum l1(5x5 ml),consumable 2939 biochemistry control serum l1 5x5 ml(model ba 400 system (mfg bybio system)),consumable 2940 biochemistry control serum l2(5x5 ml),consumable 2941 biochemistry control serum l2 5x5 ml(model ba 400 system (mfg bybio system)),consumable 2942 black braided silk with 1/2 cir cd cutting needle 16 mm length 75 cm 3/0 (14 foils/pkt) 2943 black braided silk with 1/2 cir length 75 cm size 3/0(12 foils/pkt),consumable 2944 black braided silk with 1/2 cir rb needle 20 mm length 75 cm 1/0 13 foils/pkt 2945 black braided silk with 1/2 cir rb needle 30 mm length 75 cm 2/0 12 foils/pkt 2946 blood culture media aerobic for pediatric(bact/alert pf plus),each 2947 blood culture media anaerobic for adult(bact/alert fa plus),each 2948 blood culture media anaerobic for pediatric(bact/alert pf plus),each 2949 blood culture media mycobacterium spp(bact/alert mp (plastic)),each 2950 blood gluose (god/pod)(1000 ml),consumable 2951 blood urea (bun) uv(1000 ml),consumable 2952 cannula fixer set(piece),each 2953 capillary tube 100 pieces consumable 2954 carbol fuchsin for zn stain (500ml bottle) 2955 cassette 10 x 12 2956 cassette 12 x 15 2957 catgut chromic size:2/0 length 150 cm 2958 catgut chromic with 1/2 cir cutting needle 12mm, length 70cm no.3 0, 12 foils per pakt 2959 catgut chromic with 1/2 cir rb needle 30 mm length 70cm no. 1 0, 12 foils per packet 2960 catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 1 consumable 2961 catgut chromic with 1/2 cir rb needle 40 mm length 75cm no. 2 consumable(each),consumable 2962 cell clean for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 50 ml),consumable 2963 cell pack for 5 part hematology analyser (model : sysmex xs 800i (japan))(pack size 20000 ml),consumable 2964 cell pack, reagent pack for cell counter((erma and mindrug) complete set),consumable 2965 mindray diluent m52 for cbc model no. mindray bc 5150 20 lit. 2966 mindray lh lyse m52 100 ml for cbc model no. bc 5150 2967 mindray diff lyse m52 500 ml for cbc model no. bc 5150 2968 mindray cleanser m52 1 lit for cbc model no. bc 5150 2969 mindrayauto hematology analyzer(paper roll),consumable model no. bc5150 2970 central venous catheter kit single lumen 2971 central venous catheter kit single lumen 18 g 2972 cervical collar/each soft, medium sized 2973 chikungunya card test 1 gg + 1 gm (25 test/kit) 2974 chlorhexidine 0.5 % propanol 70 %, 100 ml hand rub 2975 chlorhexidine acetate 0.5 %, medicated gauze 2976 cholesterol 600 ml(model ba 400 system (mfg bybio system)),consumable 2977 cholesterol hdl direct 160 ml(model ba 400 system (mfg bybio system)),consumable 2978 cholesterol kit end point enzymatic kit 50 test/kit 2979 cholesterol kit end point enzymatic kit 5x20ml 200 test/kit 2980 chromic (12 foils/pkt)(3/8 rb needle 30 mm, length 76 cm, size 2/0),needle 2981 con. (hno3) nitric acid (2.5 liter),consumable 2982 cotton crape bandage 10cm x 4m (box of 10 bandages) 2983 cotton crape bandage 15cm x 4m (box of 10 bandages) 2984 cover slip(50 per pkt) 18 x 18 mm, thickness 0.17 mm 2985 cpk mb kit (reckon) 25 test/kit 2986 creatine calorimeter for semi auto kinetica 4x60ml 480 test kit 2987 creatinine 600 ml(model ba 400 system (mfg bybio system)),consumable 2988 creatinine calorimeter for semi auto kinetic 4x60ml 480test/kit 2989 creatinin kit consumable each 2990 cresent knife(1 each),consumable 2991 crp kit 1x100 biolab qualitative) 2992 crp latex slide per test 2993 crp test kit (latex/card) (25 test/kit) 2994 delivery set 2995 dengu card antigen(25 card/pkt),consumable 2996 dengue duo serum plasma 10 test/kit(sd) 2997 dental x ray film size 31 x 41 mm (150 films / pkt) 2998 developer single bath liquid concentrated of consistent quality. it sould have favoutable contrast/fog ratio and good shelf life (5 ltr can to make 22.5 liters working solution) 2999 diagnostic strips for urine sugar/albmin packing: amber colored, 100 strips/pkt(mfg by anmol laboratories pvt ltd),consumable 3000 digital x ray film 10x12 (150 films/pkt) 3001 digital x ray film 11x14 (150 films/pkt) 3002 digital x ray film 8x10 (150 films/pkt) 3003 digital x ray film size 14 x 17((100 sheet per packet)),film 3004 disposable paper gloves size 7,1/2 inches consumable 3005 disposable paper gloves size 7 inches consumable 3006 disposable plastic appron (full size) 3007 disposable pricking lancet 100 units consumable 3008 disposable scalp vein set size 20 no 3009 disposable scalp vein set size 22 no 3010 disposable sharp collection containers 1.5 l 3011 disposable sharp collection containers 5 ltr 3012 disposable spinal (l.p.) needle(25g),surgical material 3013 disposable spinal needle, mfg by alpha medicare & devices pvt. ltd.(18 no),needle 3014 disposable spinal needle, mfg by alpha medicare & devices pvt. ltd.(22 no),needle 3015 disposable sterile gloves bis specification gloves, surgical rubber, hypoallergic latex, 100%, 7 inc 3016 disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex, 100%, 6 1/2 inches 3017 disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex, 100%, 6 inches 3018 disposable sterile gloves bis specification gloves, surgical rubber, made of hypoallergic latex, 100%, 7 1/2 inches 3019 disposable sterile hypodermic syringe 10ml(each),consumable 3020 disposable suction catheter assorted covering all sizes 10,12,14,16,18 consumable 3021 disposable suction catheter size 12 3022 disposable suction catheter size 14 3023 disposable surgeon cap(box of 100 caps) 3024 disposable syringe 50 ml 3025 disposable syringes is 10258:2002 with needle is 10654:2002 20ml 3026 disposable syringe with needle 20ml each 3027 disposable syringe with needle(2ml each),syrings 3028 disposable syringe with needle(3ml each),syrings 3029 disposable syringe with needle 5ml each 3030 disposable syringe with needle cgs 1cc with mark 0 1ml consumable 3031 disposable three layer surgical mask(box of 100 mask) 3032 ecg jelly 250 gms 3033 ecg roll 112 mm 3034 ecg roll 108 mm 3035 serum cholesterol kit (autospan/erba) 3036 esr tube (western green) 3037 esr tube stand(western green) 3038 edta k3 vial each 3039 edta solutions k3 (500 ml) 3040 fauchets reagents (125 ml),consumable 3041 feeding tube (catheter) 10g 3042 field stain a 500ml 3043 field stain a(mfg precious life care pvt ltd)(500 ml bottle),consumable 3044 field stain b 500ml 3045 field stain b(mfg precious life care pvt ltd)(500 ml bottle),consumable 3046 filter paper sheet((whatmann no 01) sheets),consumable 3047 foldable iol sterile lens + 18.5 d (usfda approved, as per specification)(each),consumable 3048 foldable iol sterile lens pc+14d(lens 2),pc+16d(lens 3),pc+18d(lens 5),pc+19d(lens 5),pc+19.5d(lens 5), pc+20d(lens 15),pc+20.5(lens 15),pc+21d(lens 13),pc+21.5d(lens 11),pc+22d(lens 11),pc+22.5d(lens 5),pc+23d(lens 5),pc+24d(lens 3),pc+26d(lens 2)(100 lens per box),lens 3049 foleys catheter size 12 2 way(10 each),consumable 3050 formaldehyde (formolene ) tab 3051 fouchets reagent (100 ml bottle) 3052 g6pd deficiency test kit 10 test 3053 gauze sponge/each(size 3 x 3),consumable 3054 gentian violet (gram stain) 100ml bottle 3055 glass slide 75mm x 25 mm(50 slide/pkt) thickness 1.35mm,detail specifications i with smooth edges, without any scrathtches. ii glazed glass.iii no visual or chromatic abbretions 3056 glass test tube 12 x 100 (medium size) heavy quality 100/pkt 3057 glass test tube 12 x 75(small size) heavy quality 100/pkt 3058 gloves latex autoclavable 8 no (pair) made of natural latex micro rough finish for better grip 3059 glucometer strips 1*50 ,consumable 3060 glucose kit (god/pod) 500ml 3061 blood glucose kit (autospan/erba) 3062 glucose pouch(100 gram pack(mfg bhandari products)),consumable 3063 glutaraldehyde solution 2% in 5 litre can (2 strips/vials per each can)(5 litre can),consumable 3064 gram iodine (gram stain) 100ml 3065 haemoglobinometer tube (square pattern) 3066 hbsag 25 test per kit (sd biolab) 3067 hcv kit card test(25 test / kit),digonstic 3068 hdl kit ppt(2x50ml 200 test/kit),consumable 3069 hdl/ldl standard(1x1 ml),consumable 3070 heamoglobin colour scale book with special strip complete(1 x 200),consumable 3071 hematology cell counter reagents as per requirement of cell counter cleaning solution 100 ml 3072 hematology cell counter reagents dilutent (20 ltr) 3073 hematology cell counter reagents lysis solution 500ml(each),solution 3074 hemodialysis powder for bicarb made(part a powder to make 10 ltr + part b 500gm 2/pkt),consumable 3075 hemoglobin color scale (starter kit) components (1) color scale 01/kit (2) test strip 1000/kit (3) printed literature for method of use/kit (4)lancet 1000/kit 3076 hiv elisa kit (hiv micro elisa ag+ab 4th generation )(96 test kit),consumable 3077 hiv kit card (25 test / kit) 3078 hub cutter non electric lockable safety portable box for disposal of hypodemic needles. consumable 3079 icd bag 1000 ml 3080 icd bag, mfg by life o line technologist(1000 ml),bag 3081 indicator sol, for ph (litmus sol) (1x500 ml = 500 ml),consumable 3082 individual ast panel for fungus(ast ys07),each 3083 individual ast panel for gram negative organism(gn n280),each 3084 individual ast panel for gram positive organism(gp p628),each 3085 individual identification panel for aerobic gram negative organism(gnid),each 3086 infant feeding tube(10 g each piece),consumable 3087 infant feeding tube(7g each piece),consumable 3088 infant feeding tube (catheter) size: 3g 3089 infant feeding tube (catheter) size: 4g 3090 infant feeding tube (catheter) size: 5g 3091 infant feeding tube (catheter) size: 8g 3092 infant feeding tube size: 6g 3093 infant mucus extractor sterile pvc(each),surgical material 3094 insulin syringe 40 units/ml iso 8537:2007 3095 intracath cannula for single use (intravascular catheters) bis(gauze 22, length 25),consumable 3096 intravenous set (children) with airway and needle 3097 isopropyl alcohol (propanol)(1 x 2.5 lit),consumable 3098 kellys pad disposable 3099 kellys pad rubber/each 3100 kit for total protein (including albumin and total protein) 100ml bottle 3101 latex based baloon capacity (30 50ml) foleys catheter(size 14 2 way),consumable 3102 latex based baloon capacity (30 50ml) foleys catheter(size 14 3 way),consumable 3103 latex based baloon capacity (30 50ml) foleys catheter(size 18 2 way),consumable 3104 latex based baloon (capacity 30 50 ml) foleys urinary catheter(3 way size 20),consumable 3105 latex based baloon capacity (3 ml) foleys catheter(3 way, size 12),consumable 3106 latex based baloon capacity (3ml) foleys urinary catheter peadiatrics(2 way size 8),consumable 3107 latex based baloon capacity (3ml) foleys urinary catheter peadiatrics(size 10),consumable 3108 latex examination gloves(large),consumable 3109 latex examination gloves(medium),consumable 3110 latex examination gloves(small),consumable 3111 lead letter 0 9 sets (100 clips/pkt) 3112 lead letter a to z set 100 clips per pack 3113 leishman stain 500 ml 3114 lenstip(1 each),consumable 3115 liquid hand wash solution with dispenser consumable(500 ml),consumable 3116 mackintosh double colour water proof rubber marked isi hospital rubber sheeting is:4135 1974 packing and making : as per clause no 4.1 and 4.3 / mtr 3117 malaria antigen card pf/pv card (as per nvbdcp guidelines)( 10 card, 10 dropper, 1 buffer solution) 3118 measure volume(drip set),each 3119 mercuric oxide (25 gm),consumable 3120 methanol (acetone free) for leishman staining (1x2.5 lit ),consumable 3121 methyl blue for (z n) 125 ml bottle 3122 plain plastic tube (small) 3123 plain plastic tube (medium) 3124 plain plastic tube (large) 3125 adhesive bandage strip (band aid type) 3126 micro volume drip set 3127 mva kit (mannual vaccum aspiration kit) 3128 n 95 mask 3129 nasal prong(each),consumable 3130 nebulization mask kit (adult) 3131 nebulization mask kit, mfg by life o line technologist(pediatrics),consumable 3132 nebulization mask kit (pediatrics) 3133 ns 1 elisa dengue kit with 96 wells 3134 nylon suture,macrofilment spatulated, micropoint double armed size 10 0(12 foils/pkt),sutures 3135 nylon suture spatulated micropoint reverse cutting needle, double armed suture size 9 0(12 foils/pkt),sutures 3136 n.r.b.m mask 3137 oxygen mask adult 3138 oxygen mask paediatric (standard size) 3139 oxygen nasal cannula neonatal 3140 oxygen nasal canula (neonatal) 7 white colour tubing and threaded nut 25 pcs/pkt 3141 paper adhesive plaster microporous surgical tape 2 inch x 5m /roll 3142 paper adhesive plaster microporous surgical tape 4 inch x 9 m / roll 3143 paper adhesive plaster microporous surgical tape 6 inch x 5m /roll 3144 platelet dilution fluid (100 ml bottle) 3145 polyamide size 1/0, 12 foils/pkt(3/8 r cutting needle 45 mm, length 70 cm),needle 3146 polyamide size 2/0, 12 foils/pkt(3/8 r cutting needle 45 mm, length 70 cm),needle 3147 polyamide size 8/0, 12 foils/pkt(3/8 cir micro point spatulated 6 mm, length 38 cm),consumable 3148 polyamide with cd r cut extra penetrating needle (12 foils/pkt)(size 4/0),consumable 3149 polyethylene high pressure extension tube, length 200cm 3150 polyglactin 30 mm 1/2 circle round body 90 cm size 1/0(12 foils/ pkt),consumable 3151 polyglactin 40 mm 1/2 circle round body 90 cm size 1 ( 12 foils/ pkt) 3152 polyglycolic acid absorbable surgical suture (12 foils/pkt)(1/2 cir rb needle 20 mm, length 70 cm size 3/0),needle 3153 polyglycolic acid absorbable surgical suture (12 foils/pkt)(1/2 cir rb needle 40 mm, length 90 cm size 2/0),needle 3154 polypropylene size 1, (12 foils/pkt)(1/2 cir rb needle 45 mm, length 90 cm ),needle 3155 polypropylene size 2/0 (12 foils/pkt)(1/2 cir rb needle 25mm, length 45 cm),needle 3156 poly propylene with 1/2 cir rb needle 16 mm length 70 cm size:4/0(12 foils/pkt),consumable 3157 powder developer suitable for processing medical x ray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 13.5 ltr 3158 powder developer suitable for processing medical x ray films. one developer box shall contain part a and part b which are mixed at the time of preparation of solution of specific capacity size: 9.0 ltr 3159 pregnancy test card(10 card pack(mfg oscar medicare pvt ltd)),consumable 3160 pyrethrum extract 2% conforming to no. is 1051 1980 3161 quadraple blood bag 450 ml sagm(each),consumable 3162 ra factor rapid kit 1)should be based on latex agglutination slide test 2)qualitative and semi quantative testing facility possible 3)test speed must be < 2 minutes(25 test/kit (mfg by beacon diagnostic)),consumable 3163 rbc dialuation fluid(mfg precious life care pvt ltd)(500 ml bottle),consumable 3164 reagent for hdl cholestrol test(100 ml (4 x 25)),consumable 3165 rib belt small(mfg by precious life care),each 3166 rpr rapid card test kit (50 test/pkt) 3167 ryles tube (pvc) size : adult: 16 3168 ryles tube (pvc) size : adult(18),tube 3169 ryles tube (pvc) size : children: 10 3170 ryles tube (pvc) size : children : 12 3171 ryles tube(size 14 each piece),consumable 3172 salt testing kit each 3173 seman diluting fluid 100 ml. 3174 serum creatinine(mfg pathogyme diagnostics)(100 ml (2 x 50 ml)),consumable 3175 serum t3 kit, elisa(96 test kit each),consumable 3176 sgot kit (kinetic) 5x20ml 200 test/kit 3177 sgpt(100 ml (4 x 25)),consumable 3178 silver sulphadiazine cream 500gm 3179 single lumen cathater 3180 sulphur powder 500gm pkt 3181 single umbilical catheter with luer lock stopcock fr 2, l 40 cm 3182 single umbilical catheter with luer lock stopcock fr 3, l 40 cm 3183 single umbilical catheter with luer lock stopcock fr 4, l 40 cm 3184 single umbilical catheter with luer lock stopcock fr 5, l 40 cm 3185 size of cassette(10 inch x 12 inch),consumable 3186 size of cassette(14 inch x 17 inch),consumable 3187 size of cassette(8 inch x 10 inch),consumable 3188 size of film 10 inch x 12 inch digital x ray film(dihl(pack of 150)),film 3189 size of film 10 inch x 12 inch(dihl),consumable 3190 size of film 14 inch x 17 inch digital x ray film(dihl (pack of 100)),film 3191 size of film 14 inch x 17 inch(dihl),consumable 3192 size of film 8 inch x 10 inch digital x ray film(dihl(pack of 150)),film 3193 size of film 8 inch x 10 inch(dihl),consumable 3194 skin closure stapler (35 pins high quality medical grade plastic, cartridge with ss rectangular design pins with wire diameter 0.60 mm and size after closure 7.2 x 4.3 mm) 3195 sickel cell test kit (tulip) 3196 spinal (l.p.) needle disposable 24g consumable 3197 spinal (l.p.) needle disposable 26g consumable 3198 spinal needle 24 g each 3199 spinal needle 26 g(each),needle 3200 spinal needle g 22 l 120 mm*0.71/piece 3201 spinal needle(g 22 l 120 mm),consumable 3202 spinal needle g 23 with metal stylet. 3203 spinal needle g 27 l 120 mm*0.40/piece 3204 suction catheter assorted 10 no/each 3205 suction catheter assorted 9 no/each 3206 suction catheter, sterile(size fg 20 (disposable, sterile each)),consumable 3207 suction catheter, sterile(size fg 22 (disposable, sterile each)),consumable 3208 suction catheter, sterile(size fg 6 (disposable, sterile each)),consumable 3209 sugar albumin strip 50 per pack 3210 sulfur powder 500gm 3211 surface and fogging disinfectant stabilised h202,10 11%w/v with diluted silver nitrate sol. 0.01%w/v(5 litre can),each 3212 surgical blade, size 11 3213 surgical blade, size 22 (50/pkt) 3214 surgical blade, size 23 (100/pkt) 3215 suture needles curved 1/2 circle round bodyassorted size 11 15 3216 suture needles curved 1/2 circle round bodyassorted size 1 5 3217 suture needles curved 1/2 circle round bodyassorted size 16 20 3218 swab stick with tube sterile(70 80 mm length 10 15 mm diameter), unit 1(100/pkt (mfg laboratories pvt ltd)),consumable 3219 synethetic absorbable suture 1/0 with 1/2 cir rb needle size: 1/0 length 90cm 3220 synthetic absorbable suture 1 with 1/2 circle taper cut needle (h) size :1 40mm length 90cm polyglycolic acid (pga) (12 foils per pkt) 3221 synthetic absorbable suture 2/0 with 1/2 cir rb needle size:2/0 30mm length 90cm polyglycolic acid (pga) 12 foils / pkt 3222 synthetic absorbable suture 2/0 with 1/2 cir rb needle size:2/0 40mm length 90cm polyglycolic acid (pga) 3223 synthetic absorbable suture 3/0 with 1/2 cir cutting needle size:3/0 36mm length 70cm polyglycolic acid(pga) 3224 synthetic absorbable suture 3/0 with 1/2 cir cutting needle size:3/0 36mm length 70cm polyglycolic acid(pga) 12 foils / pkt 3225 synthetic absorbable suture 3/0 with 1/2 cir rb needle size:3/0 20mm length 70cm polyglycolic acid (pga) 3226 synthetic absorbable suture 3/0 with 1/2 cir rb needle size:3/0,40mm length 90cm polyglycolic acid (pga) 3227 synthetic absorbable suture 3/0 with cd cutting needle size : 3/0 22mm length 45cm polyglycolic acid (pga) (12 foils per pkt) 3228 synthetic absorbable suture 4/0 with 1/2 cir rb needle size:4/0 20mm length 70cm poly glycolic acid (pga) 3229 synthetic absorbable suture 4/0 with 1/2 cir rb needle size:4/0 20mm length 70cm poly glycolic acid (pga)(12 foils/pkt) 3230 synthetic absorbable suture 4/0 with 3/8 cir cutting needle size:4/0 16mm length 45 cm polyglycolic acid (pga) 3231 synthetic absorbable triclosan coated polyglactin 910,size 1, needle 40mm, 1/2 circle round body , 90cm length 3232 synthetic absorbable triclosan coated polyglactin 910, size 1 0,needle 40mm,1/2 circle round body , 90cm length 3233 synthetic absorbable triclosan coated polyglactin 910,size 1, 40mm,1/2 circle reverse cutting os needle , 90cm length 3234 synthetic absorbable triclosan coated polydioxanone,size 1, needle 36.4 mm, 1/2 circle taper point ct 1 90cm 3235 synthetic absorbable triclosan coated polydioxanone, size 1 0, needle 36.4 mm, 1/2 circle taper point 90cm 3236 synthetic absorbable triclosan coated polydioxanone, size 2 0, needle 26mm, 1/2 circle taper point 70cm 3237 synthetic absorbable triclosan coated polydioxanone, size 3 0, needle 17mm, 1/2 circle taper point 70cm 3238 synthetic absorbable triclosan coated poliglecaprone 25, size 2 0, 26 mm, 1/2 circle round body, visiblack jb needle 70cm 3239 synthetic absorbable triclosan coated poliglecaprone 25, size 3 0, 26 mm, 3/8 circle reverse cutting,70cm 3240 test tube 12 x 100 (medicm size) 100/pkt 3241 test tube 12 x 75 (small size) 100/pkt(12 x 75 (small size) 100/pkt),tube 3242 test tube 15x125/1*100/pkt 3243 test tube medium (12x100) 100eack/pkt(each),consumable 3244 three layer surgical mask 100 per pack 3245 three way stop cock consumable 3246 tips for auto pipettes 200 to 1000 micro litres 500/pkt(200 to 1000 micro litres 500/pkt),each 3247 tips for auto pipettes 2 to 100 micro litres 1000/pkt(2 to 100 micro litres 1000/pkt),each 3248 tips for auto pippetes 10 to 100 micro litres 1*100/pkt 3249 tissue paper roll(each),consumable 3250 total protein 100 ml bottle 3251 total protein lysozyme 1x50 ml 3252 total protein (mfg by beacon diagnostic)(100 ml),consumable 3253 tourniquet with belt (good quality pairs), pairs 3254 transfer bag(each),consumable 3255 triglyceride 600 ml(model ba 400 system (mfg bybio system)),consumable 3256 triglyceride kit enzymet 5x20ml 200test/kit 3257 serum trigyceride (autospan/erba) 3258 trisodium citrate 3.8% (500 ml bottle) 3259 triway cannula (3 way stop cock) 3260 typhoid card test kit (for igg and igm antibody detection) (25 test kit) 3261 umbical cord clamps plastic material(box of 100 clamps),consumable 3262 urea(brethelot)3x100ml lyphozyme 2x10ml 3263 urea kit berthelot 50 test/kit 3264 urinary drainage bag 2 litre cap with non return valve (eo sterile) 3265 urinary drainage bag (paediatric)(100 ml / pc),consumable 3266 urine container 5ml disposable (50 per pkt) 3267 usg thermal paper each 3268 variable auto pippets 10 to 100 micro litres 3269 variable auto pippets 20 to 200 micro litres 3270 variable auto pippets 100 to 1000 micro litres 3271 variable auto pippets 0.5 to 50 micro litres 3272 vdrl kit (strip)(50 test/kit),consumable 3273 vtm hi media with 2 swab : (for swine flu) vtm standard kit(3ml vial with 2 regular swabs) 3274 wbc diluting fluid 500ml 3275 widal test kit rapid 3276 x ray cassets(6.5x8.5),consumable 3277 x ray cassets(8x10),consumable 3278 x ray film 10 x 12 50 sheets/pack 3279 x ray film 12 x 12 50 sheets/pack 3280 x ray film 12 x 15 50 sheets/pack 3281 x ray film 14 x 14 50 sheets/pack 3282 x ray film 14 x 17 50 sheets/pack 3283 x ray film 6.5 x 8.5 50 sheets/pack 3284 x ray film 8 x 10 50 sheets/pack 3285 x ray film fixer(powder to make 13.5 liters pkt),consumable 3286 x ray film fixer(powder to make 9 liters pkt),consumable 3287 x ray hangers(10x12),consumable 3288 x ray hangers(12x15),consumable 3289 x ray hangers(6.5x8.5),consumable 3290 x ray hangers(8x10),consumable 3291 xylene (sulphur free)(1 x 2.5 lit),consumable 3292 absorable surgical suture rb needle size no 1 0,30 mm length 70 cm , 12 foils per packet , polyglycolic acid (pga) 3293 ambu bag (250 ml) 3294 b.b silk (12 foils/pkt)(3/8 rcut needle 45 mm length 76 cm, size 2/0)),consumable 3295 b.b silk with 1/2 cir rb needle size:1/0 20 mm length 75 cm non absorbable surgical sutures usp surgical material 3296 b.b silk with 1/2 cir rb/cutting needle 30 mm length 75 cm non absorbable(size 2 0, 12 foils/pkt),consumable 3297 biomedical waste collection plastic bag(yellow)(as per attached detail specifications)(450x450 mm 55 micron 100/pkt),consumable 3298 biomedical waste collection plstic bag(black 750 x 900 mm 55 micron 100/pkt),bag 3299 biomedical waste collection plastic bag(black 900 x 900 mm 55 micron 100/pkt),bag 3300 biomedical waste collection plstic bag(blue 750 x 900 mm 55 micron 100/pkt),bag 3301 biomedical waste collection plstic bag(blue 900 x 900 mm 55 micron 100/pkt),bag 3302 biomedical waste collection plstic bag(red 750 x 900 mm 55 micron 100/pkt),bag 3303 biomedical waste collection plstic bag(red 900 x 900 mm 55 micron 100/pkt),bag 3304 biomedical waste collection plstic bag(yellow 750 x 900 mm 55 micron 100/pkt),bag 3305 biomedical waste collection plstic bag(yellow 900 x 900 mm 55 micron 100/pkt),bag 3306 bleaching powder gr ii is 1065/1989 with upto date amendment packed in 25 kg hdpe bags isi marked stable consumable 3307 blood administrations set 3308 blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag (hll) single 3309 blood bag with acd/cpd solution (disposable sterilised) with needle(350 ml),bag (hll) double 3310 blood grouping anti sera a monoclonal(10 ml vial (mfg tulip diagnostics)),consumable 3311 blood grouping anti sera b monoclonal(10 ml vial (mfg tulip diagnostics)),consumable 3312 blood grouping anti sera d monoclonal(10 ml vial (mfg tulip diagnostics)),consumable 3313 blood sugar kit 500ml 3314 c b c paper roll 56’’ 3315 c.p.d.a.blood bag 350 ml consumable 3316 chromic size 1/0 (12 foils/pkt)(3/8 cir rb needle 40 mm, suture length 76 cm),needle 3317 cotton thread 10 no. each 3318 diagnostic strips for urine sugar/albmin packing: 100 strip/pkt 3319 disposable needles 23 no 3320 disposable syringe 5 ml 3321 ecg jelly 250 gms 3322 hbs antigeng kit card(pack of 10 card test with 10 dropper, 1 buffer solution, 10 pricking lancet and 10 alcohol swab),digonstic 3323 i v cannula with inj.valve (port)(size 26g each),consumable 3324 i.v cannula with injection valve size : 18g 3325 i.v. cannula with injection valve 20g 3326 intravenous set with airway and needle((adult)),surgical material 3327 iv cannula (two way) size 20 3328 iv cannula (two way) size 22 3329 iv cannula (two way) size 24 3330 iv cannula size 26g 3331 phenyl as per schedule o (grade 1) 10 lt jar(isi marked),consumable 3332 pop bandage(4 inch),consumable 3333 pop bandage(6 inch),consumable 3334 a.v fistula needle 16 no 3335 plaster of paris bandage 10 cm x 2.7 mtr / roll 3336 plaster of paris bandage 15cm x 2.7mtr / roll 3337 plaster of paris bandage bp 10 cm x 2.7 mtr / roll 3338 100% silicone 2 way foley balloon cathetersize 8 fr & 10 frpoly bagcartoon 3339 100% silicone 2 way foley balloon cathetersize 12 fr to 24 frpoly bagcartoon 3340 2 way female foley balloon catheter(paper pack)size 12 fr to 24 frpoly bagcartoon 3341 2 way foley balloon catheter (paper pack)pediatric size 6 frinner boxcartoon 3342 2 way foley balloon catheter (paper pack)pediatric size 6 frpoly bagcartoon 3343 2 way foley balloon catheter (paper pack)pediatric size:8 fr to 10 frpoly bagcartoon 3344 2 way foley balloon catheter (paper pack)pediatric size:8 fr to 10frinner boxcartoon 3345 2 way foley balloon catheter (paper pack)size: 12 fr to 18 fr.poly bagcartoon 3346 2 way foley balloon catheter (paper pack)size: 12 fr to 18 frinner boxcartoon 3347 2 way foley balloon catheter (paper pack)size: 20 fr to 24 fr.poly bagcartoon 3348 2 way foley balloon catheter (paper pack)size: 20 fr to 24 frinner boxcartoon 3349 3 ball spirometer 3350 3 way stop cock(paper pack)poly bagbora pack 3351 3 way foley balloon catheter (paper pack)size 12 fr to 22 frinner boxcartoon 3352 3 way foley balloon catheter (paper pack)size 12 fr to 22 frpoly bagcartoon 3353 abdominal belt (box pack)size – 2xl, 3xl 3354 abdominal belt (box pack)size – s,m,l,xl 3355 abdominal corset elastic(box pack)size – s,m,l,xl 3356 abdominal darinage kitsize –fg 28, 30, 32, 34,36,packed in paper pouch 3357 abdominal darinage kitsize –fg 12,14,16, 18,20, 22, 24,26packed in paper pouch 3358 absorbent cotton wool i.p100 gms 3359 absorbent cotton wool i.p20 gms 3360 absorbent cotton wool i.p200 gms 3361 absorbent cotton wool i.p400 gms 3362 absorbent cotton wool i.p50 gms 3363 absorbent cotton wool i.p500 gms 3364 adhesive tapesize –10cm x 5mts 3365 adhesive tapesize –2.5cm x 5mts 3366 adhesive tapesize –5cm x 5mts 3367 adhesive tapesize –7.5cm x 5mts 3368 air cushion masksize: 2 3369 air cushion masksize: 3 3370 air cushion masksize: 4 3371 air cushion masksize: 5 3372 air cushion masksize: 6 3373 air cushion masksize: 7 3374 alcohol swabdisposable 3375 ambu bag adult (silicon resuscitator) 3376 ambu bag child (silicon resuscitator) 3377 ambu bag neonatal (silicon resuscitator) 3378 ankle binder (box pack)size – universal 3379 ankle bracesize – l 3380 ankle bracesize – m 3381 ankle bracesize – s 3382 ankle bracesize – xl 3383 ankle support(anklet) pair size – l 3384 ankle support(anklet) pair size – m 3385 ankle support(anklet) pair size – s 3386 ankle support(anklet) pair size – xl 3387 ankle traction (box pack)size – l 3388 ankle traction (box pack)size – m 3389 ankle traction (box pack)size – s 3390 ankle traction (box pack)size – xl 3391 arm ‘o’ elbow drape 3392 arm ‘u’ shoulder(‘u’ drape) 3393 bains circuit child (poly pack) 3394 bains circuit with heindbrink valve(poly pack) adult 3395 bed pan (poly pack)male /femalecartoon 3396 bipap mask(cpap mask/ full face mask)poly carbonate materialvented or non ventedsize: medium 3397 bipap mask(cpap mask/ full face mask)poly carbonate materialvented or non ventedsize: small 3398 bipap mask(cpap mask/ full face mask)poly carbonate materialvented or non ventedsize:large 3399 blood administration set15 mm single chamber, 18’’g vein needle, tube dia.:2.70 mm, 50 mm latex tube 3400 blood administration set15 mm single chamber, 18’’g vein needle, tube dia.:2.80 mm, 42 mm bulb latex 3401 blood administration set15 mm single chamber, 18’’g vein needle, tube dia.:2.90 mm, 45 mm bulb latex 3402 blood administration set17 mm double chamber with blood filter, 18’’g vein needle, tube dia.:3.20mm, 3403 blood lancetdisposable 3404 breathing filter 3405 bvf hme filter 3406 canula fixer(paper pack) size medium 3407 cast shoessize – l 3408 cast shoessize – m 3409 cast shoessize – s 3410 cast shoessize – xl 3411 cast shoessize –xxl 3412 catheter mount expandable(paper pack) 3413 catheter mount standard(paper pack) 3414 cervical collar soft (box pack)size – l 3415 cervical collar soft (box pack)size – m 3416 cervical collar soft (box pack)size – s 3417 cervical collar soft with button (box pack)size – l 3418 cervical collar soft with button (box pack)size – m 3419 cervical collar soft with button (box pack)size – s 3420 cervical pillowsize universal 3421 ceserian drape 3422 chest belt(sternal support)size – 2xl 3423 chest belt(sternal support)size – 3xl 3424 chest belt(sternal support)size – l 3425 chest belt(sternal support)size – m 3426 chest belt(sternal support)size – s 3427 chest belt(sternal support)size – xl 3428 chest drainage cathetersize fg 10 3429 chest drainage cathetersize fg 12 3430 chest drainage cathetersize fg 14 3431 chest drainage cathetersize fg 16 3432 chest drainage cathetersize fg 18 3433 chest drainage cathetersize fg 20 3434 chest drainage cathetersize fg 22 3435 chest drainage cathetersize fg 24 3436 chest drainage cathetersize fg 26 3437 chest drainage cathetersize fg 28 3438 chest drainage cathetersize fg 30 3439 chest drainage cathetersize fg 32 3440 chest drainage cathetersize fg 34 3441 chest drainage cathetersize fg 36 3442 citrate tube pet tube 3443 citrate tube pet tubesafety cap 3444 clavicle brace (box pack)size – l 3445 clavicle brace (box pack)size – m 3446 clavicle brace (box pack)size – s 3447 clavicle brace (box pack)size – xl 3448 close wound suction unit adult 400 mlsize:fg 10 3449 close wound suction unit adult 400 mlsize:fg 12 3450 close wound suction unit adult 400 mlsize:fg 14 3451 close wound suction unit adult 400 mlsize:fg 16 3452 close wound suction unit adult 400 mlsize:fg 18 3453 close wound suction unit adult 400 mlsize:fg 20 3454 close wound suction unit adult 800 mlsize:fg 10 3455 close wound suction unit adult 800 mlsize:fg 12 3456 close wound suction unit adult 800 mlsize:fg 14 3457 close wound suction unit adult 800 mlsize:fg 16 3458 close wound suction unit adult 800 mlsize:fg 18 3459 close wound suction unit adult 800 mlsize:fg 20 3460 close wound suction unit child 80 mlsize: fg 6 3461 close wound suction unit child 80 mlsize: fg 8 3462 clot activator 1 ml tube pediatrics tuberubber stopper 3463 clot activator 4 ml tuberubber stopper 3464 clot activator 4 ml tubesafety cap 3465 clot activator 4ml tube 3466 combine dressing – strilesize – 10cm*10cm 3467 combine dressing – strilesize –10cm*20cm 3468 contoured lumbar sacral belt – twill elasticsize – l 3469 contoured lumbar sacral belt – twill elasticsize – m 3470 contoured lumbar sacral belt – twill elasticsize – s 3471 contoured lumbar sacral belt – twill elasticsize – xl 3472 contoured lumbar sacral belt(poly pack)size – 2xl 3473 contoured lumbar sacral belt(poly pack)size – 3xl 3474 contoured lumbar sacral belt(poly pack)size – l 3475 contoured lumbar sacral belt(poly pack)size – m 3476 contoured lumbar sacral belt(poly pack)size – s 3477 contoured lumbar sacral belt(poly pack)size – xl 3478 cord clamp(blister pack) 3479 cord clamp(paper pack and 100 pcs box) 3480 cord clamp(paper pack) 3481 cord clamp(poly pack) 3482 corrugated drainage sheet 3483 cotton crepe bandage (delux)size –10cm x 4mtspacked in pvc container 3484 cotton crepe bandage (delux)size –15cm x 4mtspacked in pvc container 3485 cotton crepe bandage (delux)size –6cm x 4mtspacked in pvc container 3486 cotton crepe bandage (delux)size –8cm x 4mtspacked in pvc container 3487 cotton crepe bandage (premium)size –10cm x 4mtspacked in pvc container 3488 cotton crepe bandage (premium)size –15cm x 4mtspacked in pvc container 3489 cotton crepe bandage (premium)size –6cm x 4mtspacked in pvc container 3490 cotton crepe bandage (premium)size –8cm x 4mtspacked in pvc container 3491 dehp free infusion set vented molded in built airvent(ribbon pack)vented drip chamber 16 mm : 21’’g needle kink resistant tube dia.:3.00mm length 1500mm. y injection port and luer lock 3492 dehp free infusion set non vented (ribbon pack)molded drip chamber 16 mm : 21’’g needle kink resistant tube dia.:3.00mm length 1500mm. y injection port and luer lock 3493 disposable apronld 3494 disposable apronplastic 3495 disposable bad sheet ld blue120x210 3496 disposable bad sheet ld bluesize: 100x120 3497 disposable bouffant cap size: 16” 3498 disposable bouffant cap size: 18” 3499 disposable bouffant cap size: 21” 3500 disposable helmet hoodfor joint replacement orthopacked in paper pouch 3501 disposable mask3 ply ( elastic ) 3502 disposable mask3 ply tie on 3503 disposable surgeon cap 3504 dorsolumbar brace short/ long(poly pack)size – spl ( 44” ) 3505 dorsolumbar brace short/ long(poly pack)size – spl ( 52” ) 3506 dorsolumbar brace short/ long(poly pack)size – universal ( 28” ) 3507 dorsolumbar brace short/ long(poly pack)size – universal ( 44” ) 3508 double water trap ventilator(poly pack) adult 3509 double water trap ventilator(poly pack) child 3510 dynamic cock up splint(poly pack)size – l 3511 dynamic cock up splint(poly pack)size – m 3512 dynamic cock up splint(poly pack)size – s 3513 dynamic cock up splint(poly pack)size – xl 3514 elastic adhesive bandagesize – 10cm x 4/6mtspacked in pvc tin 3515 elastic adhesive bandagesize – 15 cm x 4/6 mtspacked in pvc tin 3516 elastic adhesive bandagesize – 6cm x 4/6 mtspacked in pvc tin 3517 elastic adhesive bandagesize – 7.5 cm x 4.5 /6 mtspacked in pvc tin 3518 elastic adhesive bandagesize – 8cm x 4/6mtspacked in pvc tin 3519 elastic knee supportsize – 3xl 3520 elastic knee supportsize – l 3521 elastic knee supportsize – m 3522 elastic knee supportsize – s 3523 elastic knee supportsize – xl 3524 elastic knee supportsize –2xl 3525 elastics shoulder immobilizer (box pack)size – l 3526 elastics shoulder immobilizer (box pack)size – m 3527 elastics shoulder immobilizer (box pack)size – s 3528 elastics shoulder immobilizer (box pack)size – xl 3529 elbow supportsize – l 3530 elbow supportsize – m 3531 elbow supportsize – s 3532 elbow supportsize – xl 3533 endotracheal tube[cuffed]size – 2.5, 3, 3.5, 4sterile / disposable 3534 endotracheal tube[cuffed]size – 4.5 to 9sterile / disposable 3535 endotracheal tube[plain]size – 2, 2.5, 3, 3.5, 4.sterile / disposable 3536 endotracheal tube[plain]size – 4.5 to 9.sterile / disposable 3537 esr tube pet tube 3538 esr tube pet tubesafety cap 3539 ethyl vinyl acetate gloves malaysian imported/100 pcs box,size: ex large. 3540 ethyl vinyl acetate gloves malaysian imported/100 pcs box,size: large 3541 ethyl vinyl acetate gloves malaysian imported/100 pcs box,size: small 3542 ethyl vinyl acetate gloves malaysian imported/100 pcs box,size:medium 3543 examination gloves latexmalaysian imported /5 gms /100 pcs boxsize ex large. 3544 examination gloves latexmalaysian imported /5 gms /100 pcs boxsize large 3545 examination gloves latexmalaysian imported /5 gms /100 pcs boxsize medium 3546 examination gloves latexmalaysian imported /5 gms /100 pcs boxsize small 3547 examination gloves nitrilemalaysian imported / 100 pcs box,size ex large. 3548 examination gloves nitrilemalaysian imported / 100 pcs box,size large 3549 examination gloves nitrilemalaysian imported / 100 pcs box,size medium 3550 examination gloves nitrilemalaysian imported / 100 pcs box,size small 3551 examination gloves plasticplastic gloves disposable(orange) 32”, 100gsm 3552 examination gloves plasticplastic gloves disposable12”, 35gsm 3553 examination gloves plasticplastic gloves disposable12”, 45gsm 3554 examination gloves plasticplastic gloves disposable14”, 50gsm 3555 extension line with3 way stopsize: 10 cms.packed in paper pouch packpoly bagcartoon 3556 extension line with3 way stopsize: 100 cms.packed in paper pouch packpoly bagcartoon 3557 extension line with3 way stopsize: 150 cms.packed in paper pouch packpoly bagcartoon 3558 extension line with3 way stopsize: 200 cms.packed in paper pouch packpoly bagcartoon 3559 extension line with3 way stopsize: 25 cms.packed in paper pouch packpoly bagcartoon 3560 extension line with3 way stopsize: 250 cms.packed in paper pouch packpoly bagcartoon 3561 extension line with3 way stopsize: 50 cms.packed in paper pouch packpoly bagcartoon 3562 eye drapewith attached drain pouch and eyelid holders 3563 eye patch 3564 finger cotsize – l 3565 finger cotsize – m 3566 finger cotsize – s 3567 fluoride 2 ml tuberubber stopper 3568 fluoride 2 ml tubesafety cap 3569 fluoride 2ml tube micro spray coating 3570 foot drop splint(poly pack) ( left/right )size – l 3571 foot drop splint(poly pack) ( left/right )size – m 3572 foot drop splint(poly pack) ( left/right )size – s 3573 frog splintsize – l 3574 frog splintsize – m 3575 frog splintsize – s 3576 fully gynec drape 3577 gamjee rollsize – 10cm*3 meters 3578 gamjee rollsize – 15cm*3 meters 3579 gibbon’s cathetersize –10 3580 gibbon’s cathetersize –12 3581 gibbon’s cathetersize –14 3582 gibbon’s cathetersize –16 3583 gibbon’s cathetersize –18 3584 gibbon’s cathetersize –20 3585 gibbon’s cathetersize –22 3586 guedel airway(paper pack)size 0 3587 guedel airway(paper pack)size 00 3588 guedel airway(paper pack)size 000 3589 guedel airway(paper pack)size 1 3590 guedel airway(paper pack)size 2 3591 guedel airway(paper pack)size 3 3592 guedel airway(paper pack)size 4 3593 guedel airway(paper pack)size 5 3594 hard cervical collar (poly pack)size – l 3595 hard cervical collar (poly pack)size – m 3596 hard cervical collar (poly pack)size – s 3597 hernia beltsize – l 3598 hernia beltsize – m 3599 hernia beltsize – s 3600 hernia beltsize – xl 3601 hernia beltsize –xxl 3602 high concentration mask [reservior bag with oxygen mask]size adult 3603 high concentration mask [reservior bag with oxygen mask]size pediatric 3604 high pressure monitoring linesize: 10 cms.packed in paper pouch packpoly bagcartoon 3605 high pressure monitoring linesize: 100cms.packed in paper pouch packpoly bagcartoon 3606 high pressure monitoring linesize: 150 cms.packed in paper pouch packpoly bagcartoon 3607 high pressure monitoring linesize: 200 cms.packed in paper pouch packpoly bagcartoon 3608 high pressure monitoring linesize: 25 cms.packed in paper pouch packpoly bagcartoon 3609 high pressure monitoring linesize: 250 cms.packed in paper pouch packpoly bagcartoon 3610 high pressure monitoring linesize: 50 cms.packed in paper pouch packpoly bagcartoon 3611 hip ‘u’ drape 3612 hiv protection kit (premium)gown, mask, cap, shoe cover, gloves, goggles, apron, waste carry bag, bed sheet 3613 hiv protection kitgown, mask, cap, shoe cover, gloves, goggles. 3614 hme filter(paper pack)size – adult 3615 hme filter(paper pack)size – pediatric 3616 hood cap 3617 i.v.flow regulator set 3618 infant feeding tube(paper pack)disposable sterile size 10 3619 infant feeding tube(paper pack)disposable sterile size 5 3620 infant feeding tube(paper pack)disposable sterile size 6 3621 infant feeding tube(paper pack)disposable sterile size 7 3622 infant feeding tube(paper pack)disposable sterile size 8 3623 infant feeding tube(paper pack)disposable sterile size 9 3624 infant mucus extracter(paper pack) 3625 infant mucus extracter(poly pack) 3626 infusion set regularmolded drip chamber 13.5 mm: 21’’g needle kink resistant tube dia.:2.70 mm length 1500 mm. 42mm tube latex. 3627 infusion set vented molded in built airvent(paper pack)vented drip chamber 15mm : kink resistant tube dia.: 2.90 mm length 1500 mm, “y” connector with luer lock 3628 infusion set vented molded in built airvent(ribbon pack)vented drip chamber 16 mm : 21’’g needle kink resistant tube dia.:3.00mm length 1500mm, y injection port and luer lock 3629 infusion set vented molded in built airvent(ribbon pack)vented drip chamber 16 mm : 21’’g needle kink resistant tube dia.:3.00mm length 1500mm. 48 mm bulb 3630 infusion set vented molded in built airventvented drip chamber 15mm : kink resistant tube dia.: 2.90 mm length 1500 mm, “y” connector with luer lock 3631 infusion set(paper pack)molded drip chamber 14 mm : 21’’g needle kink resistant tube dia.:2.70 mm length 1500 mm. 50 mm latex tube 3632 infusion set(paper pack)molded drip chamber 14 mm : 21’’g needle kink resistant tube dia.:2.80 mm length 1500 mm. 42 mm bulb latex 3633 infusion set(paper pack)vented drip chamber 15 mm : 21’’g needle kink resistant tube dia.: 2.90 mm length 1500 mm. 45 mm bulb 3634 infusion setmolded drip chamber 14 mm : 21’’g needle kink resistant tube dia.:2.70 mm length 1500 mm. 46 mm latex tube 3635 infusion setmolded drip chamber 15 mm : 21’’g needle kink resistant tube dia.:2.80 mm length 1500 mm. 42 mm bulb latex 3636 infusion set non vented (ribbon pack)molded drip chamber 16 mm : 21’’g needle kink resistant tube dia.:3.00 mm length 1500 mm. 47 mm bulb 3637 infusion setsafety type chamber(paper pack)molded drip chamber 14.6 mm : 21’’g needle kink resistant tube dia.:2.80 mm length 1500 mm. 42 mm bulb latex 3638 infusion setsafety type chambermolded drip chamber 14.6 mm : 21’’g needle kink resistant tube dia.:2.80 mm length 1500 mm. 42 mm bulb latex 3639 infusion setvented drip chamber 15 mm : 21’’g needle kink resistant tube dia.: 2.90 mm length 1500 mm. 43 mm bulb 3640 intravenous cannulasize – 14,26packed in blister pack 3641 intravenous cannulasize –16,24packed in blister pack 3642 intravenous cannulasize –18,20,22packed in blister pack 3643 jackson rees circuit 3644 k2 edta 2 ml tube micro spray coatingrubber stopper 3645 k2 edta 2 ml tube micro spray coatingsafety cap 3646 k2 edta 2ml tube micro spray coating 3647 k3 edta 1 ml tube pediatrics tuberubber stopper 3648 k3 edta 2 ml tube micro spray coatingrubber stopper 3649 k3 edta 2 ml tube micro spray coatingsafety cap 3650 k3 edta 2ml / 3ml tube micro spray coating 3651 k3 edta 3 ml tube micro spray coatingrubber stopper 3652 k3 edta 3 ml tube micro spray coatingsafety cap 3653 karman type cannulasize – 10mm 3654 karman type cannulasize – 12mm 3655 karman type cannulasize – 4mm 3656 karman type cannulasize – 6mm 3657 karman type cannulasize – 8mm 3658 knee ‘o’ drape 3659 knee brace regularsize l 3660 knee brace regularsize m 3661 knee brace regularsize s 3662 knee brace regularsize xl 3663 knee brace regularsize –xxl 3664 knee cap with open patella single pcssize – l 3665 knee cap with open patella single pcssize – m 3666 knee cap with open patella single pcssize – s 3667 knee cap with open patella single pcssize – xl 3668 knee cap with open patella single pcssize –xxl 3669 knee cap with rigid hinge size – l 3670 knee cap with rigid hinge size – m 3671 knee cap with rigid hinge size – s 3672 knee cap with rigid hinge size – size –xxl 3673 knee cap with rigid hinge size – xl 3674 knee cap ( pair ) (box pack)size – l 3675 knee cap ( pair ) (box pack)size – m 3676 knee cap ( pair ) (box pack)size – s 3677 knee cap ( pair ) (box pack)size – xl 3678 knee cap ( pair ) (box pack)size – xxl 3679 knee immobilizer extra large 22”size – l 3680 knee immobilizer extra large 22”size – m 3681 knee immobilizer extra large 22”size – s 3682 knee immobilizer extra large 22”size – xl 3683 knee immobilizer extra large 22”size –xxl 3684 knee immobilizer long 19”size – l 3685 knee immobilizer long 19”size – m 3686 knee immobilizer long 19”size – s 3687 knee immobilizer long 19”size – xl 3688 knee immobilizer long 19”size –xxl 3689 knee immobilizer short 14”size – l 3690 knee immobilizer short 14”size – m 3691 knee immobilizer short 14”size – s 3692 knee immobilizer short 14”size – xl 3693 knee immobilizer short 14”size –xxl 3694 knee wrap hinged (neoprene)size – l 3695 knee wrap hinged (neoprene)size – m 3696 knee wrap hinged (neoprene)size – s 3697 knee wrap hinged (neoprene)size – xl 3698 knee wrap hinged (neoprene)size –2xl 3699 knee wrap hinged (neoprene)size –3xl 3700 l.s.belt – pressure platesize – 2xl 3701 l.s.belt – pressure platesize – 3xl 3702 l.s.belt – pressure platesize – l 3703 l.s.belt – pressure platesize – m 3704 l.s.belt – pressure platesize – s 3705 l.s.belt – pressure platesize – xl 3706 laryngeal mask airwaysize: 1 3707 laryngeal mask airwaysize: 1.5 3708 laryngeal mask airwaysize: 2.5 3709 laryngeal mask airwaysize: 3 3710 laryngeal mask airwaysize: 4 3711 leg traction bracesize – l 3712 leg traction bracesize – m 3713 leg traction bracesize – s 3714 leg traction bracesize – xl 3715 levin’s tube(paper pack)size –10 3716 levin’s tube(paper pack)size –12 3717 levin’s tube(paper pack)size –14 3718 levin’s tube(paper pack)size –16 3719 levin’s tube(paper pack)size –18 3720 levin’s tube(paper pack)size –20 3721 levin’s tube(paper pack)size –22 3722 levin’s tube(paper pack)size –8 3723 lithium heparin 2 mlrubber stopper 3724 lithium heparin 2 mlsafety cap 3725 lithium heparine 2ml micro spray coating 3726 lumbo sacral belt (box pack)size – 2xl 3727 lumbo sacral belt (box pack)size – 3xl 3728 lumbo sacral belt (box pack)size – l 3729 lumbo sacral belt (box pack)size – m 3730 lumbo sacral belt (box pack)size – s 3731 lumbo sacral belt (box pack)size – xl 3732 male external cathetersize ex large 3733 male external cathetersize large 3734 male external cathetersize medium 3735 male external cathetersize small 3736 mallet finger splint(box pack)size – l 3737 mallet finger splint(box pack)size – s 3738 maternity beltsize universal 3739 measured volume setcylindrical measured volume chamber of 110 ml. 42 mm bulb latex tubepacked in paper pack 3740 measured volume setcylindrical measured volume chamber of 110 ml. 42 mm bulb latex tubepacked in paper pack 3741 measured volume setcylindrical measured volume chamber of 110 ml. 50 mm latex tube packed in paper pack 3742 measured volume setcylindrical measured volume chamber of 150 ml. 45 mm bulb latex tubepacked in paper pack 3743 measured volume setcylindrical measured volume chamber of 150 ml. 45 mm bulb latex tubepacked in paper pack 3744 micro drip infusion setmicro drip chamber 15 mm : 23’’g, kink free tube dia.:2.80 mmmicro drip chamber 15 mm : 23’’g, kink free tube dia.:2.80 mmlength 1500 mm 42 mm bulb 3745 micro drip with airvent infusion setvented micro drip chamber 15 mm : 23’’g needle, kink free tube dia.:3.00 mm length 1500 mm 45 mm bulb 3746 microporous surgical paper tapesize – 2.50 cm x 9.1 mtr 3747 microporous surgical paper tapesize – 5.00 cm x 9.1 mtr 3748 microporous surgical paper tapesize – 7.50 cm x 9.1 mtr 3749 microporous surgical paper tapesize –1.25 cm x 9.1 mtr 3750 microscope slide (pkt. of 50 slides ) 3751 mount pcs(nebuliser)component 3752 n 95 face maskwith valve 3753 n 95 face maskwithout valve 3754 nasal canula[nasal prong] (poly pack)adult, pediatric, neonatal 3755 nasal canula[nasal prong] (poly pack)size 10 mtr adult, pediatric, neonatal 3756 nasal canula[nasal prong] (poly pack)size 2 mtr adult, pediatric, neonatal 3757 nasal canula[nasal prong] (poly pack)size 22 mtr adult, pediatric, neonatal 3758 nasal canula[nasal prong] (poly pack)size 5 mtr adult, pediatric, neonatal 3759 nasopharyngeal airwaysize: 6 3760 nasopharyngeal airwaysize: 7 3761 nasopharyngeal airwaysize: 8 3762 nebulizer kitadult & pediatric 3763 nebulizer with t pcs 3764 nelton cathetersize: 8 fg to 24 fgpacked in paper pouch packinner boxcartoon 3765 nelton cathetersize: 8 fg to 24 fgpacked in paper pouch packpoly bagcartoon 3766 orthopedic bandagesize – 10cm*3 meters 3767 orthopedic bandagesize –15cm*3meters 3768 oxyzen maskadult & pediatric 3769 pedia urine bagcapacity 100mlpoly bagbora pack 3770 pelvic binder(poly pack)size – l 3771 pelvic binder(poly pack)size – m 3772 pelvic binder(poly pack)size – s 3773 pelvic binder(poly pack)size – xl 3774 philadelphia collar( cervical orthosis )size – l 3775 philadelphia collar( cervical orthosis )size – m 3776 philadelphia collar( cervical orthosis )size – s 3777 plain ventilator circuit [plain breathing system](poly pack)size adult & pediatric 3778 plaster ofparis bandage(pop)size – 10cm*2.7 meters 3779 plaster ofparis bandage(pop)size –15cm*2.7meters 3780 rebreathing bag (reservior bag)size (ltr) –0.5 3781 rebreathing bag (reservior bag)size (ltr) –1.0 3782 rebreathing bag (reservior bag)size (ltr) –1.5 3783 rebreathing bag (reservior bag)size (ltr) –2 3784 rectal cathetersize – 10 3785 rectal cathetersize – 12 3786 rectal cathetersize – 14 3787 rectal cathetersize – 16 3788 rectal cathetersize – 18 3789 rectal cathetersize – 20 3790 rectal cathetersize – 22 3791 rectal cathetersize – 24 3792 rectal cathetersize – 26 3793 rectal cathetersize – 28 3794 rectal cathetersize – 30 3795 rectal cathetersize – 6 3796 rectal cathetersize – 8 3797 rib belt regular (box pack)size – universal 3798 rib belt with pad (box pack)size – 2xl 3799 rib belt with pad (box pack)size – 3xl 3800 rib belt with pad (box pack)size – l 3801 rib belt with pad (box pack)size – m 3802 rib belt with pad (box pack)size – s 3803 rib belt with pad (box pack)size – xl 3804 roller bandagesize –10cm x 3mtr10 roll packetper roll 3805 roller bandagesize –10cm x 8 mtr10 roll packetper roll 3806 roller bandagesize –15cm x 3mtr10 roll packetper roll 3807 roller bandagesize –15cm x 8mtr10 roll packetper roll 3808 roller bandagesize –5cm x 3mtr10 roll packetper roll 3809 roller bandagesize –5cm x 8 mtr10 roll packetper roll 3810 roller bandagesize –7.5cm x 3mtr10 roll packetper roll 3811 roller bandagesize –7.5cm x 8 mtr10 roll packetper roll 3812 ryle’s tube (paper pack)sizesterile / disposable – size 10 3813 ryle’s tube (paper pack)sizesterile / disposable – size 12 3814 ryle’s tube (paper pack)sizesterile / disposable – size 14 3815 ryle’s tube (paper pack)sizesterile / disposable – size 16 3816 ryle’s tube (paper pack)sizesterile / disposable – size 18 3817 ryle’s tube (paper pack)sizesterile / disposable – size 20 3818 ryle’s tube (paper pack)sizesterile / disposable – size 22 3819 ryle’s tube (paper pack)sizesterile / disposable – size 24 3820 ryle’s tube (paper pack)sizesterile / disposable – size 8 3821 ryle’s tube with clouser (paper pack)sterile / disposablesize – 10 3822 ryle’s tube with clouser (paper pack)sterile / disposablesize – 12 3823 ryle’s tube with clouser (paper pack)sterile / disposablesize – 14 3824 ryle’s tube with clouser (paper pack)sterile / disposablesize – 16 3825 ryle’s tube with clouser (paper pack)sterile / disposablesize – 18 3826 ryle’s tube with clouser (paper pack)sterile / disposablesize – 20 3827 ryle’s tube with clouser (paper pack)sterile / disposablesize – 22 3828 ryle’s tube with clouser (paper pack)sterile / disposablesize – 24 3829 ryle’s tube with clouser (paper pack)sterile / disposablesize – 8 3830 scalp vein setsiliconized and thin walled high quality needle for a traumatic insertion.packed in poly pouch 3831 scalp vein setsiliconized and thin walled high quality needle insertion for atraumatic.packed in blister pack 3832 serum 4 ml tuberubber stopper 3833 serum 4 ml tubesafety cap 3834 serum 4ml tube 3835 shoe coverld blue (pair) 3836 shoe covernon woven (pair) 3837 short knee bracesize – l 3838 short knee bracesize – m 3839 short knee bracesize – s 3840 short knee bracesize – xl 3841 shoulder immobilizer (box pack)size – l 3842 shoulder immobilizer (box pack)size – m 3843 shoulder immobilizer (box pack)size – s 3844 shoulder immobilizer (box pack)size – xl 3845 single ball spirometer 3846 single dial venturi masksize adult & child 3847 single water trap ventilator(poly pack) adult 3848 single water trap ventilator(poly pack) child 3849 skin blade / razorstainless steel blade with platinum edge & teflon coated 3850 skin traction kit(poly pack) 3851 stomach tube(paper pack)size –20 3852 stomach tube(paper pack)size –22 3853 stomach tube(paper pack)size –24 3854 stomach tube(paper pack)size –26 3855 stomach tube(paper pack)size –28 3856 stomach tube(paper pack)size –30 3857 stomach tube(paper pack)size –32 3858 stool container50 ml 3859 stool containersize 30ml 3860 suction catheter with thumb control(paper pack)size fg 10 3861 suction catheter with thumb control(paper pack)size fg 12 3862 suction catheter with thumb control(paper pack)size fg 14 3863 suction catheter with thumb control(paper pack)size fg 16 3864 suction catheter with thumb control(paper pack)size fg 18 3865 suction catheter with thumb control(paper pack)size fg 20 3866 suction catheter with thumb control(paper pack)size fg 6 3867 suction catheter with thumb control(paper pack)size fg 8 3868 suction catheter(paper pack)sterile / disposable size fg 10 3869 suction catheter(paper pack)sterile / disposable size fg 12 3870 suction catheter(paper pack)sterile / disposable size fg 14 3871 suction catheter(paper pack)sterile / disposable size fg 16 3872 suction catheter(paper pack)sterile / disposable size fg 18 3873 suction catheter(paper pack)sterile / disposable size fg 20 3874 suction catheter(paper pack)sterile / disposable size fg 22 3875 suction catheter(paper pack)sterile / disposable size fg 6 3876 suction catheter(paper pack)sterile / disposable size fg 8 3877 surgeons gown (nonwoven)40gsmpacked in paper pouch 3878 surgical gloves latex: sterile: 6 3879 surgical gloves latex: sterile: 6.5 3880 surgical gloves latex: sterile: 7 3881 surgical gloves latex: sterile: 7.5 3882 surgical gloves latex: sterile: 8 3883 surgical gloves : latex: sterile: powder free 3884 surgical gown (nonwoven)25gsmpacked in paper pouch 3885 surgical gown (nonwoven)45gsmpacked in paper pouch 3886 surgical wrapped gownsize: xl 3887 t oxygenator with tubing(poly pack) 3888 t pcs(nebuliser)component 3889 tennis elbow supportsize – l 3890 tennis elbow supportsize – m 3891 tennis elbow supportsize – s 3892 tennis elbow supportsize – xl 3893 thumb spica splintsize –universal 3894 total hip replacement kitskin blade / razorstainless steel blade with platinum edge & teflon coated 3895 total knee replacement kit5 gowns, 5 helmet hood, 2 bed sheet,1 estimated drape, 1 bad sheet 48”*83” 3896 umbilical cathetersize – 4 3897 umbilical cathetersize – 5 3898 umbilical cathetersize – 6 3899 umbilical cathetersize – 7 3900 umbilical cathetersize – 8 3901 universal shoulder immobilizer (box pack)size – universal 3902 urethral cathetersize 10k (91k) to 14k (90k)packed in paper pouch pack 3903 urethral red rubber cathetersize 12 fr to 24 frpoly bagcartoon 3904 urinary leg bag capacity – 700 ml12 mic. tube length – 10” pvc non return valve, outlet, poly bagbora pack 3905 urine bag with hangercapacity – 2000 ml15 mic. tube length – 40” pvc non return valve, top outlet, plastic hangerpoly bagbora pack 3906 urine bag with hangercapacity – 2000 ml17 mic. tube length – 40” pvc non return valve, top outlet, plastic hangerpoly bagbora pack 3907 urine bag with hangercapacity – 2000 ml12 mic. tube length – 36” pvc non return valve, top outlet, plastic hangerpoly bagbora pack 3908 urine bagcapacity – 1500 ml8 mic. tube length – 28” pvc non return valve, top outlet, cotton threadpoly bagbora pack 3909 urine bagcapacity – 2000 ml10 mic. tube length – 32” pvc non return valve, top outletpoly bagbora pack 3910 urine bagcapacity – 2000 ml12 mic. tube length – 36” pvc non return valve, top outletpoly bagbora pack 3911 urine bagcapacity – 2000 ml15 mic. tube length – 40” pvc non return valve, top outletpoly bagbora pack 3912 urine bagcapacity – 2000 ml8 mic. tube length – 28” pvc non return valve, top outlet plastic threadpoly bagbora pack 3913 urine culture bottele50 ml 3914 urine culture bottelesize 30ml 3915 urine pot(poly pack)male /female(two in one)cartoon 3916 urometerwith 250 ml measured volume meter por measurement of urine output capacity – 2000 mlpacked in ribbon bag packpoly bagcartoon 3917 venturi mask with 7 duilters adjustablesize adult 3918 venturi mask with 7 duilters adjustablesize child 3919 vericose vein stockingsize – 2xl 3920 vericose vein stockingsize – 3xl 3921 vericose vein stockingsize – l 3922 vericose vein stockingsize – m 3923 vericose vein stockingsize – s 3924 vericose vein stockingsize – xl 3925 walking sticksize – l 3926 walking sticksize – m 3927 walking sticksize – s 3928 wrist & fore arm splintsize –universal 3929 wrist support with thumbsize – universal 3930 wrist supportsize – l 3931 wrist supportsize – m 3932 wrist supportsize – s 3933 yankeur suction set crown tip (ribbon poly pack) 3934 yankeur suction set plain tip (ribbon poly pack) 3935 zigzag absorbent cotton wool i.p400 gms 3936 zigzag absorbent cotton wool i.p500 gms 3937 acetone detection kit 3938 acid phosphatase (kinetic) 3939 albumin (bcg method) (liquistat) 3940 alkaline phosphatase (liquistat) (pnpp)nkinetic 3941 alkaline phosphatase (liquistat) (pnpp)nkinetic 3942 alkaline phosphatase (liquistat) (pnpp)nkinetic 3943 alkaline phosphatase (kinetic auto)n405 nm with extended stability 3944 alkaline phosphatase (kinetic auto)n405 nm with extended stability 3945 alkaline phosphatase (kinetic auto)n405 nm with extended stability 3946 ammonia ( uv kinetic) (liquistat) 3947 amylase (cnpg3) (liquistat) 3948 22% bovine serum albumin 3949 anti human globulin (coombs) 3950 anti a1 lectin 3951 aso turbilatex (quantitative) 3952 barium chloride 10% w/v 3953 benedicts reagent (qualitative) 3954 benedicts reagent (qualitative) 3955 bilirubin (liquistat) (dmso total & direct auto & manual) 3956 bilirubinn(dmso total & direct auto & manual) 3957 biochemistry calibrator (liquistat) (with multi parameter assigned value) 3958 neutral detergent for lab ware 3959 neutral detergent for lab ware 3960 microanatomy spray fixative 3961 detergent, deodorant 3962 blood grouping regent anti a 3963 blood grouping regent anti b 3964 blood grouping regent anti d 3965 blood grouping reagent combo (a + b + d) 3966 calcium (o cpc auto & manual)n(liquistat) 3967 calcium (o cpc auto & manual)n(liquistat) 3968 calcium (arsenezo iii) (liquistat) 3969 calcium (arsenezo iii) (liquistat) 3970 canada balsam (cytology mountant) 3971 carbol fuchsin (zn strong) 3972 carbol fuchsin (zn strong) 3973 urine strip g (glucose) 3974 urine strip g (glucose) 3975 urine strip ag (albumin & glucose) 3976 urine strip ag (albumin & glucose) 3977 urine strip agph (alb, glucose, ph) 3978 urine strip agph (alb, glucose, ph) 3979 urine strip kg (ketone & glucose) 3980 urine strip kg (ketone & glucose) 3981 urine strip 5p bln(alb, glucose, ph , ketone & blood) 3982 urine strip 5p bln(alb, glucose, ph , ketone & blood) 3983 urine strip 5p sg (alb,nglucose, ph , ketone & sg) 3984 urine strip 5p sg (alb,nglucose, ph , ketone & sg) 3985 chloride (thiocynate) 3986 chloride (thiocynate) 3987 cholesterol (ce co pap) (liquistat) 3988 cholesterol (ce co pap) (liquistat) 3989 cholesterol (ce co pap) (liquistat) 3990 cholesterol (ce co pap) (liquistat) 3991 cholesterol totaln(wybenga manual with hdl ppt reagent) 3992 cholinestrase (kinetic) 3993 pregnancy card test 3994 pregnancy strip test 3995 ckmb (ifcc kinetic) 3996 ckmb (ifcc kinetic) 3997 ck nac (ifcc) 3998 ck nac (ifcc) 3999 creatinine fk (kinetic) (liquistat) 4000 creatinine fk (kinetic) (liquistat) 4001 creatinine ep (liquistat) (manual end point jaffs) 4002 crystal violet (gention violet) 4003 crystal violet (gention violet) 4004 crp turbilatex (quantitative) 4005 csf diluting fluid 4006 csf protein (liquistat)n(auto & manual for urine micro proteins) 4007 cytochrom kit with buffer 2x (modified leishmans stain) 4008 cytology collection kit 4009 de colouriser for hematoxylene (1% hcl in a.a.) 4010 demineralised water (reagent grade) 4011 distilled water (biochemistry grade) 4012 distilled water (biochemistry grade) 4013 distilled water (double) (flame photometry) 4014 distilled water (double) (flame photometry) 4015 direct hdl (liquistat) 4016 direct ldl (liquistat) 4017 double oxalate solution 4018 dpx mountant (cytology mountant) 4019 drabkins solution with standard (for hb) 4020 drabkins solution with standard (for hb) 4021 easyfix spray (blood smear fixative) 4022 edta 5% w/v 4023 edta 5% w/v 4024 edta k3 concentraten(dropping bottle) 4025 edta k3 concentraten(dropping bottle) 4026 electrolyte (na+,k+,cl+) new (liquistat) (auto colorimetric) 4027 eosin 2% (for hematoxylin stain) 4028 eosin 2% (for hematoxylin stain) 4029 eosinophil diluting fluid 4030 field stain a 4031 field stain a 4032 field stain a 4033 field stain b 4034 field stain b 4035 field stain b 4036 field stain a & bn(combined kit with easyfix spray fixative) 4037 flow cell cleaner (ready to use) 4038 fluoride concentraten(dropping bottle) 4039 fluoride concentraten(dropping bottle) 4040 formal saline (fornhistology sample preservation) 4041 flouride solution (pot.noxalate 5%, flouride 1%) 4042 flouride solution (pot.noxalate 5%, flouride 1%) 4043 fouchet’s reagent 4044 gamma gt (ifcc kinetic) (liquistat) 4045 geimsa stain kit (withnbuffer 10x & easyfix spray) 4046 grams iodine 4047 grams iodine 4048 glucose (god pod) 4049 glucose (god pod) 4050 glucose (god pod) (liquistat) 4051 glucose (god pod) (liquistat) 4052 glycerin purified 4053 got (ast) kinetic (liquistat) 4054 got (ast) kinetic (liquistat) 4055 got (ast) kinetic (liquistat) 4056 gpt (alt) kinetic (liquistat) 4057 gpt (alt) kinetic (liquistat) 4058 gpt (alt) kinetic (liquistat) 4059 gram’s stain kit (ready to use) 4060 g 6pdh (screening) 4061 g 6pdh (quantitative, uv) kinetic 4062 haemoglobin std (cynmeth) 4063 heamoglobin with std. (liquistat)(fe cyan)n(ready to use drabkin’s reagent with hb std) 4064 heamoglobin with std. (liquistat)(fe cyan)n(ready to use drabkin’s reagent with hb std) 4065 heamtest (for occult blood with positive & negative control) 4066 sugarstrips (occult blood strips) 4067 hematoxylene (harris) 4068 hematoxylene (harris) 4069 hydrochloric acid n/10 4070 hydrochloric alcohol (for aafb) 4071 immersion oil (microscopy grade) dropping bottle 4072 immersion oil (microscopy grade) dropping bottle 4073 iron tibc (ferrozin) 4074 ldh (uv kinetic) (liquistat) 4075 lipase (liquistat) 4076 lipase (liquistat) 4077 liquid paraffin 4078 lugol’s iodine 4079 magnesium (calmagite)(liqui) 4080 methylene blue 4081 methylene blue 4082 micro protein (pyrogallol red) 4083 micro protein (turbidometry) 4084 opticare microscope lens cleaner 4085 papanicolaou ea 36 4086 papanicolaou ea 36 4087 papanicolaou ea 65 4088 papanicolaou ea 65 4089 papanicolaou og 6 4090 papanicolaou og 6 4091 paraffin wax 58° 60°c with cerecin 4092 phosphorus (end point) new (liquistat) 4093 platelet diluting fluid 4094 potassium (stpb) (liquistat) 4095 pot. oxalate fluoride (concentrate) 4096 pot. oxalate fluoride (concentrate) 4097 protein (biuret) (liquistat) 4098 rapid afb stain kit (cold method)) 4099 rapid bile pigment reagent 4100 rapid dengue (card) ns1 4101 rapid dengue(igg/igm and ns1 (card) combo 4102 rapid fructose kit (withnpositive control) 4103 rapid h & e stain kit (onlyn03 minute h & e staining kit) 4104 rapid hbsag (card) 4105 rapid hiv 1 & 2 (card) 4106 rapid hcv (card) 4107 rapid hcv (card) 4108 rapid sickle cell hbs new (solubility test) (liquistat) with accessories 4109 rapid thalassemia (nestroff reagent) 4110 rapid malaria pf / pv (card test) 4111 rapid malaria stain kit (jsb i & ii) (onenminute stain for blood parasite) 4112 rapid mp stain kitn(one minute stain for blood parasite) 4113 rapid pap stain kitn(a3 minute pap staining kit) 4114 rapid pap cytoplasm stain a 4115 rapid pap cytoplasm stain b 4116 rapid pap dehydrant 4117 rapid pap nuclear stain 4118 rapid aso (latex slide test) 4119 rapid aso (latex slide test) 4120 rapid aso (latex slide test) 4121 rapid crp (latex slide test) 4122 rapid crp (latex slide test) 4123 rapid crp (latex slide test) 4124 rapid ra (latex slide test) 4125 rapid ra (latex slide test) 4126 rapid ra (latex slide test) 4127 rapid widal (o, h, ah, bh) slide test 4128 rapid widal (o, & h) slide test 4129 rbc diluting fluid 4130 reticulocyte counting reagent 4131 reticview (with counter stain & buffer) 4132 rf turbilatex (rheumtoid factor) quantitative 4133 r.p.r. (vdrl test) (ready to use slide test) 4134 r.p.r. (vdrl test) (ready to use slide test) 4135 r.p.r. (vdrl test) (ready to use slide test) 4136 safranine 0.5% w/v (grams) 4137 safranine 0.5% w/v (grams) 4138 saneat liquid soapn(phosphate free) (extra powder & fragnance) with dispenser 4139 saneat liquid soapn(phosphate free) (extra powder & fragnance) with dispenser 4140 saneat liquid soapn(phosphate free) (extra powder & fragnance) with dispenser 4141 scott’s tap water substitute 4142 semen diluting fluid 4143 sodium (phosphonazo iii) new (liquistat) 4144 sodium citrate 3.2% w/v 4145 sodium citrate 3.8% w/v 4146 sodium hypochloriten(4% available chlorine) 4147 sodium hypochloriten(4% available chlorine) 4148 sodium pottassium std 120/2n(for flame photometer 140/4n(ready to use) 160/6 4149 sodium pottassium std 120/2n(for flame photometer 140/4n(ready to use) 160/6 4150 sodium pottassium std 120/2n(for flame photometer 140/4n(ready to use) 160/6 4151 sod / pot / chlo (liquistat) (u. acetate, stpb, thiocynate) 4152 sgot (manual dnph) 4153 sgpt (manual dnph) 4154 sulphuric acid 20% 4155 sulphosalicylic acid 3% w/v 4156 sulphosalicylic acid 30 % w/v 4157 sulphosalicylic acid 30 % w/v 4158 syphilis (strip) 4159 syphilis (card) 4160 total protein & albumin (biuret &nbcg ) (liquistat) 4161 triglycerides (enz. end point) (liquistat) 4162 triglycerides (enz. end point) (liquistat) 4163 triglycerides (enz. end point) (li